Evaluation of a Highly Efficient DNA Extraction Method for Bacillus anthracis Endospores
Abstract
1. Introductions
2. Materials and Methods
2.1. Strains and Culture Conditions
2.2. Bacterial Standard for DNA Extraction Procedures
2.3. Spore Production and Purification
2.4. DNA Extraction
2.4.1. Extraction of DNA Using Commercial Kits
2.4.2. Modified DNA Extraction Protocol for the MasterPure Complete DNA and RNA Purification Kit
2.5. qPCR Assay
2.6. DNA Yield and Quality
2.7. DNA Integrity
2.8. Extraction of DNA from B. anthracis Spores
2.9. Spore Treatment with Propidium Monoazide (PMA)
2.10. Spore Microscopy
2.11. Copy Number Analysis Using Digital Droplet PCR
2.12. Whole Genome Sequencing
3. Results
3.1. Comparison of DNA Extraction Kits
3.1.1. Characteristics of DNA Extraction Kits
3.1.2. DNA Extraction Method Greatly Impacts DNA Yield
3.1.3. An Improved DNA Extraction for Superior DNA Yields
3.1.4. DNA Extraction Method Impacts the Quality of Sequencing Results
3.2. DNA Can Be Effectively Extracted from Within B. anthracis Spores
3.2.1. Commercial DNA Extraction Kits Are Not Suitable to Lyse Spores
3.2.2. Bead-Beating Enables Effective Lysis of B. anthracis Spores for Subsequent DNA Extraction
3.2.3. An Improved Protocol for Highest Efficiency of DNA Extraction from within B. anthracis Spores
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dragon, D.C.; Rennie, R.P. The ecology of anthrax spores: Tough but not invincible. Can. Vet. J. 1995, 36, 7. [Google Scholar]
- Giorno, R.; Bozue, J.; Cote, C.; Wenzel, T.; Moody, K.-S.; Mallozzi, M.; Ryan, M.; Wang, R.; Zielke, R.; Maddock, J.R.; et al. Morphogenesis of the Bacillus anthracis Spore. J. Bacteriol. 2007, 189, 691–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atlas, R.M. Bioterrorism: From Threat to Reality. Annu. Rev. Microbiol. 2002, 56, 167–185. [Google Scholar] [CrossRef] [Scilit]
- Riedel, S. Anthrax: A Continuing Concern in the Era of Bioterrorism. Bayl. Univ. Med. Cent. Proc. 2005, 18, 234–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamborrini, M.; Oberli, M.A.; Werz, D.B.; Schürch, N.; Frey, J.; Seeberger, P.H.; Pluschke, G. Immuno-detection of anthrose containing tetrasaccharide in the exosporium of Bacillus anthracis and Bacillus cereus strains. J. Appl. Microbiol. 2009, 106, 1618–1628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knisely, R.F. Selective medium for Bacillus anthracis. J. Bacteriol. 1966, 92, 784–786. [Google Scholar] [CrossRef] [Scilit]
- Fan, J.; Kraft, A.J.; Henrickson, K.J. Current methods for the rapid diagnosis of bioterrorism-related infectious agents. Pediatr. Clin. North Am. 2006, 53, 817–842. [Google Scholar] [CrossRef] [Scilit]
- Niemz, A.; Ferguson, T.M.; Boyle, D.S. Point-of-care nucleic acid testing for infectious diseases. Trends Biotechnol. 2011, 29, 240–250. [Google Scholar] [CrossRef] [Scilit]
- Fauver, J.R.; Martin, J.; Weil, G.J.; Mitreva, M.; Fischer, P.U. De novo assembly of the Brugia malayi genome using long reads from a single MinION flowcell. Sci. Rep. 2019, 9, 19521. [Google Scholar] [CrossRef] [Scilit]
- Akane, A.; Matsubara, K.; Nakamura, H.; Takahashi, S.; Kimura, K. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J. Forensic Sci. 1994, 39, 13607J. [Google Scholar] [CrossRef] [Scilit]
- Monteiro, L.; Bonnemaison, D.; Vekris, A.; Petry, K.G.; Bonnet, J.; Vidal, R.; Cabrita, J.; Mégraud, F. Complex polysaccharides as PCR inhibitors in feces: Helicobacter pylori model. J. Clin. Microbiol. 1997, 35, 995–998. [Google Scholar] [CrossRef] [Scilit]
- Sidstedt, M.; Jansson, L.; Nilsson, E.; Noppa, L.; Forsman, M.; Rådström, P.; Hedman, J. Humic substances cause fluorescence inhibition in real-time polymerase chain reaction. Anal. Biochem. 2015, 487, 30–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Heesch, S.; Mokry, M.; Boskova, V.; Junker, W.; Mehon, R.; Toonen, P.; de Bruijn, E.; Shull, J.D.; Aitman, T.J.; Cuppen, E.; et al. Systematic biases in DNA copy number originate from isolation procedures. Genome Biol. 2013, 14, R33. [Google Scholar] [CrossRef] [Scilit]
- Zielińska, S.; Radkowski, P.; Blendowska, A.; Ludwig-Gałęzowska, A.; Łoś, J.M.; Łoś, M. The choice of the DNA extraction method may influence the outcome of the soil microbial community structure analysis. MicrobiologyOpen 2017, 6, e00453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shehadul Islam, M.; Aryasomayajula, A.; Selvaganapathy, P. A Review on macroscale and microscale cell lysis methods. Micromachines 2017, 8, 83. [Google Scholar] [CrossRef] [Scilit]
- Roopnarain, A.; Mukhuba, M.; Adeleke, R.; Moeletsi, M. Biases during DNA extraction affect bacterial and archaeal community profile of anaerobic digestion samples. 3 Biotech 2017, 7, 375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malvar, T.; Gawron-Burke, C.; Baum, J.A. Overexpression of Bacillus thuringiensis HknA, a histidine protein kinase homology, bypasses early Spo mutations that result in CryIIIA overproduction. J. Bacteriol. 1994, 176, 4742–4749. [Google Scholar] [CrossRef] [Scilit]
- Antwerpen, M.H.; Zimmermann, P.; Bewley, K.; Frangoulidis, D.; Meyer, H. Real-time PCR system targeting a chromosomal marker specific for Bacillus anthracis. Mol. Cell. Probes 2008, 22, 313–315. [Google Scholar] [CrossRef] [Scilit]
- Nocker, A.; Cheung, C.-Y.; Camper, A. Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. J. Microbiol. Methods 2006, 67, 310–320. [Google Scholar] [CrossRef] [Scilit]
- Probst, A.; Mahnert, A.; Weber, C.; Haberer, K.; Moissl-Eichinger, C. Detecting inactivated endospores in fluorescence microscopy using propidium monoazide. Int. J. Astrobiol. 2012, 11, 117–123. [Google Scholar] [CrossRef] [Scilit]
- Lang, R.D.; Nermut, M.V.; Williams, L.D. Ultrastructure of sheep erythrocyte plasma membranes and cytoskeletons bound to solid supports. J. Cell Sci. 1981, 49, 383–399. [Google Scholar] [PubMed]
- Laue, M.; Bannert, N. Detection limit of negative staining electron microscopy for the diagnosis of bioterrorism-related microorganisms. J. Appl. Microbiol. 2010, 109, 1159–1168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abusleme, L.; Hong, B.-Y.; Dupuy, A.K.; Strausbaugh, L.D.; Diaz, P.I. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing. J. Oral Microbiol. 2014, 6, 23990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ketchum, R.N.; Smith, E.G.; Vaughan, G.O.; Phippen, B.L.; McParland, D.; Al-Mansoori, N.; Carrier, T.J.; Burt, J.A.; Reitzel, A.M. DNA extraction method plays a significant role when defining bacterial community composition in the marine invertebrate Echinometra mathaei. Front. Mar. Sci. 2018, 5, 255. [Google Scholar] [CrossRef] [Scilit]
- Gill, C.; van de Wijgert, J.H.H.M.; Blow, F.; Darby, A.C. Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota. PLoS ONE 2016, 11, e0163148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bag, S.; Saha, B.; Mehta, O.; Anbumani, D.; Kumar, N.; Dayal, M.; Pant, A.; Kumar, P.; Saxena, S.; Allin, K.H.; et al. An improved method for high quality metagenomics DNA extraction from human and environmental samples. Sci. Rep. 2016, 6, 26775. [Google Scholar] [CrossRef] [Scilit]
- Bartram, A.; Poon, C.; Neufeld, J. Nucleic acid contamination of glycogen used in nucleic acid precipitation and assessment of linear polyacrylamide as an alternative co-precipitant. BioTechniques 2009, 47, 1019–1022. [Google Scholar] [CrossRef] [Scilit]
- Tan, S.; Dvorak, C.M.T.; Estrada, A.A.; Gebhart, C.; Marthaler, D.G.; Murtaugh, M.P. MinION sequencing of Streptococcus suis allows for functional characterization of bacteria by multilocus sequence typing and antimicrobial resistance profiling. J. Microbiol. Methods 2019, 169, 105817. [Google Scholar] [CrossRef] [Scilit]
- Carrigg, C.; Rice, O.; Kavanagh, S.; Collins, G.; O’Flaherty, V. DNA extraction method affects microbial community profiles from soils and sediment. Appl. Microbiol. Biotechnol. 2007, 77, 955–964. [Google Scholar] [CrossRef] [Scilit]
- Tyler, A.D.; Mataseje, L.; Urfano, C.J.; Schmidt, L.; Antonation, K.S.; Mulvey, M.R.; Corbett, C.R. Evaluation of Oxford Nanopore’s MinION sequencing device for microbial whole genome sequencing applications. Sci. Rep. 2018, 8, 10931. [Google Scholar] [CrossRef] [Scilit]
- Krishnakumar, R.; Sinha, A.; Bird, S.W.; Jayamohan, H.; Edwards, H.S.; Schoeniger, J.S.; Patel, K.D.; Branda, S.S.; Bartsch, M.S. Systematic and stochastic influences on the performance of the MinION nanopore sequencer across a range of nucleotide bias. Sci. Rep. 2018, 8, 3159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Tongeren, S.P.; Degener, J.E.; Harmsen, H.J.M. Comparison of three rapid and easy bacterial DNA extraction methods for use with quantitative real-time PCR. Eur. J. Clin. Microbiol. Infect. Dis. Off. Publ. Eur. Soc. Clin. Microbiol. 2011, 30, 1053–1061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, M.C.; Shields, M.J.; Hahn, K.R.; Janzen, T.W.; Goji, N.; Amoako, K.K. Evaluation of DNA extraction methods for Bacillus anthracis spores isolated from spiked food samples. J. Appl. Microbiol. 2013, 115, 156–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brauge, T.; Faille, C.; Inglebert, G.; Dubois, T.; Morieux, P.; Slomianny, C.; Midelet-Bourdin, G. Comparative evaluation of DNA extraction methods for amplification by qPCR of superficial vs intracellular DNA from Bacillus spores. Int. J. Food Microbiol. 2018, 266, 289–294. [Google Scholar] [CrossRef] [Scilit]
- Johns, M.; Harrington, L.; Titball, R.W.; Leslie, D.L. Improved methods for the detection of Bacillus anthracis spores by the polymerase chain reaction. Lett. Appl. Microbiol. 2008, 18, 236–238. [Google Scholar] [CrossRef] [Scilit]
- Vandeventer, P.E.; Weigel, K.M.; Salazar, J.; Erwin, B.; Irvine, B.; Doebler, R.; Nadim, A.; Cangelosi, G.A.; Niemz, A. Mechanical disruption of lysis-resistant bacterial cells by use of a miniature, low-power, disposable device. J. Clin. Microbiol. 2011, 49, 2533. [Google Scholar] [CrossRef] [Scilit]
- de Lipthay, J.R.; Enzinger, C.; Johnsen, K.; Aamand, J.; Sørensen, S.J. Impact of DNA extraction method on bacterial community composition measured by denaturing gradient gel electrophoresis. Soil Biol. Biochem. 2004, 36, 1607–1614. [Google Scholar] [CrossRef] [Scilit]
- Salonen, A.; Nikkilä, J.; Jalanka-Tuovinen, J.; Immonen, O.; Rajilić-Stojanović, M.; Kekkonen, R.A.; Palva, A.; de Vos, W.M. Comparative analysis of fecal DNA extraction methods with phylogenetic microarray: Effective recovery of bacterial and archaeal DNA using mechanical cell lysis. J. Microbiol. Methods 2010, 81, 127–134. [Google Scholar] [CrossRef] [Scilit]
- Fujimoto, S.; Nakagami, Y.; Kojima, F. Optimal bacterial DNA isolation method using bead-beating technique. Mem. Kyushu Univ Dep Health Scis Med. Sch 2004, 3, 33–38. [Google Scholar]
- Starke, R.; Jehmlich, N.; Alfaro, T.; Dohnalkova, A.; Capek, P.; Bell, S.; Hofmockel, K. Incomplete cell disruption of resistant microbes. Sci. Rep. 2019, 9, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Burd, E.M. Validation of laboratory-developed molecular assays for infectious diseases. Clin. Microbiol. Rev. 2010, 23, 550–576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shipley, M.A.; Koehler, J.W.; Kulesh, D.A.; Minogue, T.D. Comparison of nucleic acid extraction platforms for detection of select biothreat agents for use in clinical resource limited settings. J. Microbiol. Methods 2012, 91, 179–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luk, A.W.; Beckmann, S.; Manefield, M. Dependency of DNA extraction efficiency on cell concentration confounds molecular quantification of microorganisms in groundwater. FEMS Microbiol. Ecol. 2018, 94, fiy146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicholson, W.L.; Munakata, N.; Horneck, G.; Melosh, H.J.; Setlow, P. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol. Mol. Biol. Rev. 2000, 64, 548–572. [Google Scholar] [CrossRef] [Scilit]
- Létant, S.E.; Murphy, G.A.; Alfaro, T.M.; Avila, J.R.; Kane, S.R.; Raber, E.; Bunt, T.M.; Shah, S.R. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples. Appl. Environ. Microbiol. 2011, 77, 6570–6578. [Google Scholar] [CrossRef] [Scilit]
- Rantakokko-Jalava, K.; Viljanen, M.K. Application of Bacillus anthracis PCR to simulated clinical samples. Clin. Microbiol. Infect. 2003, 9, 1051–1056. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Blanch, J.F.; Sanchez, G.; Garay, E.; Aznar, R. Evaluation of a real-time PCR assay for the detection and quantification of Bacillus cereus group spores in food. J. Food Prot. 2010, 73, 1480–1485. [Google Scholar] [CrossRef] [Scilit]
- Luna, V.A.; King, D.; Davis, C.; Rycerz, T.; Ewert, M.; Cannons, A.; Amuso, P.; Cattani, J. Novel sample preparation method for safe and rapid detection of Bacillus anthracis spores in environmental powders and nasal swabs. J. Clin. Microbiol. 2003, 41, 1252. [Google Scholar] [CrossRef] [Scilit]
- Aslan, K.; Previte, M.J.R.; Zhang, Y.; Gallagher, T.; Baillie, L.; Geddes, C.D. Extraction and detection of DNA from Bacillus anthracis spores and the vegetative cells within 1 min. Anal. Chem. 2008, 80, 4125–4132. [Google Scholar] [CrossRef] [Scilit]
- Dineen, S.M.; Aranda, R., 4th; Anders, D.L.; Robertson, J.M. An evaluation of commercial DNA extraction kits for the isolation of bacterial spore DNA from soil. J. Appl. Microbiol. 2010, 109, 1886–1896. [Google Scholar] [CrossRef] [Scilit]
- De Bruin, O.M.; Chiefari, A.; Wroblewski, D.; Egan, C.; Kelly-Cirino, C.D. A novel chemical lysis method for maximum release of DNA from difficult-to-lyse bacteria. Microb. Pathog. 2019, 126, 292–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Boer, R.; Peters, R.; Gierveld, S.; Schuurman, T.; Kooistra-Smid, M.; Savelkoul, P. Improved detection of microbial DNA after bead-beating before DNA isolation. J. Microbiol. Methods 2010, 80, 209–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Commercial Kit | Manufacturer | Cell Disruption Method * |
|---|---|---|
| DNA MinipPrep kit | ZymoBIOMICS | BB/ SB |
| DNeasy Blood and Tissue kit | Qiagen | PL + CL/ SB |
| DNeasy PowerSoil kit | Qiagen | BB/ SB |
| DNeasy Ultra Clean Microbial kit | Qiagen | BB/ SB |
| Echolution Tissue DNA Micro kit | BioECHO | PL + CL/ SB |
| GenElute Bacterial Genomic DNA kit | Sigma Aldrich | PL + CL/ SB |
| In-house protocol, based on DNA Investigator kit | Qiagen | BB/ SB |
| innu PREP DNA Mini kit | Analytik Jena | PL + CL/ SB |
| MagJet Genomic DNA kit | Thermo Scientific | PL + CL/ MP |
| MasterPure Complete DNA & RNA Purification kit | Lucigen | PL + CL/ SP |
| nexttec 1-step DNA isolation kit for Bacteria | Biozym | PL + CL/ SB |
| NucleoSpin Microbial DNA Mini kit | Machery & Nagel | BB/ SB |
| PureLink Microbiome DNA Purification kit | Thermo Scientific | BB/ SB |
| QIAamp Cador pathogen Mini kit | Qiagen | PL + CL/ SB |
| QIAamp DNA Mini kit | Qiagen | PL + CL/ SB |
| QIAamp UCP Pathogen Mini kit | Qiagen | BB/ SB |
| QIAmp DNA Microbiome kit | Qiagen | BB/ SB |
| RTP Bacteria DNA Mini kit | Stratec Molecular | PL + CL/ SB |
| smart DNA prep | Analytik Jena | CL/ MP |
| Wizard Genomic DNA Purification kit | Promega | PL + CL/ SP |
| Name | Sequence [5–3′] | Reference |
|---|---|---|
| dhp61_183-113F | CGTAAGGACAATAAAAGCCGTTGT | [18] |
| dhp61_183-208R | CGATACAGACATTTATTGGGAACTACAC | [18] |
| dhp61_183-143T | 6FAM-TGCAATCGATGAGCTAATGAACAATGACCCT-TMR | [18] |
| Fran_F | GAGCGCAACCCCTATTGATA | this study |
| Fran_R | TTTTTGAGTTTCGCTCCAGCT | this study |
| Fran_TM | 6FAM-CTATTGAGACTGCCGCTGACAAGGC-BBQ | this study |
| No. | Commercial Kit | Cell Disruption Method * | Completion Time ** [min] | Average Cost *** [€/Sample] |
|---|---|---|---|---|
| 1 | MasterPure Complete DNA and RNA Purification kit | PL + CL/SP | 90 | 2.23 |
| 2 | In-house protocol, based on DNA Investigator kit | BB/ SB | 180 | 6.13 |
| 3 | innu PREP DNA Mini kit | PL + CL/SB | 90 | 2.44 |
| 4 | GenElute Bacterial Genomic DNA kit | PL + CL/SB | 90 | 3.08 |
| 5 | DNeasy Ultra Clean Microbial kit | BB/ SB | 50 | 2.79 |
| 6 | QIAamp DNA Mini kit | PL + CL/SB | 150 | 3.90 |
| 7 | NucleoSpin Microbial DNA | BB/ SB | 40 | 3.50 |
| 8 | DNeasy Blood and Tissue kit | PL + CL/SB | 90 | 3.74 |
| 9 | MagJet Genomic DNA kit | PL + CL/MP | 150 | 3.06 |
| 10 | PureLink Microbiome DNA Purification kit | BB/SB | 60 | 6.64 |
| 11 | Wizard Genomic DNA Purification kit | PL + CL/SP | 180 | 2.49 |
| 12 | QIAamp Cador pathogen Mini kit | PL + CL/SB | 180 | 6.24 |
| 13 | DNA Mini Prep | BB/SB | 60 | 6.52 |
| 14 | DNeasy PowerSoil kit | BB/SB | 50 | 6.43 |
| 15 | nexttec 1-step DNA isolation kit for Bacteria | PL + CL/SB | 60 | 2.69 |
| 16 | QIAamp UCP Pathogen Mini kit | BB/SB | 60 | 4.86 |
| 17 | RTP Bacteria DNA Mini kit | PL + CL/SB | 75 | 3.89 |
| 18 | smart DNA prep | CL/MP | 150 | 3.40 |
| 19 | Echolution Tissue DNA Micro kit | PL + CL/SB | 60 | 3.42 |
| 20 | QIAmp DNA Microbiome kit | BB/ SB | 160 | 16.97 |
| Sample | Concentration Spores [CFU] | Ct Values | |
|---|---|---|---|
| Co | 108 | 27.38 ± 0.17 | |
| TL | 1 min | 108 | 19.09 ± 0.09 |
| 5 min | 108 | 19.02 ± 0.04 | |
| 10 min | 108 | 19.46 ± 0.19 | |
| FP | 1 min | 108 | 19.09 ± 0.13 |
| 2 × 1 min | 108 | 19.48 ± 0.01 | |
| 3 min | 108 | 19.54 ± 0.04 | |
| 5 min | 108 | 20.45 ± 0.28 | |
| Type of beads | Co | 106 | 35.16 ± 0.55 |
| Pathogen lysis tubes S | 106 | 28.77 ± 0.20 | |
| Glass beads, 0.5 mm | 106 | 25.92 ± 0.12 | |
| PowerBead Tubes, 0.1 mm | 106 | 25.72 ± 0.08 | |
| Amount beads | Co | 108 | 27.60 ± 0.01 |
| 200 mg | 108 | 19.03 ± 0.18 | |
| 500 mg | 108 | 19.60 ± 0.23 | |
| 1000 mg | 108 | 20.85 ± 0.04 | |
| Volume sample | 200 µL | 106 | 26.85 ± 0.03 |
| 500 µL | 106 | 26.00 ± 0.08 | |
| 1000 µL | 106 | 25.98 ± 0.04 | |
| Sample | Concentration Spores [CFU] | Ct Values |
|---|---|---|
| Suspension of untreated B. anthracis spores (control) | 106 | 34.08 ± 0.01 |
| QIAmp DNA Mini kit | 106 | 28.30 ± 0.23 |
| In-house protocol, based on DNA Investigator kit | 106 | 24.76 ± 1.02 |
| MasterPure kit, lysis supernatant | 106 | 25.99 ± 0.10 |
| MasterPure kit, debris pellet | 106 | 25.40 ± 0.30 |
| In-house protocol, based on DNA Investigator kit | 103 | 36.87 ± 1.10 |
| MasterPure kit (lysis supernatant + debris pellet) * | 103 | 34.01 ± 0.97 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Knüpfer, M.; Braun, P.; Baumann, K.; Rehn, A.; Antwerpen, M.; Grass, G.; Wölfel, a.R. Evaluation of a Highly Efficient DNA Extraction Method for Bacillus anthracis Endospores. Microorganisms 2020, 8, 763. https://doi.org/10.3390/microorganisms8050763
Knüpfer M, Braun P, Baumann K, Rehn A, Antwerpen M, Grass G, Wölfel aR. Evaluation of a Highly Efficient DNA Extraction Method for Bacillus anthracis Endospores. Microorganisms. 2020; 8(5):763. https://doi.org/10.3390/microorganisms8050763
Chicago/Turabian StyleKnüpfer, Mandy, Peter Braun, Kathrin Baumann, Alexandra Rehn, Markus Antwerpen, Gregor Grass, and and Roman Wölfel. 2020. "Evaluation of a Highly Efficient DNA Extraction Method for Bacillus anthracis Endospores" Microorganisms 8, no. 5: 763. https://doi.org/10.3390/microorganisms8050763
APA StyleKnüpfer, M., Braun, P., Baumann, K., Rehn, A., Antwerpen, M., Grass, G., & Wölfel, a. R. (2020). Evaluation of a Highly Efficient DNA Extraction Method for Bacillus anthracis Endospores. Microorganisms, 8(5), 763. https://doi.org/10.3390/microorganisms8050763
