Cloacal and Ocular Microbiota of the Endangered Australian Northern Quoll
Abstract
1. Introduction
2. Method
2.1. Northern Quolls Sample Collection and Processing
2.1.1. Sample Collection
2.1.2. DNA Extraction
2.1.3. 16S rRNA Gene Library Preparation and Sequencing
2.2. Other Marsupial Sample Collection and Processing
2.2.1. Sample Collection and DNA Extraction
2.2.2. 16S rRNA Gene Library Preparation and Sequencing
2.2.3. 16S rRNA Gene Sequence Analysis
3. Results
3.1. Sequencing Data
3.2. Northern Quoll Taxonomic Summary
3.3. Chlamydiales Detection is Not Correlated with Changes in the Northern Quoll Microbiota
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Johnson, C.N.; Isaac, J.L.; Fisher, D.O. Rarity of a top predator triggers continent-wide collapse of mammal prey: Dingoes and marsupials in Australia. Proc. Biol. Sci. 2007, 274, 341–346. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, E.G.; Johnson, C.N. Predator interactions, mesopredator release and biodiversity conservation. Ecol. Lett. 2009, 12, 982–998. [Google Scholar] [CrossRef] [PubMed]
- Braithwaite, R.W.; Griffiths, A.D. Demographic variation and range contraction in the northern quoll, Dasyurus hallucatus (MArsupialia, Dasyuridae). Wildl. Res. 1994, 21, 203–217. [Google Scholar] [CrossRef]
- Department of Enviroment and Energy. Dasyurus hallucatus in Species Profile and Threats Database. Available online: http://www.environment.gov.au/cgi-bin/sprat/public/publicspecies.pl?taxon_id=331 (accessed on 22 May 2018).
- Woinarski, J.C.Z.; Risler, J.; Kean, L. Response of vegetation and vertebrate fauna to 23 years of fire exclusion in a tropical Eucalyptus open forest, Northern Territory, Australia. Austral Ecol. 2004, 29, 156–176. [Google Scholar] [CrossRef]
- Oakwood, M. Reproduction and demography of the northern quoll, Dasyurus hallucatus, in the lowland savanna of Northern Australia. Aust. J. Zool. 2000, 48, 519–539. [Google Scholar] [CrossRef]
- Woinarski, J.C.Z.; Armstrong, M.; Brennan, K.; Fisher, A.; Griffiths, A.D.; Hill, B.; Milne, D.J.; Palmer, C.; Ward, S.; Watson, M.; et al. Monitoring indicates rapid and severe decline of native small mammals in Kakadu National Park, northern Australia. Wildl. Res. 2010, 37, 116–126. [Google Scholar] [CrossRef]
- Rankmore, B.R.; Griffiths, A.D.; Woinarski, J.C.Z.; Ganambarr, B.L.; Taylor, R.; Brennan, K.; Firestone, K.; Cardoso, M. Island Translocation of the Northern Quoll Dasyurus hallucatus as a Conservation Response to the Spread of the Cane Toad Chaunus (bufo) marinus in the Northern Territory, Australia; Trust, N.H., Ed.; Australian Government: Canberra, Australia, 2008.
- O’Donnell, S.; Webb, J.K.; Shine, R. Conditioned taste aversion enhances the survival of an endangered predator imperilled by a toxic invader. J. Appl. Ecol. 2010, 47, 558–565. [Google Scholar] [CrossRef]
- How, R.A.; Spencer, P.B.S.; Schmitt, L.H. Island populations have high conservation value for northern Australia’s top marsupial predator ahead of a threatening process. J. Zool. 2009, 278, 206–217. [Google Scholar] [CrossRef]
- Jolly, C.J.; Kelly, E.; Gillespie, G.R.; Phillips, B.; Webb, J.K. Out of the frying pan: Reintroduction of toad-smart northern quolls to southern Kakadu National Park. Austral Ecol. 2018, 43, 139–149. [Google Scholar] [CrossRef]
- Gilbert, J.A.; Blaser, M.J.; Caporaso, J.G.; Jansson, J.K.; Lynch, S.V.; Knight, R. Current understanding of the human microbiome. Nat. Med. 2018, 24, 392–400. [Google Scholar] [CrossRef] [PubMed]
- Nishida, A.; Inoue, R.; Inatomi, O.; Bamba, S.; Naito, Y.; Andoh, A. Gut microbiota in the pathogenesis of inflammatory bowel disease. Clin. J. Gastroenterol. 2018, 11, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Ravel, J.; Brotman, R.M.; Gajer, P.; Ma, B.; Nandy, M.; Fadrosh, D.W.; Sakamoto, J.; Koenig, S.S.; Fu, L.; Zhou, X.; et al. Daily temporal dynamics of vaginal microbiota before, during and after episodes of bacterial vaginosis. Microbiome 2013, 1, 29. [Google Scholar] [CrossRef] [PubMed]
- Malmuthuge, N.; Guan, L.L. Understanding host-microbial interactions in rumen: Searching the best opportunity for microbiota manipulation. J. Anim. Sci. Biotechnol. 2017, 8, 8. [Google Scholar] [CrossRef] [PubMed]
- Fouhse, J.M.; Zijlstra, R.T.; Willing, B.P. The role of gut microbiota in the health and disease of pigs. Anim. Front. 2016, 6, 30–36. [Google Scholar] [CrossRef]
- Amato, K.R.; Yeoman, C.J.; Kent, A.; Righini, N.; Carbonero, F.; Estrada, A.; Gaskins, H.R.; Stumpf, R.M.; Yildirim, S.; Torralba, M.; et al. Habitat degradation impacts black howler monkey (Alouatta pigra) gastrointestinal microbiomes. ISME J. 2013, 7, 1344–1353. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Wu, Q.; Dai, J.; Zhang, S.; Wei, F. Evidence of cellulose metabolism by the giant panda gut microbiome. Proc. Natl. Acad. Sci. USA 2011, 108, 17714–17719. [Google Scholar] [CrossRef] [PubMed]
- Shiffman, M.E.; Soo, R.M.; Dennis, P.G.; Morrison, M.; Tyson, G.W.; Hugenholtz, P. Gene and genome-centric analyses of koala and wombat fecal microbiomes point to metabolic specialization for Eucalyptus digestion. PeerJ 2017, 5, e4075. [Google Scholar] [PubMed]
- Cheng, Y.; Fox, S.; Pemberton, D.; Hogg, C.; Papenfuss, A.T.; Belov, K. The Tasmanian devil microbiome-implications for conservation and management. Microbiome 2015, 3, 76. [Google Scholar] [CrossRef] [PubMed]
- Alfano, N.; Courtiol, A.; Vielgrader, H.; Timms, P.; Roca, A.L.; Greenwood, A.D. Variation in koala microbiomes within and between individuals: Effect of body region and captivity status. Sci. Rep. 2015, 5, 10189. [Google Scholar] [CrossRef] [PubMed]
- Vidgen, M.E.; Hanger, J.; Timms, P. Microbiota composition of the koala (Phascolarctos cinereus) ocular and urogenital sites, and their association with Chlamydia infection and disease. Sci. Rep. 2017, 7, 5239. [Google Scholar] [CrossRef] [PubMed]
- Fadrosh, D.W.; Ma, B.; Gajer, P.; Sengamalay, N.; Ott, S.; Brotman, R.M.; Ravel, J. An improved dual-indexing approach for multiplexed 16s rRNA gene sequencing on the Illumina MiSeq platform. Microbiome 2014, 2, 6. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S. Fastqc: A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 1 March 2018).
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Pena, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Zhang, J.; Kobert, K.; Flouri, T.; Stamatakis, A. Pear: A fast and accurate illumina paired-end read merger. Bioinformatics 2014, 30, 614–620. [Google Scholar] [CrossRef] [PubMed]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [PubMed]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately maximum-likelihood trees for large alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. Uchime improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [PubMed]
- Pruesse, E.; Peplies, J.; Glockner, F.O. SINA: Accurate high-throughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics 2012, 28, 1823–1829. [Google Scholar] [CrossRef] [PubMed]
- Ihaka, R.; Gentleman, R. R: A language for data analysis and graphics. J. Comput. Graph. Stat. 1996, 5, 299–314. [Google Scholar]
- McMurdie, P.J.; Holmes, S. phyloseq: An R Package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef] [PubMed]
- Oksanen, J.; Blanchet, G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. Vegan: Community Ecology Package; R Package Version 2.4-2; The R Foundation for Statistical Computing: Vienna, Austria, 2017. [Google Scholar]
- Anderson, M.J.; Walsh, D.C.I. PERMANOVA, ANOSIM, and the Mantel test in the face of heterogeneous dispersions: What null hypothesis are you testing? Ecol. Monogr. 2013, 83, 557–574. [Google Scholar] [CrossRef]
- Wickham, H.; Francois, R.; Henry, L.; Müller, K. Dplyr: A Grammar of Data Manipulation. R Package Version 0.7.0 ed. 2017. Available online: https://cran.r-project.org/package=dplyr (accessed on 01 March 2018).
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer International Publishing: Basel, Switzerland, 2016. [Google Scholar]
- Gu, Z.; Eils, R.; Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 2016, 32, 2847–2849. [Google Scholar] [CrossRef] [PubMed]
- Gu, Z.; Gu, L.; Eils, R.; Schlesner, M.; Brors, B. Circlize implements and enhances circular visualization in R. Bioinformatics 2014, 30, 2811–2812. [Google Scholar] [CrossRef] [PubMed]
- Burnard, D.; Huston, W.M.; Webb, J.K.; Jelocnik, M.; Reiss, A.; Gillett, A.; Fitzgibbon, S.; Carver, S.; Carrucan, J.; Flanagan, C.; et al. Molecular evidence of Chlamydia pecorum and arthropod-associated Chlamydiae in an expanded range of marsupials. Sci. Rep. 2017, 7, 12844. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, N.A.; Walker, A.W.; Berry, S.H.; Duncan, S.H.; Farquarson, F.M.; Louis, P.; Thomson, J.M.; Consortium, U.I.G.; Satsangi, J.; Flint, H.J.; et al. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing. PLoS ONE 2014, 9, e88982. [Google Scholar] [CrossRef] [PubMed]
- Gohl, D.M.; Vangay, P.; Garbe, J.; MacLean, A.; Hauge, A.; Becker, A.; Gould, T.J.; Clayton, J.B.; Johnson, T.J.; Hunter, R.; et al. Systematic improvement of amplicon marker gene methods for increased accuracy in microbiome studies. Nat. Biotechnol. 2016, 34, 942–949. [Google Scholar] [CrossRef] [PubMed]
- Dong, Q.; Brulc, J.M.; Iovieno, A.; Bates, B.; Garoutte, A.; Miller, D.; Revanna, K.V.; Gao, X.; Antonopoulos, D.A.; Slepak, V.Z.; et al. Diversity of bacteria at healthy human conjunctiva. Investig. Ophthalmol. Vis. Sci. 2011, 52, 5408–5413. [Google Scholar] [CrossRef] [PubMed]
- Ley, R.E.; Hamady, M.; Lozupone, C.; Turnbaugh, P.J.; Ramey, R.R.; Bircher, J.S.; Schlegel, M.L.; Tucker, T.A.; Schrenzel, M.D.; Knight, R.; et al. Evolution of mammals and their gut microbes. Science 2008, 320, 1647–1651. [Google Scholar] [CrossRef] [PubMed]
- Dubin, K.; Pamer, E.G. Enterococci and their interactions with the intestinal microbiome. Microbiol. Spectr. 2014, 5. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.B.; Ravel, J. The vaginal microbiota, host defence and reproductive physiology. J. Physiol. 2017, 595, 451–463. [Google Scholar] [CrossRef] [PubMed]
- Burnard, D.; Polkinghorne, A. Chlamydial infections in wildlife-conservation threats and/or reservoirs of ‘spill-over’ infections? Vet. Microbiol. 2016, 196, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Coldham, T.; Rose, K.; O’Rourke, J.; Neilan, B.A.; Dalton, H.; Lee, A.; Mitchell, H. Detection of helicobacter species in the gastrointestinal tract of ringtail possum and koala: Possible influence of diet, on the gut microbiota. Vet. Microbiol. 2013, 166, 429–437. [Google Scholar] [CrossRef] [PubMed]
- Smith, C.C.; Snowberg, L.K.; Gregory Caporaso, J.; Knight, R.; Bolnick, D.I. Dietary input of microbes and host genetic variation shape among-population differences in stickleback gut microbiota. ISME J. 2015, 9, 2515–2526. [Google Scholar] [CrossRef] [PubMed]





| Primer Name | Illumina Adaptor Region | Phaser | Priming Region |
| PCR1_forward | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | (0–3 bp) | ACTCCTACGGGAGGCAGCAG |
| PCR1_reverse | ACACTCTTTCCCTACACGACGCTCTTCCGATCT | (0–3 bp) | GGACTACHVGGGTWTCTAAT |
| Illumina Flowcell Region | Sample Index | Illumina Adaptor Region | |
| PCR2_forward | CAAGCAGAAGACGGCATACGAGAT | (8 bp index) | GTGACTGGAGTTCAGACGTG |
| PCR2_reverse | AATGATACGGCGACCACCGAGATCT | (8 bp index) | ACACTCTTTCCCTACACGA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Burke, C.; Burnard, D.; Polkinghorne, A.; Webb, J.; Huston, W.M. Cloacal and Ocular Microbiota of the Endangered Australian Northern Quoll. Microorganisms 2018, 6, 68. https://doi.org/10.3390/microorganisms6030068
Burke C, Burnard D, Polkinghorne A, Webb J, Huston WM. Cloacal and Ocular Microbiota of the Endangered Australian Northern Quoll. Microorganisms. 2018; 6(3):68. https://doi.org/10.3390/microorganisms6030068
Chicago/Turabian StyleBurke, Catherine, Delaney Burnard, Adam Polkinghorne, Jonathan Webb, and Wilhelmina M. Huston. 2018. "Cloacal and Ocular Microbiota of the Endangered Australian Northern Quoll" Microorganisms 6, no. 3: 68. https://doi.org/10.3390/microorganisms6030068
APA StyleBurke, C., Burnard, D., Polkinghorne, A., Webb, J., & Huston, W. M. (2018). Cloacal and Ocular Microbiota of the Endangered Australian Northern Quoll. Microorganisms, 6(3), 68. https://doi.org/10.3390/microorganisms6030068

