New Postbiotic Derived from Sequential Fermentation of Two Lacticaseibacillus Strains Exerts Beneficial Effects on Epithelial Gut Barrier and Innate Immunity in Human Enterocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Postbiotic Products
2.2. Human Enterocyte Cell Line
2.3. Stimulation with Different Postbiotic Products
2.4. Modulation of Epithelial Gut Barrier
2.5. Cell Proliferation Assay
2.6. Real Time PCR
2.7. Protein Levels of Tight Junction Markers Were Quantified by ELISA on Cell Lysates
2.8. Modulation of Innate Immunity
2.9. Statistical Analysis
3. Results
3.1. Modulation of Human Enterocyte Cell Growth and Differentiation
3.2. Modulation of Tight Junction Proteins and Mucous Production in Human Enterocytes
3.3. Modulation of Innate Immunity
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| iPB | Innovative postbiotic |
| ZO-1 | Zonula occludens-1 |
| MUC-2 | Mucin-2 |
| HBD-2 | Beta-defensin 2 |
| LGG | Lactocticaseibacillus GG |
| LGGp | Lactocticaseibacillus GG postbiotic |
| Lpp | Lactocticaseibacillus paracasei NPB-01 postbiotic |
| qRT-PCR | Quantitative real-time PCR |
| GUS-B | Glucuronidase beta |
| TGF-β | Transforming growth factor-β |
| RA | Retinoic acid |
| TSLP | Thymic stromal lymphopoietin |
| DCs | Dendritic cells |
References
- Aguilar-Toalá, J.E.; Arioli, S.; Behare, P.; Belzer, C.; Canani, R.B.; Chatel, J.-M.; D’auria, E.; de Freitas, M.Q.; Elinav, E.; Esmerino, E.A.; et al. Postbiotics—When simplification fails to clarify. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 825–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calvanese, C.M.; Villani, F.; Ercolini, D.; De Filippis, F. Postbiotics versus probiotics: Possible new allies for human health. Food Res. Int. 2025, 217, 116869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prajapati, N.; Patel, J.; Singh, S.; Yadav, V.K.; Joshi, C.; Patani, A.; Prajapati, D.; Sahoo, D.K.; Patel, A. Postbiotic production: Harnessing the power of microbial metabolites for health applications. Front. Microbiol. 2023, 14, 1306192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yeşilyurt, N.; Yılmaz, B.; Ağagündüz, D.; Capasso, R. Involvement of Probiotics and Postbiotics in the Immune System Modulation. Biologics 2021, 1, 89–110. [Google Scholar] [CrossRef] [Scilit]
- Roggero, P.; Liotto, N.; Pozzi, C.; Braga, D.; Troisi, J.; Menis, C.; Giannì, M.L.; Canani, R.B.; Paparo, L.; Nocerino, R.; et al. Analysis of immune, microbiota and metabolome maturation in infants in a clinical trial of Lactobacillus paracasei CBA L74-fermented formula. Nat. Commun. 2020, 11, 2703. [Google Scholar] [CrossRef] [Scilit]
- Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef] [Scilit]
- Scott, E.; De Paepe, K.; Van de Wiele, T. Postbiotics and Their Health Modulatory Biomolecules. Biomolecules 2022, 12, 1640. [Google Scholar] [CrossRef] [Scilit]
- Yolmeh, M.; Xavier-Santos, D.; Sant’ANa, A.S. Modulating gut microbiota by paraprobiotics: Mechanisms, advantages, and challenges. Food Biosci. 2024, 60, 104305. [Google Scholar] [CrossRef] [Scilit]
- Thorakkattu, P.; Khanashyam, A.C.; Shah, K.; Babu, K.S.; Mundanat, A.S.; Deliephan, A.; Deokar, G.S.; Santivarangkna, C.; Nirmal, N.P. Postbiotics: Current Trends in Food and Pharmaceutical Industry. Foods 2022, 11, 3094. [Google Scholar] [CrossRef] [Scilit]
- Balakrishna, K.; Naveena, G.; Kingston, J.J. Postbiotics at the interface of microbial biotechnology and therapeutics: Industrial production, functional mechanisms, and clinical potentials. Arch. Microbiol. 2026, 208, 123. [Google Scholar] [CrossRef] [Scilit]
- Maniya, H.; Modasiya, I.; Chauhan, M.; Mori, P.; Kumar, V. Developing Robust Probiotic Consortia: A Methodological Optimization Approach. Curr. Microbiol. 2024, 81, 407. [Google Scholar] [CrossRef] [Scilit]
- Roberts, K.D.; Ahmed, S.; Valentin, E.S.; Di Martino, L.; McCormick, T.S.; Ghannoum, M.A. Immunomodulatory Properties of Multi-Strain Postbiotics on Human CD14+ Monocytes. Life 2024, 14, 1673. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Luo, X.; Huang, Y.; Zhao, M.; Liu, T.; Wang, J.; Feng, F. Influence of cooking techniques on food quality, digestibility, and health risks regarding lipid oxidation. Food Res. Int. 2023, 167, 112685. [Google Scholar] [CrossRef] [Scilit]
- Paparo, L.; Aitoro, R.; Nocerino, R.; Fierro, C.; Bruno, C.; Canani, R.B. Direct effects of fermented cow’s milk product with Lactobacillus paracasei CBA L74 on human enterocytes. Benef. Microbes 2018, 9, 165–172. [Google Scholar] [CrossRef] [Scilit]
- Nocerino, R.; Bedogni, G.; Carucci, L.; Cosenza, L.; Cozzolino, T.; Paparo, L.; Palazzo, S.; Riva, L.; Verduci, E.; Canani, R.B. The Impact of Formula Choice for the Management of Pediatric Cow’s Milk Allergy on the Occurrence of Other Allergic Manifestations: The Atopic March Cohort Study. J. Pediatr. 2021, 232, 183–191.e3. [Google Scholar] [CrossRef] [Scilit]
- Bueno, E.B.T.; Silva, K.d.O.; Mendes, M.E.F.; de Oliveira, L.B.; de Menezes, F.P.; Imperador, A.C.; Correia, L.F.; Winkelstroter, L.K. Postbiotics Derived from Lactic Acid Bacteria Fermentation: Therapeutic Potential in the Treatment of Muscular Complications in Inflammatory Bowel Disease. Fermentation 2025, 11, 362. [Google Scholar] [CrossRef] [Scilit]
- Alrosan, M.; Al-Massad, M.; Obeidat, H.J.; Maghaydah, S.; Alu’dAtt, M.H.; Tan, T.-C.; Liao, Z.; Alboqai, O.; Ebqa’ai, M.; Dheyab, M.A.; et al. Fermentation-induced modifications to the structural, surface, and functional properties of quinoa proteins. Food Sci. Biotechnol. 2025, 34, 3317–3329. [Google Scholar] [CrossRef] [Scilit]
- Oglio, F.; Paparo, L.; Carucci, L.; Gaeta, A.; Armiento, S.; Coppola, S.; Molinaro, A.; De Castro, C.; Masino, A.; Mauriello, V.; et al. Postbiotic effects elicited by heat-inactivated Lacticaseibacillus rhamnosus GG against cow’s milk allergy in human cells. Front. Immunol. 2026, 16, 1671729. [Google Scholar] [CrossRef] [Scilit]
- Pimentel, T.C.; Cruz, A.G.; Pereira, E.; da Costa, W.K.A.; Rocha, R.d.S.; Pedrosa, G.T.d.S.; Rocha, C.d.S.; Alves, J.M.; Alvarenga, V.O.; Sant’aNa, A.S.; et al. Postbiotics: An overview of concepts, inactivation technologies, health effects, and driver trends. Trends Food Sci. Technol. 2023, 138, 199–214. [Google Scholar] [CrossRef] [Scilit]
- Sawant, S.S.; Park, H.-Y.; Sim, E.-Y.; Kim, H.-S.; Choi, H.-S. Microbial Fermentation in Food: Impact on Functional Properties and Nutritional Enhancement—A Review of Recent Developments. Fermentation 2025, 11, 15. [Google Scholar] [CrossRef] [Scilit]
- Kerksick, C.M. Acute Alpha-Glycerylphosphorylcholine Supplementation Enhances Cognitive Performance in Healthy Men. Nutrients 2024, 16, 4240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kienesberger, S.; Cosic, A.; Kitsera, M.; Raffl, S.; Hiesinger, M.; Leitner, E.; Halwachs, B.; Gorkiewicz, G.; Glabonjat, R.A.; Raber, G.; et al. Enterotoxin tilimycin from gut-resident Klebsiella promotes mutational evolution and antibiotic resistance in mice. Nat. Microbiol. 2022, 7, 1834–1848. [Google Scholar] [CrossRef] [Scilit]
- Rezaie, A.; Chang, B.W.; Germano, J.d.F.; Leite, G.; Mathur, R.; Houser, K.; Hosseini, A.; Brimberry, D.; Rashid, M.; Mehravar, S.; et al. Effect, Tolerability, and Safety of Exclusive Palatable Elemental Diet in Patients With Intestinal Microbial Overgrowth. Clin. Gastroenterol. Hepatol. 2025, 23, 2306–2317.e7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parrish, A.; Boudaud, M.; Kuehn, A.; Ollert, M.; Desai, M.S. Intestinal mucus barrier: A missing piece of the puzzle in food allergy. Trends Mol. Med. 2022, 28, 36–50. [Google Scholar] [CrossRef] [Scilit]
- Wehkamp, J.; Schmid, M.; Stange, E.F. Defensins and other antimicrobial peptides in inflammatory bowel disease. Curr. Opin. Gastroenterol. 2007, 23, 370–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meade, K.G.; O’FArrelly, C. β-Defensins: Farming the Microbiome for Homeostasis and Health. Front. Immunol. 2019, 9, 3072. [Google Scholar] [CrossRef] [Scilit]
- Pinkerton, J.W.; Kim, R.Y.; Koeninger, L.; Armbruster, N.S.; Hansbro, N.G.; Brown, A.C.; Jayaraman, R.; Shen, S.; Malek, N.; A Cooper, M.; et al. Human β-defensin-2 suppresses key features of asthma in murine models of allergic airways disease. Clin. Exp. Allergy 2020, 51, 120–131. [Google Scholar] [CrossRef] [Scilit]
- Lia, F.; Baron, B. Analysis of Polyphenolic Composition, Antioxidant Power and Stress-Response Effects of Fractionated Perilla Leaf Extract on Cells In Vitro. Biologics 2025, 5, 2. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Zhong, Y.; Chen, L.; Liu, W.; Lin, C.; Chen, Y.; Wang, X. HGF Aggravated Periodontitis-Associated Gut Barrier and Microbial Dysfunction: Implications for Oral–Gut Axis Regulation. Biology 2025, 14, 496. [Google Scholar] [CrossRef] [Scilit]
- Furnari, S.; Ciantia, R.; Garozzo, A.; Furneri, P.M.; Fuochi, V. Lactobacilli-Derived Microbe-Associated Molecular Patterns (MAMPs) in Host Immune Modulation. Biomolecules 2025, 15, 1609. [Google Scholar] [CrossRef] [Scilit]





| Target Gene | Forward | Revers |
|---|---|---|
| Muc2 | 5′-CTCCGCATGAGTGTGAGT-3′ | 5′-TAGCAGCCACACTTGTCTG-3′ |
| Lactase | 5′-ACACGGTCGATTTCCTCTCT-3′ | 5′-TGGGTTCTTCATGGTGGAGG-3′ |
| Gus-B | GAAAATATGTGGTTGGAGAGCTCATT | CCGAGTGAAGATCCCCTTTTTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Oglio, F.; Cadavere, A.; De Aloe, M.; Lintura, A.; Michelini, M.; Luongo, C.; Coppola, S.; Agizza, A.; Caldaria, E.; Carucci, L. New Postbiotic Derived from Sequential Fermentation of Two Lacticaseibacillus Strains Exerts Beneficial Effects on Epithelial Gut Barrier and Innate Immunity in Human Enterocytes. Microorganisms 2026, 14, 931. https://doi.org/10.3390/microorganisms14040931
Oglio F, Cadavere A, De Aloe M, Lintura A, Michelini M, Luongo C, Coppola S, Agizza A, Caldaria E, Carucci L. New Postbiotic Derived from Sequential Fermentation of Two Lacticaseibacillus Strains Exerts Beneficial Effects on Epithelial Gut Barrier and Innate Immunity in Human Enterocytes. Microorganisms. 2026; 14(4):931. https://doi.org/10.3390/microorganisms14040931
Chicago/Turabian StyleOglio, Franca, Alessia Cadavere, Monia De Aloe, Anna Lintura, Marco Michelini, Chiara Luongo, Serena Coppola, Alessandra Agizza, Erika Caldaria, and Laura Carucci. 2026. "New Postbiotic Derived from Sequential Fermentation of Two Lacticaseibacillus Strains Exerts Beneficial Effects on Epithelial Gut Barrier and Innate Immunity in Human Enterocytes" Microorganisms 14, no. 4: 931. https://doi.org/10.3390/microorganisms14040931
APA StyleOglio, F., Cadavere, A., De Aloe, M., Lintura, A., Michelini, M., Luongo, C., Coppola, S., Agizza, A., Caldaria, E., & Carucci, L. (2026). New Postbiotic Derived from Sequential Fermentation of Two Lacticaseibacillus Strains Exerts Beneficial Effects on Epithelial Gut Barrier and Innate Immunity in Human Enterocytes. Microorganisms, 14(4), 931. https://doi.org/10.3390/microorganisms14040931

