Antibacterial Activity of the Pyrazolone Copper Complex P-FAH-Cu-phen Against Staphylococcus aureus and Promotion of Healing of Traumatized Infected Skin in Mice

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

 

This study is about the antibacterial activity of a novel agent against S. aureus. As resistance in S. aureus is increasing, the subject is interesting. However, there are some concerns.

*It seems that the authors used DMSO as the solvent for the complex. DMSO final concentration is never stated. “the MIC for DMSO increased 3 to 175 times” MIC cannot increase for a solvent. The quantity of added DMSO is important because the toxicity and antibacterial activity of DMSO affect the results, even though [there was no obvious DIZ circle when DMSO alone (20 μL?) was used]. How did you check this?

*It is necessary to test the toxicity of the complex.

*Initial CFU (10⁴ CFU/mL) is unusually low and not justified.

*ImageJ use is mentioned but no thresholding or counting criteria are described.

* Ambiguity in bacterial strain description:  How many strains was used for investigation? No strain designation (ATCC number? clinical isolate? MRSA or MSSA?), No resistance profile, No justification for strain choice.

*How did the authors collect bacteria from 2MIC? It seems that MBC= 2MIC. Thus, bacteria cannot grow in 2MIC.

*Animal model ethics and rigor (mixed): Concerns: Only female mice (no justification), No blinding mentioned, No exclusion criteria stated.

*How did you interpret RT data? Which method was used to analyze qPCR? Did you design the primers?

*Statistics section is too generic. No post hoc test specified, No normality testing, No definition of significance threshold (e.g., p < 0.05)

*[its MIC/MBC ratio was 0.5]. This is not standard. The ratio is usually MBC/MIC, which here is 2, not 0.5.

* MIC/MBC are given in μM in text but μg/mL in Table 2.

*Concentrations in DIZ text (100/200 μg/mL) don’t match table header (200/400 μg/mL).

*Initial upregulation of hla and agrA at 30 min is interesting but risky. This may reflect stress response or transient regulatory feedback.

*MTT data interpretation needs restraint. “relative metabolic activities … 9.68%–10.76%”. This implies >89% reduction, which is extremely strong.

*Table 1. Provide amplicon size and conditions for PCR.

* Grammatical errors are seen.

*Abbreviation Issue. Expand all abbreviations at first mention in the text.

*Remove Table 2 and embed its data within the text

*[Coagulase is an important virulence factor of S. aureus, which is able to activate plasminogen and disrupt thrombosis]: it needs reference

 

Best

 

Author Response

Dear Editor and Reviewers,

First and foremost, we would like to express our sincere gratitude for your time and effort in reviewing our manuscript. We greatly appreciate the constructive feedback you provided. In this revised version (Manuscript Number:microorganisms-4148361), we have made extensive changes based on your suggestions, and we believe these revisions have significantly improved the quality of the manuscript. Below, we address each of your comments in detail.

Should you have any questions or require further clarification regarding this manuscript, please do not hesitate to contact me.

Thank you once again for your valuable time and review.

Sincerely,

Dongyuan Zhou

*Corresponding Author E-mail:

lijinyu234@163.com

 

 

The response to the reviewer #1:

Question l: It seems that the authors used DMSO as the solvent for the complex. DMSO final concentration is never stated. “the MIC for DMSO increased 3 to 175 times” MIC cannot increase for a solvent. The quantity of added DMSO is important because the toxicity and antibacterial activity of DMSO affect the results, even though [there was no obvious DIZ circle when DMSO alone (20 μL?) was used]. How did you check this?

Answer:

We sincerely thank you for your careful review and valuable comments regarding the use of DMSO in our study. We have thoroughly addressed the issues raised and made the following revisions:

1) Clarification of final DMSO concentrations

In all in vitro antibacterial assays, P-FAH-Cu-phen was dissolved in DMSO to prepare a stock solution (5 mg/mL). Based on the tested compound concentrations, we have now calculated and explicitly stated the final DMSO concentrations in each experiment:

① Agar diffusion (200 and 400 μg/mL): corresponding DMSO concentrations of 4% and 8% (v/v);

② MIC/MBC determination (highest test concentration 4 μg/mL): final DMSO ≤0.08% (v/v);

③ Plate experiment (50-100 μg/mL): maximum DMSO 2% (v/v);

④ Time-kill assay (1-2 MIC): final DMSO ≤0.056% (v/v);

⑤ Resistance screening (0.5 MIC): final DMSO approx. 0.01% (v/v);

⑥ Subsequent mechanistic assays (envelope dysfunction, ATPase, biofilm, etc.): final DMSO ≤0.5% (v/v).

These details have been added to the corresponding Methods sections in the revised manuscript.

2) Validation of DMSO's effect on bacterial growth

To exclude potential interference from DMSO itself, we included matched DMSO solvent controls in key experiments:

① In agar diffusion, 8% DMSO (20 μL) produced no inhibition zone;

② In MIC/MBC assays, 0.08% DMSO showed no visible inhibition of bacterial growth;

③ In plate experiments, 2% DMSO treatment resulted in colony counts similar to the negative control;

④ In resistance screening, 0.01% DMSO was included as a solvent control throughout.

According to published English literature, low concentrations of DMSO in liquid culture systems have no significant inhibitory effect on Staphylococcus aureus growth:

Reference	Key Findings
Summer et al., 2022, Biofilm1	DMSO (0.03–25%) significantly inhibits biofilm formation in a species-dependent manner; emphasizes the need for standardized solvent controls in antibiofilm assays
Ilieva, 2021, Toxics2	The MIC of DMSO against S. aureus ATCC 29213 is 25% (v/v), indicating that concentrations below 0.5% have no inhibitory effect on bacterial grow
Liu et al., 2023, PeerJ3	For drug susceptibility testing, DMSO concentrations should be kept below 2.5% to avoid significant effects on microbial growth

Therefore, in subsequent mechanistic experiments where the final DMSO concentration was ≤0.5%, well below the inhibitory thresholds reported in the literature, we did not repeatedly set up DMSO controls, as all assays were conducted within the previously validated safe concentration range.

3) Correction of the inaccurate phrase "MIC for DMSO"

We agree that the phrase "MIC for DMSO" is incorrect. Our original intention was to describe that, in the presence of DMSO, the MIC of the positive control drug (gentamicin) against S. aureus increased after serial passaging. We have revised this statement accordingly to clearly distinguish the solvent from the antibacterial agent. (see lines 156-164, 166-179). We greatly appreciate your insightful comments, which have helped us improve the rigor and clarity of our work.

References

1. Summer K, et al. Out of control: The need for standardised solvent approaches and data reporting in antibiofilm assays incorporating dimethyl-sulfoxide (DMSO). Biofilm. 2022;4:100081.
2. Ilieva Y, et al. Cytotoxicity and Microbicidal Activity of Commonly Used Organic Solvents: A Comparative Study and Application to a Standardized Extract from Vaccinium macrocarpon. Toxics. 2021; 9(5):92.  
3. Liu J, et al. Effect of various concentrations of common organic solvents on the growth and proliferation ability of Candida glabrata and their permissible limits for addition in drug susceptibility testing. PeerJ. 2023;11:e16444.

 

The response to the reviewer #1:

Question 2: It is necessary to test the toxicity of the complex.

Answer: We sincerely thank the Editor for this important and constructive comment. We fully agree that toxicity evaluation is essential for assessing the translational potential of P-FAH-Cu-phen.

In the present study, our primary objective was to investigate the antibacterial efficacy and anti-infective mechanism of P-FAH-Cu-phen against S. aureus, including its activity in an infected skin wound model. In this context, we observed no obvious deterioration in general condition during treatment, and body weight increased gradually in all groups throughout the experimental period (Fig. 7C), which provides preliminary in vivo tolerability-related information under the current topical treatment conditions.

In addition, the mammalian cytotoxicity and in vivo biological effects of P-FAH-Cu-phen have been reported in our previous work[1], where the compound was evaluated in cultured mammalian cells (including normal liver cells, NCTC1469) and in mice, providing prior toxicity/safety-related background for this complex.

However, we agree that these data do not replace a dedicated toxicity assessment in the specific anti-infective/topical-use setting of the current study. To address this concern, we have now revised the manuscript to explicitly acknowledge this limitation and to state that systematic safety evaluation (e.g., cytotoxicity toward skin-relevant mammalian cells and route-relevant biocompatibility/toxicity assessment) will be performed in future work. We appreciate the Editor’s suggestion, which has helped us improve the rigor and clinical relevance of the manuscript. Modification in Manuscript: We have added the information in test (lines 738–748).

 

 

Figure 7 Experimental design and macroscopic wound-healing outcomes of P-FAH-Cu-phen in a murine S. aureus-infected wound model. (A) Schematic diagram of treatment experiment process for S.aureus-infected skin wounds in Mice. (B) Mouse skin wound model (C) Effect of P-FAH-Cu-phen treatment on body weight of mice. (D) Representative photographs of cutaneous abscesses after treatment with P-FAH-Cu-phen or Mupirocin treatment.(E) Skin Trauma Schematic. (F) The would healing of skin ulcers over 10 days. Data represented as mean ± SD from three independent biological replicates (n = 10). Data are presented as mean ± SD. Statistical significance was analyzed by one-way ANOVA followed by Dunnett’s post hoc test. P < 0.05 was considered statistically significant. ***P < 0.001，****P < 0.0001 when compared to Control group.

References

[1] M. Nurmamat, H. Yan, R. Wang, H. Zhao, Y. Li, X. Wang, K. Nurmaimaiti, T. Kurmanjiang, D. Luo, J. Baodi, G. Xu, J. Li, Novel Copper(II) Complex with a 4-Acylpyrazolone Derivative and Coligand Induce Apoptosis in Liver Cancer Cells, ACS Med Chem Lett 12 (2021) 467–476. https://doi.org/10.1021/acsmedchemlett.0c00680.

 

The response to the reviewer #1:

Question 3: Initial CFU (10⁴ CFU/mL) is unusually low and not justified.

Answer:

We thank the reviewer for this important observation regarding the initial bacterial inoculum used in the plate experiment. We would like to provide the following clarification and justification:

1) Purpose of the plate experiment: This experiment was designed to evaluate the bactericidal effect of P-FAH-Cu-phen after a relatively short exposure time (3 h), rather than to determine MIC/MBC values. Therefore, a lower initial inoculum (10⁴ CFU/mL) was intentionally chosen to allow for clear visualization and accurate enumeration of surviving colonies after treatment. Higher inocula (e.g., 10⁶-10⁷ CFU/mL) often lead to confluent growth on agar plates, making colony counting difficult and potentially masking subtle but meaningful bactericidal effects.

2) Methodological precedent: The use of 10⁴ CFU/mL for short-term bactericidal assays is supported by previous studies evaluating rapid-killing antimicrobial agents（Guachalla, et al, 2017 ). For example, a high-throughput bactericidal assay protocol employed 3×10⁴ CFU/mL bacteria with a 3 h incubation period to assess complement-mediated killing, followed by CFU enumeration on agar plates. This demonstrates that comparable inoculum sizes have been successfully used to assess bactericidal activity over brief exposure periods.

3) Internal control validation: Importantly, the DMSO solvent control (2% DMSO) included in this experiment showed colony counts equivalent to the untreated control (approximately 1×10⁴ CFU/mL after 3 h incubation, followed by a 100-fold dilution for plating), confirming that the low initial inoculum did not compromise bacterial viability or growth under control conditions.

We have revised the manuscript accordingly (see lines 181-197). We hope this clarification addresses the reviewer’s concern.

References

Guachalla LM, et al. Multiple Modes of Action of a Monoclonal Antibody against Multidrug-Resistant Escherichia coli Sequence Type 131-H30. Antimicrob Agents Chemother. 2017;61(11):e01428-17. doi: 10.1128/AAC.01428-17. PMID: 28874372; PMCID: PMC5655088.

 

The response to the reviewer #1:

Question 4: ImageJ use is mentioned but no thresholding or counting criteria are described.

Answer: Thank you for this important and helpful comment. We agree that the original manuscript did not provide sufficient detail regarding the ImageJ analyses, which may affect reproducibility. In response, we have revised the Methods section to clarify the image analysis procedures in all relevant parts of the manuscript, including both the plate experiment and the in vivo wound-healing assay.

Specifically, we now clarify that, in the plate experiment, colonies were counted manually from plate images using Image J (Cell Counter), rather than by automated threshold-based particle analysis. We have added the colony-counting criteria (ROI definition, criteria for countable colonies, and handling of fused/edge colonies).

For the in vivo wound-healing assay, we now clarify that wound area was quantified in ImageJ by manual delineation of wound margins (not threshold-based segmentation), with a consistent boundary definition applied across all groups and time points. We also added details on image calibration and ROI-based area measurement.

Modification in Manuscript: We revised the relevant Methods subsections (Plate experiment and Section 2.6, Wound-healing activity in vivo) to clarify the ImageJ analysis workflow, including manual colony-counting criteria (plate experiment) and manual wound-margin delineation/ROI area measurement criteria (in vivo wound images).Modification in Manuscript: We have added the information in test (lines 190–197, 390-394).

Plate experiment：Plate images were analyzed using ImageJ. Colony numbers were counted manually from plate images using the Cell Counter tool (i.e., no automated threshold-based particle counting was applied). The whole agar plate area was used as the counting region (ROI). Clearly separated colonies were counted as individual colonies, while fused/overlapping colonies were counted conservatively based on visible boundaries. Colonies touching the plate edge were counted only when more than half of the colony area was within the ROI. Colony numbers were then used to calculate bacterial survival according to Formula (1).

Wound area：wound area was quantified from serial photographs using ImageJ. Images were calibrated using a scale marker, and wound margins were manually delineated using the same boundary definition across all groups and time points (i.e., no threshold-based segmentation was applied). The wound region was defined as the ROI and measured in ImageJ, and wound closure was calculated relative to the initial wound area.

 

The response to the reviewer #1:

Question 5: Ambiguity in bacterial strain description: How many strains was used for investigation? No strain designation (ATCC number? clinical isolate? MRSA or MSSA?), No resistance profile, No justification for strain choice.

Answer: Thank you for this important and constructive comment. We agree that the bacterial strain description in the original manuscript was not sufficiently detailed and may have caused ambiguity.

In the revised manuscript, we have clarified that only one strain was used throughout this study (for both the in vitro assays and the murine wound infection model), namely Staphylococcus aureus ATCC 25923, which is an MSSA (methicillin-susceptible S. aureus) reference strain. We have added the full strain designation, strain type (MSSA), source, and culture/activation details in the Materials and Methods section.

Specifically, the strain was sourced from the Xinjiang Laboratory of Conservation and Regulatory Biology of Special Environmental Species, Xinjiang Normal University, and the same strain was used consistently across all experiments to ensure methodological consistency.

Regarding the resistance profile, we agree that this information is important. In the present study, we used a standard MSSA reference strain (S. aureus ATCC 25923) for an initial proof-of-concept evaluation and did not perform resistance profiling across multiple strains or resistance phenotypes. We have now clarified this in the manuscript and added a limitation statement in the Discussion indicating that future studies will include MRSA strains and clinical isolates with defined resistance profiles.

Modification in Manuscript: We have added the information in test (lines 68–76).
Staphylococcus aureus ATCC 25923 (methicillin-susceptible S. aureus, MSSA) was used in this study. The strain was obtained from the Xinjiang Laboratory of Conservation and Regulatory Biology of Special Environmental Species, Xinjiang Normal University. A 1 mL aliquot of frozen stock culture stored at -80°C was inoculated into 100 mL of LB broth and incubated at 37°C for 24 h with shaking at 180 rpm for activation.. The same strain was used throughout the in vitro assays and the murine wound infection model. The antibacterial activity of P-FAH-Cu-phen was initially assessed using the agar diffusion method according to a previously described procedure with minor modifications[9]. Briefly, a logarithmic-phase bacterial suspension (10⁹ CFU/mL) was mixed with sterile LB medium containing 1.5% agar at a 1:100 (v/v) ratio and poured into plates. After solidification, sterile filter paper discs (7 mm diameter, Beyotime, Shanghai, China) loaded with 20 μL of P-FAH-Cu-phen solution (200 or 400 μg/mL) were placed on the agar surface and incubated at 37°C for 24 h. Antibacterial activity was assessed by measuring the diameter of the inhibition zone (DIZ), A disc loaded with 20 μL of 8% (v/v) DMSO-corresponding to the solvent concentration in the 400 μg/mL P-FAH-Cu-phen solution-served as the control.

References

[9] Kurmanjiang, T.; Wang, X.; Li, J.; Mamat, N.; Nurmamat, M.; Xu, G. A Novel Pyrazolone Complex P-FAH-Cu-Bpy Induces Death of Escherichia Coli and Staphylococcus Aureus by Disrupting Cell Structure and Blocking Energy. Arch Microbiol 2023, 205, 376, doi:10.1007/s00203-023-03714-6.

 

The response to the reviewer #1:

Question 6: How did the authors collect bacteria from 2MIC? It seems that MBC= 2MIC. Thus, bacteria cannot grow in 2MIC.

Answer:

We thank the reviewer for this question. The use of 2 MIC in time-kill and mechanistic assays is consistent with MBC=2 MIC when considering the difference in exposure time: MBC is defined as no colony growth after 24 h exposure, reflecting long-term endpoint killing; whereas time-kill kinetics (0-40 min) and mechanistic assays (AKP, ATPase; 5 h) are short-term exposures designed to capture the dynamic process of killing and early damage events. Our time-kill data (Fig. 2C) show that at 2 MIC, ~5% of bacteria survived at 2.5 min and ~1% at 40 min, demonstrating that within this minute-to-hour window, drug-induced damage occurs progressively. The AKP and ATPase assays leverage this time window: after 5 h exposure to 2 MIC, although bacteria are not yet completely killed, membrane permeability has increased, leading to AKP leakage into the supernatant; meanwhile, membrane dysfunction is reflected by altered ATPase activity in the supernatant. Thus, measuring supernatant components after 5 h exposure is entirely feasible. This approach-short-term exposure to bactericidal concentrations for mechanistic studies-has been widely employed in previous research to investigate early drug-induced damage, such as membrane permeabilization and enzyme leakage[1].

We have clarified exposure times in the revised Methods. Thank you for your insightful comment.

 

Figure 2 In vitro antibacterial activity of P-FAH-Cu-phen. (A) Photographs of S. aureus on agar plates. (B) Baterica viability of S. aureus. (c) killing kinetics curves on S. aureus.***P<0.001 and ****P<0.0001 when compared to control.

References

[1] Liu D, et al. A potential food biopreservative, CecXJ-37N, non-covalently intercalates into the nucleotides of bacterial genomic DNA beyond membrane attack. Food Chem. 2017;217:576-584.doi: 10.1016/j.foodchem.2016.09.033. PMID: 27664673

 

The response to the reviewer #1:

Question 7: Animal model ethics and rigor (mixed): Concerns: Only female mice (no justification), No blinding mentioned, No exclusion criteria stated.

Answer: Thank you for this important and constructive comment. We agree that additional methodological details are needed to improve the transparency and rigor of the animal study.

In the revised manuscript, we have clarified the following points in the Materials and Methods (Section 2.6, Wound-healing activity in vivo):

1. Use of female mice only (justification):
   Female KM mice were used in this initial proof-of-concept wound infection study to improve experimental consistency during longitudinal wound monitoring and to reduce variability associated with aggressive behavior and wound interference. We have now added this rationale to the Methods section. We also acknowledge that sex may influence wound healing and host responses, and this has been added as a limitation in the Discussion.
2. Blinding:
   Blinding was not implemented during treatment administration or outcome assessment in the current study. We agree that this may introduce observer bias. We have now explicitly stated this in the revised manuscript as a methodological limitation and will implement blinded outcome assessment in future studies.
3. Exclusion criteria:
   No predefined exclusion criteria were established for this exploratory study, and no animals/data points were excluded from the final analysis. We have now added this statement to the Methods section for transparency.

In addition, we clarified the randomization procedure for group allocation in the revised manuscript. We thank the reviewer for this suggestion, which has helped us improve the rigor and reporting quality of the study.

Modification in Manuscript: We revised Section 2.6 (Wound-healing activity in vivo) to provide the rationale for using female mice, clarify the randomization and exclusion-criteria reporting, and explicitly state that blinding was not implemented in the current study. We have added this information to the discussion section (Lines 373–408)

 

The response to the reviewer #1:

Question 8: How did you interpret RT data? Which method was used to analyze qPCR? Did you design the primers?

Answer: Thank you for this important comment. We agree that the original manuscript did not describe the qRT-PCR analysis in sufficient detail.

In the revised manuscript, we have clarified how the qRT-PCR data were interpreted and analyzed. Briefly, qRT-PCR results were analyzed using the 2^-ΔΔCt method for relative quantification, with 16S rRNA as the internal reference gene and the untreated control group as the calibrator. The data were expressed as relative fold changes in gene expression (target genes: sea, hla, and agrA) at each time point.

We have also clarified the primer information. The primers used in this study were designed by the authors (using [Primer Premier 5.0]) and synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). The primer sequences are listed in Table 1.

Table 1 qRT-PCR primmers

Gene code	Forvard primers sequence	Reverse primers sequence	Amplicon size (bp)
16S rRNA	GCTGCCCTTTGTATTGTC	AGATGTTGGGTTAAGT CCC	187
sea	ATGGTGCTTATTATGGTTATC	CGTTTCCAAAGGTACTGTATT	426
hla	TTGGTGCAAATGTTTC	TCACTTTCCAGCCTACT	312
agrA	TGATAATCCTTATGAGGTGCTT	CACTGTGCTCGTAACGAAA	259

These details have now been added to the qRT-PCR subsection in the Materials and Methods to improve transparency and reproducibility (Lines 287–305)

 

The response to the reviewer #1:

Question 9: Statistics section is too generic. No post hoc test specified, No normality testing, No definition of significance threshold (e.g., p < 0.05)

Answer: Thank you for this important comment. We agree that the statistical analysis section in the original manuscript was too general. In the revised manuscript, we have now specified the normality test (Shapiro-Wilk), the post hoc multiple-comparison test used after one-way ANOVA ([Tukey’s/Dunnett’s]), and the significance threshold (two-sided P < 0.05). We also clarified the statistical software used (SPSS 23.0) and updated the relevant figure legends where appropriate.

Modification in Manuscript: We revised the Statistical Analysis subsection to specify the normality test (Shapiro–Wilk), the post hoc multiple-comparison test used after one-way ANOVA ([Tukey’s/Dunnett’s]), and the significance threshold (two-sided P < 0.05), while retaining the software information (SPSS 23.0 and GraphPad Prism 8.0).(See details in lines 409–417)

 

The response to the reviewer #1:

Question 10: [its MIC/MBC ratio was 0.5]. This is not standard. The ratio is usually MBC/MIC, which here is 2, not 0.5.

Answer: Thank you for this careful and important correction. We agree with the reviewer that the ratio should be reported as MBC/MIC, not MIC/MBC. The original text was incorrectly written. We have corrected this in the revised manuscript. Accordingly, for P-FAH-Cu-phen, the correct value is MBC/MIC = 2 (rather than 0.5).

 

The response to the reviewer #1:

Question 11: MIC/MBC are given in μM in text but μg/mL in Table 2

Answer: Thank you for this important comment. We agree that the inconsistent units used for MIC/MBC values in the text and Table 2 may cause confusion. In the revised manuscript, we have corrected this inconsistency by using a uniform unit format throughout the manuscript (μg/mL). The corresponding values in the text and Table 2 have been revised accordingly.

 

The response to the reviewer #1:

Question 12: Concentrations in DIZ text (100/200 μg/mL) don’t match table header (200/400 μg/mL).

Answer: Thank you for this careful comment. We agree that there was an inconsistency between the DIZ concentration values reported in the text and the Table 2 header. After checking the original experimental records, we confirmed that the correct concentrations were 200 and 400 μg/mL. The values in the text have been corrected accordingly, and the manuscript has been checked to ensure consistency throughout.

 

The response to the reviewer #1:

Question 13: Initial upregulation of hla and agrA at 30 min is interesting but risky. This may reflect stress response or transient regulatory feedback.

Answer: Thank you for this insightful and constructive comment. We agree with the reviewer that the initial upregulation of hla and agrA at 30 min should be interpreted with caution. As suggested, this early transcriptional increase may reflect a transient stress response and/or short-term regulatory feedback triggered by exposure to P-FAH-Cu-phen, rather than a sustained pro-virulence effect.

In the revised manuscript, we have toned down the interpretation of the qRT-PCR results and now describe these changes as a time-dependent transcriptional response. We avoid overinterpreting the 30 min upregulation and emphasize that conclusions regarding virulence regulation should be based on the overall temporal pattern and require further validation at the protein/functional level.

We have also added a statement in the Discussion noting that future studies with finer time-course sampling and toxin/protein-level assays will be needed to distinguish transient stress adaptation from sustained virulence regulation. Modification in Manuscript (lines 512–517, 673-691)

 

The response to the reviewer #1:

Question 14: MTT data interpretation needs restraint. “relative metabolic activities … 9.68%–10.76%”. This implies >89% reduction, which is extremely strong.

Answer: Thank you for this insightful comment. We agree that the MTT data indicate a very strong reduction in biofilm-associated metabolic activity under the tested conditions and should be interpreted cautiously. In the revised manuscript, we have toned down the wording to avoid overinterpretation and now explicitly state that the MTT assay reflects metabolic activity within the biofilm, rather than directly proving complete biofilm eradication or cell death.

We retained the reported values because they reflect the measured MTT signal under our experimental conditions, but we revised the results wording to describe these results as a marked suppression of biofilm-associated metabolic activity. We also note that additional assays would be needed to further distinguish metabolic suppression from loss of viability/biomass.

Modification in Manuscript：(lines 533–541)

The MTT assay showed that P-FAH-Cu-phen markedly reduced biofilm-associated metabolic activity after 24 h treatment (Fig. 6B), with relative metabolic activities of 9.68%, 6.41%, 8.00%, 7.18%, and 10.76% at 1, 1/2, 1/4, 1/8, and 1/16 MIC, respectively. These results indicate strong suppression of biofilm metabolic activity under the tested conditions.

 

The response to the reviewer #1:

Question 15: Table 1. Provide amplicon size and conditions for PCR.

Answer: Thank you for this helpful comment. We agree that providing the amplicon size and PCR/qPCR conditions would improve reproducibility.

In the revised manuscript, we have added the amplicon size (bp) for each primer pair in Table 1. We have also expanded the qRT-PCR subsection in the Materials and Methods to include the reaction system and cycling conditions. Briefly, qRT-PCR was performed in a 20 μL reaction system (including 2× SYBR Green premix, primers, cDNA template, and RNase-free ddH₂O), with cycling conditions of 95 °C for 15 min, followed by 40 cycles of 95 °C for 10 s, 58 °C for 20 s, and 72 °C for 20 s, and a final extension at 72 °C for 5 min. A melting curve analysis (60-95 °C) was also performed to verify amplicon specificity. To avoid overcrowding Table 1, the detailed qRT-PCR conditions are provided in the Methods section

Table 1 qRT-PCR primmers

Gene code	Forvard primers sequence	Reverse primers sequence	Amplicon size (bp)
16S rRNA	GCTGCCCTTTGTATTGTC	AGATGTTGGGTTAAGT CCC	187
sea	ATGGTGCTTATTATGGTTATC	CGTTTCCAAAGGTACTGTATT	426
hla	TTGGTGCAAATGTTTC	TCACTTTCCAGCCTACT	312
agrA	TGATAATCCTTATGAGGTGCTT	CACTGTGCTCGTAACGAAA	259

 

The response to the reviewer #1:

Question 16: Grammatical errors are seen.

Answer: Thank you for your comment. We agree that the original manuscript contained grammatical and language issues. In the revised version, we have carefully proofread the entire manuscript and corrected grammatical errors, sentence structure problems, and wording inconsistencies to improve clarity and readability.

 

The response to the reviewer #1:

Question 17: Abbreviation Issue. Expand all abbreviations at first mention in the text.

Answer: Thank you for this helpful comment. We agree that all abbreviations should be expanded at first mention to improve clarity and readability. In the revised manuscript, we carefully checked the entire manuscript and revised the text so that abbreviations are spelled out at first occurrence, followed by the abbreviation in parentheses, and used consistently thereafter.

In addition, we reviewed abbreviation usage across the Abstract, main text, tables, and figure legends to ensure consistency throughout the manuscript.

 

The response to the reviewer #1:

Question 18: Remove Table 2 and embed its data within the text

Answer: Thank you for this helpful suggestion. We agree that the information in Table 2 can be presented more concisely in the main text. In the revised manuscript, we have removed Table 2 and incorporated the corresponding antibacterial data (DIZ, MIC, and MBC values) into the Results section to improve readability and reduce redundancy. The numbering of subsequent tables/figures has been updated accordingly.

The antimicrobial activity of P-FAH-Cu-phen against S. aureus was quantitatively evaluated by determining the diameter of inhibition zone (DIZ), minimum inhibitory concentration (MIC), and minimum bactericidal concentration (MBC). No obvious inhibition zone was observed in the DMSO control group. In contrast, the DIZ increased from 11.50 ± 0.29 mm to 14.00 ± 0.50 mm as the concentration of P-FAH-Cu-phen increased from 200 μg/mL to 400 μg/mL, indicating a concentration-dependent antibacterial effect against S. aureus. The MIC and MBC values were 1.4 μg/mL and 2.8 μg/mL, respectively, with an MBC/MIC ratio of 2.

 

The response to the reviewer #1:

Question 19: [Coagulase is an important virulence factor of S. aureus, which is able to activate plasminogen and disrupt thrombosis]: it needs reference

Answer: Thank you for this important comment. We agree that this statement required a supporting reference. In revising the manuscript, we also recognized that the original wording was not sufficiently precise. We have therefore revised the sentence to more accurately describe the role of coagulase in S. aureus virulence (i.e., its contribution to fibrin clot formation/immune evasion and persistence), and we have added the appropriate reference(s) to support this statement.

Coagulase is an important virulence factor of S. aureus that contributes to fibrin clot formation, immune evasion, and bacterial persistence during infection.

References

Evans, D.C.S.; Khamas, A.B.; Payne-Dwyer, A.; Wollman, A.J.M.; Rasmussen, K.S.; Klitgaard, J.K.; Kallipolitis, B.; Leake, M.C.; Meyer, R.L. Cooperation between Coagulase and von Willebrand Factor Binding Protein in Staphylococcus Aureus Fibrin Pseudocapsule Formation. Biofilm 2024, 8, 100233, doi:10.1016/j.bioflm.2024.100233.

 

Acknowledgment

Dear Editor and Reviewers,

We would like to express our heartfelt gratitude for the detailed and insightful feedback and suggestions you have provided for our manuscript. Your valuable time, effort, and professional guidance have not only helped us identify areas for improvement but also provided us with a clear direction for revising our work. Based on your comments, we have made comprehensive revisions to the manuscript, which have significantly enhanced both the academic quality and readability of our research.

Throughout this process, we have deeply appreciated your high standards of academic rigor and your dedicated attitude toward ensuring the accuracy and clarity of research work. It is through your meticulous and thoughtful review that our findings are now presented in a more precise and comprehensible manner. For this, we express our sincere gratitude and respect.

We sincerely look forward to the acceptance and publication of this manuscript. If you have any further questions or additional suggestions, we warmly welcome continued communication and will spare no effort in addressing and incorporating any necessary revisions.

Finally, we would like to once again thank you for the time and expertise you have devoted to our work. We wish you continued success in your professional endeavors, good health, and a fulfilling life.

Sincerely,

Dongyuan Zhou

*Corresponding Author E-mail:

 lijinyu234@163.com

 

Author Response File: Author Response.pdf

Reviewer 2 Report

Comments and Suggestions for Authors

The manuscript presents a comprehensive preclinical evaluation of the pyrazolone copper complex P-FAH-Cu-phen against Staphylococcus aureus, combining in vitro antibacterial, anti-virulence, antibiofilm, and in vivo wound-healing data. The scope is ambitious and generally well aligned with the stated aims. The antibacterial activity is strong, the resistance-selection experiment is a notable strength, and the integration of mechanistic assays with an infected wound model enhances translational relevance.

However, several issues limit the rigor of mechanistic interpretation and the strength of the translational claims. These mainly concern experimental controls, interpretation of resistance and virulence data, assay design choices, and incomplete safety assessment. Addressing these points would substantially strengthen the manuscript.

Major comments

1. Limited strain diversity and clinical relevance

All experiments appear to be conducted using a single S. aureus strain of unspecified origin and resistance background.

• No information is provided on whether this strain is MSSA or MRSA.

• Activity against clinical isolates is not assessed.

Why this matters:
Antimicrobial and anti-virulence effects can vary markedly across S. aureus lineages. Conclusions about therapeutic potential are premature without testing against multiple strains, ideally including MRSA.

Recommendation:
Include MIC/MBC and at least key phenotypic assays (killing kinetics or biofilm inhibition) on a small panel of clinical isolates, or explicitly limit claims to the tested strain.

2. Interpretation of resistance development needs caution

The multistep resistance assay is a strength, but its interpretation is overstated.

• Gentamicin and DMSO are used as comparators, but DMSO is not an antibiotic and its MIC increase is biologically unclear.

• Resistance is defined solely by MIC shifts without genomic or phenotypic validation.

• Serial passaging at a fixed MIC does not rule out tolerance, persistence, or adaptive stress responses.

Why this matters:
The claim of “low resistance potential” is strong and clinically sensitive.

Recommendation:
Tone down conclusions to “no detectable MIC increase under the tested conditions.” Ideally, add growth-rate analysis, post-passage fitness assessment, or recovery experiments after drug withdrawal.

3. Mechanistic claims exceed the direct evidence

The manuscript repeatedly attributes activity to “cell-envelope disruption,” but the assays used are indirect.

• AKP leakage, macromolecule release, and reduced ATPase activity indicate membrane stress but do not establish primary membrane targeting.

• ATPase activity is measured in supernatants, not membranes, which complicates interpretation.

• No direct membrane integrity assays are included (e.g., membrane potential dyes, lipid peroxidation, electron microscopy of planktonic cells).

Why this matters:
Copper complexes are pleiotropic; overstating a specific mechanism weakens credibility.

Recommendation:
Reframe the mechanism as “envelope-associated dysfunction” rather than definitive membrane disruption, or add a direct membrane integrity assay.

4. Anti-virulence experiments confounded by bactericidal exposure

Virulence assays and qRT-PCR are conducted at 1×MIC.

• At this concentration, bacterial viability and global transcription may already be compromised.

• Early upregulation of hla and agrA followed by suppression complicates interpretation.

• Hemolysis and coagulase inhibition may reflect reduced bacterial fitness rather than targeted anti-virulence effects.

Why this matters:
Anti-virulence claims require separation from growth inhibition.

Recommendation:
Limit virulence conclusions to sub-MIC concentrations and explicitly acknowledge that transcriptional effects at MIC may reflect stress or killing rather than specific regulatory targeting.

5. Biofilm inhibition versus biofilm killing is not clearly distinguished

The study mixes prevention and eradication concepts.

• Biofilms are formed in the presence of the compound, but activity against mature biofilms is not tested.

• Crystal violet, MTT, and CFU results are not always concordant.

• Non-monotonic concentration responses are observed but not quantitatively analyzed.

Why this matters:
Clinically, established biofilms are more relevant than early formation.

Recommendation:
Clarify that the data address biofilm formation inhibition, not mature biofilm eradication. If possible, add a mature-biofilm treatment assay or narrow the claims.

6. In vivo efficacy lacks safety and comparator depth

The murine wound model is well executed, but safety assessment is minimal.

• No evaluation of local skin toxicity, irritation, or delayed healing in uninfected wounds.

• No systemic copper exposure or tissue accumulation data.

• Only mupirocin is used as a comparator, without dose equivalence discussion.

Why this matters:
Copper complexes raise specific toxicological concerns, especially for topical use.

Recommendation:
At minimum, acknowledge these gaps more explicitly. Inclusion of a non-infected wound group treated with P-FAH-Cu-phen would strengthen safety claims.

Minor comments

1. Units alternate between μg/mL and μM in different sections. Use one consistently and justify conversions.

2. The agar diffusion assay adds limited value given the MIC/MBC data and could be shortened.

3. Statistical methods are described generally; exact post-hoc tests are not specified.

4. Several assays reuse the same time points without justification (e.g., 5 h for AKP and ATPase).

5. The wound cytokine data include both TNF-α and IL-10; interpretation of reduced IL-10 is not discussed and may not be straightforward.

6. The comparison with the previously reported P-FAH-Cu-bpy compound is informative but partially anecdotal; a direct side-by-side experiment would be stronger.

7. The terms in vivo and in vitro should be written in italics throughout the entire manuscript, in accordance with standard scientific and journal formatting conventions.

8. The abbreviations MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration) should be defined at their first occurrence, preferably in the Introduction or at the first mention in the Results section. After definition, only the abbreviations should be used consistently. This comment applies to all abbreviations used in the manuscript.

9. The Introduction would benefit from the inclusion of specific, concrete studies reporting antibacterial activity of pyrazolone-based copper complexes. Citing representative examples from the literature would help to better position the current work and clearly highlight the novelty and added value of this study relative to existing reports.

10. Figure 4 lacks visual consistency compared with the other figures. In particular, the font style and size differ from the rest of the manuscript. Please unify the font and formatting across all figures as much as possible to ensure consistency.

11. In the main text, figures are referred to using both “Fig.” and “Figure.” Please standardize figure citations to “Figure X” throughout the manuscript, in line with journal formatting requirements.

12. Lines 511–525 appear in a different font from the surrounding text. Please ensure that the journal’s standard font is used consistently across the entire manuscript.

13. Figure 7 presents important in vivo results but is difficult to interpret due to its small size and high information density. Consider splitting this figure into multiple panels or separate figures to improve clarity and readability.

14. The Conclusion section could be strengthened by explicitly restating the most significant experimental findings, particularly those related to rapid bactericidal activity, resistance suppression, and in vivo therapeutic efficacy, to better emphasize the overall impact of the study.

Author Response

Dear Editor and Reviewers,

First and foremost, we would like to express our sincere gratitude for your time and effort in reviewing our manuscript. We greatly appreciate the constructive feedback you provided. In this revised version (Manuscript Number:microorganisms-4148361), we have made extensive changes based on your suggestions, and we believe these revisions have significantly improved the quality of the manuscript. Below, we address each of your comments in detail.

Should you have any questions or require further clarification regarding this manuscript, please do not hesitate to contact me.

Thank you once again for your valuable time and review.

Sincerely,

Dongyuan Zhou

*Corresponding Author E-mail:

lijinyu234@163.com

 

The response to the reviewer #2: Major comments

Question 1: Limited strain diversity and clinical relevance. All experiments appear to be conducted using a single S. aureus strain of unspecified origin and resistance background. No information is provided on whether this strain is MSSA or MRSA. Activity against clinical isolates is not assessed.

Why this matters:

Antimicrobial and anti-virulence effects can vary markedly across S. aureus lineages. Conclusions about therapeutic potential are premature without testing against multiple strains, ideally including MRSA.

Recommendation:

Include MIC/MBC and at least key phenotypic assays (killing kinetics or biofilm inhibition) on a small panel of clinical isolates, or explicitly limit claims to the tested strain.

Answer: Thank you for this important and constructive comment. We fully agree that strain diversity and resistance background are important for evaluating the broader clinical relevance of antibacterial and anti-virulence effects. This point overlaps in part with another reviewer’s comment on strain description; for completeness, we provide a full response here and have revised the manuscript accordingly.

In the revised manuscript, we have clarified that all experiments in the present study were conducted using a single strain, Staphylococcus aureus ATCC 25923, which is an MSSA (methicillin-susceptible S. aureus) reference strain. We have added the strain designation, resistance background (MSSA), source, and culture details in the Materials and Methods section, and clarified that the same strain was used throughout the in vitro assays and the murine wound infection model.

We agree with the reviewer that antibacterial and anti-virulence responses may vary across S. aureus lineages, including MRSA and clinical isolates. In the current work, our aim was to perform an initial proof-of-concept evaluation of P-FAH-Cu-phen under controlled and reproducible conditions using a well-established reference strain. We did not assess activity against clinical isolates or MRSA strains in this study.

To address this concern, we have explicitly limited our claims in the revised manuscript to the tested strain/experimental conditions and toned down statements regarding therapeutic potential. We also added a limitation statement in the Discussion noting that future studies should include a panel of clinical isolates (including MRSA) and key phenotypic assays (e.g., MIC/MBC, killing kinetics, and biofilm-related assays) to assess the generalizability and clinical relevance of P-FAH-Cu-phen.

We appreciate this recommendation, which has helped us improve the rigor and scope framing of the manuscript.We have added the information in test (lines 148–164, 738-748).

The response to the reviewer #2: Major comments

Question 2: Interpretation of resistance development needs caution

The multistep resistance assay is a strength, but its interpretation is overstated.

Gentamicin and DMSO are used as comparators, but DMSO is not an antibiotic and its MIC increase is biologically unclear.

Resistance is defined solely by MIC shifts without genomic or phenotypic validation.

Serial passaging at a fixed MIC does not rule out tolerance, persistence, or adaptive stress responses.

Why this matters:

The claim of “low resistance potential” is strong and clinically sensitive.

Recommendation:

Tone down conclusions to “no detectable MIC increase under the tested conditions.” Ideally, add growth-rate analysis, post-passage fitness assessment, or recovery experiments after drug withdrawal.

Answer: Thank you for this insightful and constructive comment. We agree that our original interpretation of the multistep passaging assay was too strong. In the revised manuscript, we have substantially toned down the wording and no longer describe the result as indicating a “low resistance potential.” Instead, we now state that no detectable MIC increase was observed for P-FAH-Cu-phen under the tested serial passaging conditions.

We also agree that DMSO is a vehicle control rather than an antibiotic comparator. In the revised text, we have clarified its role as a solvent control and removed wording that could imply biological interpretation of DMSO as an antimicrobial comparator in the resistance-development context.

In addition, we now explicitly acknowledge that the current assay is based on MIC shifts only and was not supported by genomic or additional phenotypic validation. We also clarify that serial passaging under a fixed exposure condition does not exclude tolerance, persistence, or adaptive stress responses. Accordingly, we have added a limitation/future-direction statement indicating that follow-up studies (e.g., recovery experiments after drug withdrawal, growth/fitness analysis, and molecular validation) are needed to better characterize adaptation and resistance risk.

Revised Results text:
To assess adaptive changes during repeated exposure, S. aureus was serially passaged in the presence of P-FAH-Cu-phen for 30 generations. As shown in Fig. 3, the MIC of P-FAH-Cu-phen fluctuated slightly during the early passages and then remained stable through the later generations, with no detectable overall increase under the tested conditions. In contrast, the MIC of gentamicin increased during serial passaging. DMSO was included as the vehicle control. These data indicate that, under the present serial passaging conditions, repeated exposure to P-FAH-Cu-phen did not produce a measurable MIC shift. We have added the information in test (lines 439–446).

Revised Discussion text:
Using a multistep passaging assay, no detectable MIC increase was observed for P-FAH-Cu-phen under the tested serial passaging conditions (Figure. 3). In contrast, the MIC of gentamicin increased substantially under the same conditions, consistent with the known propensity of S. aureus to develop reduced susceptibility to conventional antibiotics[37,38]. However, it is important to note that the current assay evaluates MIC shifts only and does not by itself distinguish stable genetic resistance from tolerance, persistence, or transient adaptive stress responses. Further studies—including recovery after drug withdrawal, fitness analyses, genomic sequencing, and phenotypic characterization of passaged isolates-will be necessary to fully define the adaptive potential of S. aureus in response to P-FAH-Cu-phen[38,39]. We have added the information in test (lines 633–642).

 

The response to the reviewer #2: Major comments

Question 3: Mechanistic claims exceed the direct evidence

The manuscript repeatedly attributes activity to “cell-envelope disruption,” but the assays used are indirect.

AKP leakage, macromolecule release, and reduced ATPase activity indicate membrane stress but do not establish primary membrane targeting.

ATPase activity is measured in supernatants, not membranes, which complicates interpretation.

No direct membrane integrity assays are included (e.g., membrane potential dyes, lipid peroxidation, electron microscopy of planktonic cells).

Why this matters:

Copper complexes are pleiotropic; overstating a specific mechanism weakens credibility.

Recommendation:

Reframe the mechanism as “envelope-associated dysfunction” rather than definitive membrane disruption, or add a direct membrane integrity assay.

Answer: Thank you for this insightful and constructive comment. We agree that the mechanistic interpretation in the original manuscript was stronger than warranted by the current data.

As the reviewer correctly points out, the assays used in this study (extracellular AKP activity, release of nucleic acids/proteins, and ATPase-related readouts) provide indirect evidence of cell-envelope stress and leakage-associated dysfunction, but do not by themselves establish primary membrane targeting or definitive membrane disruption. We also agree that the ATPase assay, as performed in this study, reflects enzyme-related changes measured in culture supernatants rather than direct activity measurements in isolated membrane fractions, and therefore should be interpreted cautiously.

In the revised manuscript, we have therefore reframed the mechanistic description throughout the Abstract, Results, Discussion, and figure/section titles. Specifically, we now describe the findings as indicating “cell-envelope/envelope-associated dysfunction” or “envelope stress accompanied by leakage-related changes”, rather than definitive membrane disruption. We have also toned down statements implying a specific primary membrane-targeting mechanism and added a limitation statement noting that direct membrane integrity assays (e.g., membrane potential dyes, lipid peroxidation assays, or microscopy of planktonic cells) were not included in the present study.We have added the information in test (lines 455-486; 643–660)

Revised Results text: Line(455-486)

3.3 In vitro mechanism of action

3.3.1 Envelope-associated dysfunction (AKP leakage and macromolecule release)

Alkaline phosphatase (AKP), a cell envelope–associated enzyme, is commonly used as an indicator of increased cell wall/cell envelope permeability, as its extracellular activity rises when the envelope barrier is perturbed[28]. As shown in Figure 4A, exposure to 2×MIC P-FAH-Cu-phen for 5 h increased extracellular AKP activity in S. aureus from 4.306 to 6.9065 U/mL prot compared with the untreated control. This increase is consistent with treatment-associated envelope stress accompanied by AKP leakage into the culture supernatant.

Further evidence of envelope-associated dysfunction was provided by the increased extracellular release of nucleic acids and proteins. Relative to the control, nucleic acid release increased by 2.1-fold and 2.4-fold after treatment with 1×MIC and 2×MIC P-FAH-Cu-phen, respectively (Figure 4B). Likewise, the extracellular protein content increased by 4.5-fold and 5.6-fold, respectively (Figure 4C). Collectively, these findings demonstrate that P-FAH-Cu-phen treatment impairs the envelope barrier function of S. aureus.

 

Figure 4 In vitro mechanisms of bacterial inhibition by P-FAH-Cu-phen against S. aureus. (A) AKP activity after treatment 0 h or 5 h. (B) Extracellular nucleic acid(OD₂₆₀nm) release. (C) Extracellular protein content. (D) K⁺-Na⁺-ATPase activity after treatment 0 h or 5 h. (E) Ca²⁺-Mg²⁺-ATPase activity after treatment 0 h or 5 h.  Analysis by two-way ANOVA or one-way ANOVA; ***P < 0.001 vs. 5 h group or Control group; ##P < 0.01 vs. 0 h group; ns, non-significant.

3.3.2 Membrane-associated ATPase activity

ATPase-related functions are important for maintaining ion homeostasis and energy-associated physiological processes in bacteria[29,30]. Following 5 h of P-FAH-Cu-phen treatment, the extracellularly measured K⁺-Na⁺-ATPase-related readout in S. aureus decreased from 5.9877 to 3.9816 U/mL compared with the untreated control (Figure 4D). Similarly, the Ca²⁺-Mg²⁺-ATPase-related readout declined from 5.3319 to 2.6685 U/mL (Figure 4E). These results indicate that P-FAH-Cu-phen treatment perturbed ATPase-related functions, contributing to envelope-associated dysfunction under the tested conditions.

Revised Discussion text: Line(643-660)

Pyrazolone-based scaffolds are widely represented in bioactive molecules and drug-like compounds, and their aromatic/π-conjugated frameworks together with hydrogen-bonding functionality may facilitate interactions with diverse biomolecular targets[40–43]. Consistent with this general premise, our mechanistic assays suggest that P-FAH-Cu-phen induces envelope-associated dysfunction in S. aureus. Specifically, extracellular AKP activity increased after treatment, which is consistent with envelope stress and leakage of envelope-associated enzymes. In parallel, the marked elevation of nucleic acids and proteins in the culture supernatant further supports leakage-associated changes in envelope barrier function under the tested conditions. In addition, ATPase-related readouts measured in the culture supernatant (K⁺-Na⁺-ATPase and Ca²⁺-Mg²⁺-ATPase) decreased after exposure to P-FAH-Cu-phen, suggesting perturbation of ion-homeostasis- and energy-related processes[44,45]. Our mechanistic assays suggest envelope-associated dysfunction in S. aureus, supported by increased AKP leakage, macromolecule release, higher conductivity, and altered ATPase-related readouts in supernatants. Because these measures are indirect and ATPase readouts were not obtained from isolated membrane fractions, the data do not establish primary membrane targeting; direct membrane integrity assays are needed to clarify the primary target.

We appreciate the reviewer’s suggestion, which has helped us improve the precision and credibility of the mechanistic interpretation.

 

The response to the reviewer #2: Major comments

Question 4: Anti-virulence experiments confounded by bactericidal exposure

Virulence assays and qRT-PCR are conducted at 1×MIC.

At this concentration, bacterial viability and global transcription may already be compromised.

Early upregulation of hla and agrA followed by suppression complicates interpretation.

Hemolysis and coagulase inhibition may reflect reduced bacterial fitness rather than targeted anti-virulence effects.

Why this matters:

Anti-virulence claims require separation from growth inhibition.

Recommendation:

Limit virulence conclusions to sub-MIC concentrations and explicitly acknowledge that transcriptional effects at MIC may reflect stress or killing rather than specific regulatory targeting.

Answer: Thank you for this insightful and important comment. We agree that anti-virulence experiments at 1×MIC may be confounded by growth inhibition and bactericidal effects, which could affect transcriptional regulation and complicate the interpretation of early upregulation of virulence genes like hla and agrA. 

In the revised manuscript, we have limited the virulence-related conclusions to sub-MIC concentrations, where the effects on virulence are more likely to be due to anti-virulence activity rather than general growth inhibition. We have explicitly acknowledged in the Discussion that transcriptional changes at 1×MIC may reflect stress responses or bactericidal effects, rather than targeted regulation of virulence factors. We also highlight that the early upregulation of hla and agrA, followed by suppression, may indicate a transient stress response rather than a specific anti-virulence effect.

Revised Results text:

(lines 512–525):As illustrated in Figure 5D, qRT-PCR analysis showed that exposure to P-FAH-Cu-phen induced time-dependent changes in the transcription of virulence-related genes (sea, hla, and agrA) in S. aureus. Notably, both hla and agrA exhibited an initial increase in transcript levels at 30 min after treatment. Given the early time point, this response may represent a transient transcriptional adaptation to compound exposure, potentially indicative of an early stress response.

 

 

Figure 5 Effects of P-FAH-Cu-phen on Virulence in S.aureus. (A) Red blood cells hemolysis assay and photographs images for direct ovservation of hemolysis by test samples. (B) Hemolysis ratio quantification. (C) Coagulase inhibition images. (D) qRT-PCR analysis of the expression of virulence factor genes (sea, hla, and agrA) in S. aureus. Data are representative of three indepent experiments and analyzed by One-way ANOVA or two ANOVA, ***P < 0.001 compared to the Triton X-100 group or the 30 min group. ###P < 0.001 compared to the 2 h group.

Revised Discussion text:

(lines 718–737): S. aureus produces multiple virulence factors, including hemolysins, enterotoxins, and coagulase, which contribute to host damage and persistence[46]. α-Hemolysin is a key mediator of cytotoxicity, and strategies that reduce hemolysis may attenuate pathogenicity independently of growth inhibition[47,48]. In this study, P-FAH-Cu-phen reduced hemolytic activity in S. aureus culture supernatants, including at sub-MIC concentrations, indicating suppression of a toxin-associated phenotype under conditions where bactericidal effects are minimal. P-FAH-Cu-phen also reduced coagulase activity， although this effect was less pronounced at sub-MIC levels, suggesting that reduced bacterial fitness at higher concentrations may contribute to the observed phenotype[49]. qRT-PCR showed time-dependent changes in sea, hla, and agrA (a key regulator in the agr quorum-sensing system)[50]. At 30 min, hla and agrA were transiently upregulated, which may reflect an early stress response or adaptive feedback. By 2 h, the expression of all three genes was downregulated, including reduced expression of the toxin-associated genes sea and hla[51]. These transcriptional changes were observed at 1×MIC, a concentration at which bacterial fitness and global transcription may be affected. Under these bactericidal conditions, the observed modulation of virulence-related gene expression likely reflects a combination of direct compound effects and broader cellular stress responses.

We appreciate your suggestion, which has helped us refine the interpretation of our data and appropriately frame the conclusions.

 

The response to the reviewer #2: Major comments

Question 5: Biofilm inhibition versus biofilm killing is not clearly distinguished

The study mixes prevention and eradication concepts.

Biofilms are formed in the presence of the compound, but activity against mature biofilms is not tested.

Crystal violet, MTT, and CFU results are not always concordant.

Non-monotonic concentration responses are observed but not quantitatively analyzed.

Why this matters:

Clinically, established biofilms are more relevant than early formation.

Recommendation:

Clarify that the data address biofilm formation inhibition, not mature biofilm eradication. If possible, add a mature-biofilm treatment assay or narrow the claims.

Answer: Thank you for this important and constructive comment. We agree that the original manuscript did not sufficiently distinguish between biofilm formation inhibition and activity against mature biofilms.

In the present study, P-FAH-Cu-phen was added during the 24 h biofilm formation period in the crystal violet, MTT, and CFU assays. Therefore, these experiments evaluate the effect of the compound on biofilm formation/development under treatment, rather than eradication of pre-established mature biofilms. In the revised manuscript, we have clarified this point in the Results, and Discussion, and we have narrowed the relevant claims accordingly. 

We also clarified that the three assays capture different aspects of the biofilm phenotype: crystal violet reflects total biofilm biomass, MTT reflects biofilm-associated metabolic activity, and CFU enumeration reflects the number of cultivable bacteria recovered from the treated biofilm-associated population. Because these readouts measure distinct properties, complete quantitative concordance is not necessarily expected. In addition, we acknowledge that the observed non-monotonic concentration responses were not formally modeled and should not be overinterpreted mechanistically.

We have now added a limitation statement noting that mature-biofilm treatment/eradication was not directly assessed in this study, and that future work should include a dedicated mature-biofilm assay to evaluate whether P-FAH-Cu-phen can disrupt or eradicate established biofilms.

Revised Results text:Line (527-558)

The effect of P-FAH-Cu-phen on S. aureus biofilm formation was evaluated by co-incubating bacteria with the compound for 24 h. This experimental setup assesses the compound's ability to interfere with biofilm development, rather than its activity against pre-formed mature biofilms.

Crystal violet staining showed that P-FAH-Cu-phen reduced biofilm biomass compared with the untreated control, indicating inhibition of biofilm development under the tested conditions(Figure 6A). The MTT assay showed that P-FAH-Cu-phen markedly reduced biofilm-associated metabolic activity after 24 h treatment (Figure. 6B), with relative metabolic activities of 9.68%, 6.41%, 8.00%, 7.18%, and 10.76% at 1, 1/2, 1/4, 1/8, and 1/16 MIC, respectively.CFU enumeration demonstrated a significant reduction in the number of cultivable bacteria recovered from biofilms formed under P-FAH-Cu-phen treatment compared to the untreated control(Figure 6C). Taken together, these results indicate that P-FAH-Cu-phen interferes with biofilm formation/development and reduces the metabolic activity and cultivable cell burden of the resulting biofilm-associated population.

SEM supported these findings. In the untreated control, bacteria adhered densely to the coverslip surface, forming multilayered aggregates characteristic of biofilm formation (Figure 6D). In contrast, after treatment with 1×MIC or 1/2×MIC P-FAH-Cu-phen, only sparse bacterial adhesion was observed, with reduced intercellular aggregation and altered cell morphology, indicating impaired surface attachment and microcolony formation. CLSM further confirmed that P-FAH-Cu-phen inhibited biofilm formation: untreated controls showed thick biofilms with abundant live (SYTO9-positive) cells, whereas treated samples exhibited sparse coverage and a predominance of dead (PI-positive) cells (Figure 6E).

Collectively, these results demonstrate that P-FAH-Cu-phen effectively inhibits S. aureus biofilm formation under the tested co-incubation conditions, reducing biomass, metabolic activity, and viable cell numbers within the developing biofilm.

 

Figure 6 Effect of P-FAH-phen on S.aureus biofilms formation. (A) Crystal violet staining based quantification of biofilm biomass. (B) Quantification of MTT staining. (C) Enumeration of viable bacteria in biofilms. (D) scanning electron microscope images. (E) confocal laser scanning microscope image, ***P<0.001 when compared to Control.

Revised Discussion text:Line (691-715)

Biofilm formation significantly enhances bacterial tolerance to antibiotics and host immune defenses, contributing to the persistence of chronic infections[52]. In this study, we evaluated the effect of P-FAH-Cu-phen on S. aureus biofilm formation during a 24-h incubation using complementary assays, including crystal violet staining, the MTT assay, CFU enumeration, and microscopic imaging. The results demonstrate that P-FAH-Cu-phen effectively inhibits biofilm formation, reducing biomass, metabolic activity, and viable cell counts within the developing biofilm.

Notably, the inhibitory effects were not entirely concordant across different assays: crystal violet staining showed reduced biomass at 1/16×MIC, whereas changes in MTT readouts and CFU counts at this concentration were relatively limited. This partial discrepancy is not unexpected, as these three methods assess different aspects of biofilms-matrix-associated biomass, cellular metabolic activity, and cultivable cell numbers—each of which may be differentially affected by drug treatment due to biofilm heterogeneity. Similar non-linear concentration-response patterns have been reported for small-molecule perturbations in other bacterial systems[53].

It should be emphasized that the present study assessed inhibition of biofilm formation during co-incubation with P-FAH-Cu-phen, rather than eradication of pre-established mature biofilms. Mature biofilms are clinically more relevant in chronic infections; therefore, while our findings suggest that P-FAH-Cu-phen has potential to prevent biofilm development, its efficacy against established biofilms requires further investigation. The non-monotonic concentration responses observed across different assays also reflect the inherent complexity of biofilm development and underscore the value of using multiple complementary methods to evaluate antibiofilm activity.

 

The response to the reviewer #2: Major comments

Question 6: In vivo efficacy lacks safety and comparator depth

The murine wound model is well executed, but safety assessment is minimal.

No evaluation of local skin toxicity, irritation, or delayed healing in uninfected wounds.

No systemic copper exposure or tissue accumulation data.

Only mupirocin is used as a comparator, without dose equivalence discussion.

Why this matters:

Copper complexes raise specific toxicological concerns, especially for topical use.

Recommendation:

At minimum, acknowledge these gaps more explicitly. Inclusion of a non-infected wound group treated with P-FAH-Cu-phen would strengthen safety claims.

Answer: Thank you for your constructive comment. We agree that the current study's safety evaluation is limited, and we appreciate the reviewer’s concern regarding copper complex toxicity, especially for topical use. 

In the revised manuscript, we have added a limitation statement in the Discussion, acknowledging the lack of a non-infected wound group, local skin toxicity, irritation, and delayed healing evaluations, which will be addressed in future studies. We have also included a statement regarding the absence of systemic copper exposure and tissue accumulation data, which will be explored in subsequent research. Additionally, we have included a dose-equivalence discussion with mupirocin as a comparator in the Discussion to further clarify the comparison and the use of mupirocin as a standard treatment. Line (738-748)

 

The response to the reviewer #2: Minor comments

Question 1: Units alternate between μg/mL and μM in different sections. Use one consistently and justify conversions.

Answer: Thank you for this helpful comment. We agree that the use of both μg/mL and μM in different sections was inconsistent and could cause confusion. In the revised manuscript, we have standardized the reporting of concentrations and now use μg/mL consistently throughout the text, tables, and figure legends. Where relevant, the corresponding μM values were recalculated based on the molecular weight of P-FAH-Cu-phen and checked for consistency, but the primary unit reported in the manuscript is now μg/mL.

 

The response to the reviewer #2: Minor comments

Question 2: The agar diffusion assay adds limited value given the MIC/MBC data and could be shortened.

Answer: Thank you for this helpful comment. We agree that the agar diffusion assay provides only limited additional information compared with the MIC/MBC data. In the revised manuscript, we have shortened the description of the agar diffusion assay and retained it only as a brief supportive visual result, while emphasizing MIC/MBC as the primary quantitative assessment of antibacterial activity.

Modification in Manuscript: We condensed the agar diffusion-related description in the Results section and revised the text so that DIZ is presented only as a supplementary visual indicator, whereas the main antibacterial evaluation is based on MIC/MBC and the subsequent plate/time-kill assays.

 

The response to the reviewer #2: Minor comments

Question 3: Statistical methods are described generally; exact post-hoc tests are not specified.

Answer: Thank you for this helpful comment. We agree that the statistical analysis section in the original manuscript did not specify the exact post hoc test clearly enough. In the revised manuscript, we have now explicitly stated that multiple-group comparisons were analyzed by one-way ANOVA, followed by [Tukey’s / Dunnett’s] post hoc test for multiple comparisons. We also revised the relevant figure legends where appropriate to improve clarity and reproducibility. (Line 410-417)

 

The response to the reviewer #2: Minor comments

Question 4: Several assays reuse the same time points without justification (e.g., 5 h for AKP and ATPase).

Answer: Thank you for this helpful comment. We agree that the rationale for using the same sampling time point in several assays was not clearly stated in the original manuscript.

In the revised manuscript, we have clarified that the 5 h time point was selected as a common endpoint for the AKP and ATPase-related assays to allow direct comparison of envelope-associated readouts under the same exposure conditions (See line253-256) .This time point was used because it provided measurable biochemical changes under the tested conditions while avoiding an excessively late endpoint that might introduce additional secondary effects.

We also acknowledge that a more detailed time-course analysis was not performed in the present study. This has now been noted as a limitation, and future work will examine earlier and later time points to better define the temporal dynamics of these responses.

 

The response to the reviewer #2: Minor comments

Question 5: The wound cytokine data include both TNF-α and IL-10; interpretation of reduced IL-10 is not discussed and may not be straightforward.

Answer: Thank you for your valuable comment. We agree that the reduced IL-10 levels observed in our study were not fully discussed and require further clarification.

IL-10 is an important anti-inflammatory cytokine that plays a crucial role in balancing immune responses and preventing excessive inflammation. A reduction in IL-10 could suggest a shift towards a more pro-inflammatory environment or a failure in the anti-inflammatory response. In the context of wound healing, IL-10 reduction may not necessarily correlate with an overall increase in inflammation; rather, it could indicate a disruption in the delicate balance between pro- and anti-inflammatory mediators.

We have now added a more detailed interpretation of the IL-10 data in the Discussion section, acknowledging that the reduced IL-10 levels could represent an altered immune response rather than a simple increase in inflammation. This finding may also indicate the need for further investigation into the role of IL-10 in wound healing and immune regulation following treatment with P-FAH-Cu-phen. (Line 728-737)

Revised Discussion text

IL-10 is an important anti-inflammatory cytokine that plays a crucial role in balancing immune responses and preventing excessive inflammation. A reduction in IL-10 could suggest a shift towards a more pro-inflammatory environment or a failure in the anti-inflammatory response. In the context of wound healing, IL-10 reduction may not necessarily correlate with an overall increase in inflammation; rather, it could indicate a disruption in the delicate balance between pro- and anti-inflammatory mediators. Notably, the present data do not distinguish whether the beneficial effects are driven primarily by reduced bacterial load or by altered host responses, and the underlying mechanisms warrant further investigation.

 

The response to the reviewer #2: Minor comments

Question 6: The comparison with the previously reported P-FAH-Cu-bpy compound is informative but partially anecdotal; a direct side-by-side experiment would be stronger.

Answer: Thank you for this helpful and constructive comment. We agree that the comparison with the previously reported P-FAH-Cu-bpy compound is informative only as a contextual reference and should not be interpreted as a direct performance comparison.

In the revised manuscript, we have toned down the wording of this comparison and clarified that the discussion of P-FAH-Cu-bpy is included only to provide background within the same compound family. Because the two compounds were not evaluated side-by-side under identical experimental conditions in the present study, no definitive conclusion regarding relative efficacy or mechanistic superiority can be drawn.Line (661-671)

Revised Discussion text

Notably, we previously reported a closely related congener, P-FAH-Cu-bpy, in which 1,10-phenanthroline is replaced by 2, 2'-bipyridine. Despite this co-ligand substitution, P-FAH-Cu-bpy exhibited comparably potent antibacterial activity and rapid killing, together with a similar set of mechanistic signatures, including increased leakage markers (e.g., AKP activity and release of nucleic acids/proteins), decreased ATPase activities, elevated intracellular Cu accumulation, and a low propensity for resistance development upon serial passaging[9]. Taken together, these cross-study consistencies support a scaffold-class effect dominated by the shared Cu-pyrazolone framework, while the co-ligand (phen vs bpy) likely tunes physicochemical properties (e.g., stability/lipophilicity and uptake) rather than fundamentally changing the qualitative antibacterial phenotype.

 

The response to the reviewer #2: Minor comments

Question 7: The terms in vivo and in vitro should be written in italics throughout the entire manuscript, in accordance with standard scientific and journal formatting conventions.

Answer: Thank you for this helpful comment. We agree that in vivo and in vitro should be formatted in italics in accordance with standard scientific writing conventions. In the revised manuscript, we have carefully checked the entire text and corrected the formatting of in vivo and in vitro throughout the manuscript.

 

The response to the reviewer #2: Minor comments

Question 8: The abbreviations MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration) should be defined at their first occurrence, preferably in the Introduction or at the first mention in the Results section. After definition, only the abbreviations should be used consistently. This comment applies to all abbreviations used in the manuscript.

Answer: Thank you for this helpful comment. We agree and have already corrected this in the revised manuscript. MIC and MBC are now defined at first mention, and the abbreviations are used consistently thereafter. We also applied the same revision principle to all abbreviations throughout the manuscript.

 

The response to the reviewer #2: Minor comments

Question 9: The Introduction would benefit from the inclusion of specific, concrete studies reporting antibacterial activity of pyrazolone-based copper complexes. Citing representative examples from the literature would help to better position the current work and clearly highlight the novelty and added value of this study relative to existing reports.

Answer: Thank you for this helpful and constructive comment. We agree that the Introduction would be strengthened by citing more specific studies on the antibacterial activity of pyrazolone-based copper complexes. In the revised manuscript, we have added representative literature examples reporting the antimicrobial properties of related acylpyrazolone/pyrazolone-derived Cu(II) complexes to better position the current study within the existing field.

Specifically, we now cite prior studies showing that pyrazolone-based Cu(II) complexes can exhibit measurable antibacterial activity against both Gram-positive and Gram-negative bacteria, including the report by Poormohammadi et al. on antibacterial pyrazolone-based Schiff-base copper complexes and our previously reported P-FAH-Cu-bpy compound, which showed antibacterial activity against E. coli and S. aureus under separate experimental settings. These additions help clarify the background and allow us to more explicitly state the novelty of the present study, namely the evaluation of P-FAH-Cu-phen in a focused S. aureus anti-infective context, including anti-virulence, antibiofilm, and infected-wound model assessments. Line (72-88)

 

The response to the reviewer #2: Minor comments

Question 10: Figure 4 lacks visual consistency compared with the other figures. In particular, the font style and size differ from the rest of the manuscript. Please unify the font and formatting across all figures as much as possible to ensure consistency.

Answer: Thank you for this helpful comment. We agree that Figure 4 was not fully consistent with the other figures in terms of font style and size. In the revised manuscript, we have reformatted Figure 4 to match the visual style used throughout the other figures, including the font type, font size, and overall labeling format, in order to improve consistency across the manuscript.

 

The response to the reviewer #2: Minor comments

Question 11: In the main text, figures are referred to using both “Fig.” and “Figure.” Please standardize figure citations to “Figure X” throughout the manuscript, in line with journal formatting requirements.

Answer: Thank you for this helpful comment. We agree that figure citations should be formatted consistently throughout the manuscript. In the revised version, we have carefully checked the entire text and standardized all figure citations to “Figure X” in accordance with the journal’s formatting requirements.

 

The response to the reviewer #2: Minor comments

Question 12: Lines 511–525 appear in a different font from the surrounding text. Please ensure that the journal’s standard font is used consistently across the entire manuscript.

Answer: Thank you for this helpful comment. We agree that a portion of the text in the original manuscript was not formatted consistently with the surrounding content. In the revised manuscript, this formatting issue has been corrected, and we have ensured that the journal’s standard font is used consistently in the revised text.

 

The response to the reviewer #2: Minor comments

Question 13: Figure 7 presents important in vivo results but is difficult to interpret due to its small size and high information density. Consider splitting this figure into multiple panels or separate figures to improve clarity and readability.

Answer: Thank you for this helpful comment. We agree that the original Figure 7 contained a high density of in vivo data and was difficult to interpret in its original format. In the revised manuscript, we have reorganized and split the original Figure 7 into two separate figures to improve clarity and readability.

Specifically, the original figure has been divided into:
(i) Figure 7, which now includes the experimental design and macroscopic wound-healing outcomes (former panels A–F), and
(ii) Figure 8, which now presents the histological, hydroxyproline, bacterial burden, and cytokine data (former panels G–K).

This reorganization reduces visual crowding and makes the in vivo results easier to follow. The figure numbering, panel labels, and corresponding in-text citations have been updated accordingly.

 

Figure 7 Experimental design and macroscopic wound-healing outcomes of P-FAH-Cu-phen in a murine S. aureus-infected wound model. (A) Schematic diagram of treatment experiment process for S.aureus-infected skin wounds in Mice. (B) Mouse skin wound model (C) Effect of P-FAH-Cu-phen treatment on body weight of mice. (D) Representative photographs of cutaneous abscesses after treatment with P-FAH-Cu-phen or Mupirocin treatment.(E) Skin Trauma Schematic. (F) The would healing of skin ulcers over 10 days. Data represented as mean ± SD from three independent biological replicates (n = 10).Data are presented as mean ± SD. Statistical significance was analyzed by one-way ANOVA followed by Dunnett’s post hoc test. P < 0.05 was considered statistically significant. ***P < 0.001，****P < 0.0001 when compared to Control group.

 

Figure 8. Histological, antibacterial, and inflammatory evaluation of wound tissues after treatment with P-FAH-Cu-phen. (A) H&E staining of wound tissue sections from each group at 10 days after the treatment. (B) Effect of P-FAH-Cu-phen on hydroxyproline content. (C) LB culture pates of different groups of skin after treatment. (D) Quantitative analysis of bacteria colony. (E) Effects of P-FAH-Cu-phen on the levels of inflammatory factors IL-10 and TNF-α in mouse skin. Data are presented as mean ± SD. Statistical significance was analyzed by one-way ANOVA followed by Dunnett’s post hoc test. P < 0.05 was considered statistically significant. ***P < 0.001，****P < 0.0001 when compared to Control group.

 

The response to the reviewer #2: Minor comments

Question 14: The Conclusion section could be strengthened by explicitly restating the most significant experimental findings, particularly those related to rapid bactericidal activity, resistance suppression, and in vivo therapeutic efficacy, to better emphasize the overall impact of the study.

Answer: Thank you for this helpful comment. We agree that the original Conclusion section could more clearly restate the most important experimental findings. In the revised manuscript, we have strengthened the Conclusion by more explicitly summarizing the key results, including the rapid bactericidal activity of P-FAH-Cu-phen, the finding that no detectable MIC increase was observed under the tested serial passaging conditions, and its therapeutic efficacy in the murine S. aureus-infected wound model.

At the same time, we have kept the wording appropriately cautious so that the Conclusion remains consistent with the evidence presented in the study.

Revised conclusion text:

In summary, P-FAH-Cu-phen exhibited rapid bactericidal activity against S.aureus and produced integrated in vitro effects consistent with cell-envelope disruption, impairment of membrane-associated functions, and attenuation of virulence- and biofilm-related phenotypes. In an S. aureus-infected skin-trauma model, topical administration accelerated wound closure, improved histological repair, and increased hydroxyproline content, while reducing end-point bacterial burden and infection-associated cytokine levels. Collectively, these findings support further investigation of P-FAH-Cu-phen as a potential topical candidate for S. aureus-infected skin wounds

 

 

Acknowledgment

Dear Editor and Reviewers,

We would like to express our heartfelt gratitude for the detailed and insightful feedback and suggestions you have provided for our manuscript. Your valuable time, effort, and professional guidance have not only helped us identify areas for improvement but also provided us with a clear direction for revising our work. Based on your comments, we have made comprehensive revisions to the manuscript, which have significantly enhanced both the academic quality and readability of our research.

Throughout this process, we have deeply appreciated your high standards of academic rigor and your dedicated attitude toward ensuring the accuracy and clarity of research work. It is through your meticulous and thoughtful review that our findings are now presented in a more precise and comprehensible manner. For this, we express our sincere gratitude and respect.

We sincerely look forward to the acceptance and publication of this manuscript. If you have any further questions or additional suggestions, we warmly welcome continued communication and will spare no effort in addressing and incorporating any necessary revisions.

Finally, we would like to once again thank you for the time and expertise you have devoted to our work. We wish you continued success in your professional endeavors, good health, and a fulfilling life.

Sincerely,

Dongyuan Zhou

*Corresponding Author E-mail:

 lijinyu234@163.com

 

Author Response File: Author Response.pdf

Reviewer 3 Report

Comments and Suggestions for Authors

The manuscript entitled “Antibacterial activity of the pyrazolone copper complex P-FAH-Cu-phen against Staphylococcus aureus and promotion of healing of traumatized infected skin in mice” addresses a highly relevant and timely topic, namely the development of new topical antimicrobial agents with rapid bactericidal activity and low potential for resistance development. The study combines comprehensive in vitro analyses with an in vivo murine skin infection model, which significantly enhances the translational relevance of the findings.

The Introduction is well written, clearly structured, and provides an appropriate background and rationale for the study. The authors convincingly justify the need for novel anti-Staphylococcus aureus strategies and position the investigated copper complex well within the current state of knowledge.

The experimental design is robust, and the breadth of assays employed to elucidate antibacterial activity, mode of action, effects on virulence factors, and biofilm formation is commendable. The rapid bactericidal effect, lack of detectable resistance development, and multi-level interference with cell-envelope integrity and virulence regulation represent clear strengths of the study. The in vivo data further support the therapeutic potential of P-FAH-Cu-phen, demonstrating not only reduced bacterial burden but also enhanced wound healing and modulation of inflammatory markers. Overall, the manuscript is scientifically sound, well written, and likely to be of interest to a broad readership.

Only minor issues should be addressed prior to publication. At line 130, the supplier of the 7 mm paper disks used in the disk diffusion assay is not specified. For the sake of methodological transparency and reproducibility, this information should be included. In addition, throughout the manuscript (e.g., line 371 and elsewhere), in vitro and Latin names of microorganisms should be consistently written in italics, in accordance with standard scientific conventions.

In summary, this is a well-designed, clearly presented, and timely study with strong experimental support for its conclusions. After addressing the minor formal corrections outlined above, I recommend the manuscript for publication.

Author Response

Dear Editor and Reviewers,

First and foremost, we would like to express our sincere gratitude for your time and effort in reviewing our manuscript. We greatly appreciate the constructive feedback you provided. In this revised version (Manuscript Number:microorganisms-4148361), we have made extensive changes based on your suggestions, and we believe these revisions have significantly improved the quality of the manuscript. Below, we address each of your comments in detail.

Should you have any questions or require further clarification regarding this manuscript, please do not hesitate to contact me.

Thank you once again for your valuable time and review.

Sincerely,

Dongyuan Zhou

*Corresponding Author E-mail:

lijinyu234@163.com

 

 

The response to the reviewer #3:

Question 1: Only minor issues should be addressed prior to publication. At line 130, the supplier of the 7 mm paper disks used in the disk diffusion assay is not specified. For the sake of methodological transparency and reproducibility, this information should be included. In addition, throughout the manuscript (e.g., line 371 and elsewhere), in vitro and Latin names of microorganisms should be consistently written in italics, in accordance with standard scientific conventions.

 

Answer: We sincerely thank the reviewer for the positive and encouraging evaluation of our work, and we are grateful for the recommendation for publication after minor revision.

Regarding the specific comments:

1. Supplier information for the 7 mm paper disks:
   Thank you for pointing out this omission. In the revised manuscript, we have added the supplier information for the 7 mm sterile paper disksused in the disk diffusion assay in the Materials and Methodssection to improve methodological transparency and reproducibility. Line 159.
2. Italic formatting of in vitroand microbial Latin names:
   Thank you for this helpful reminder. In the revised manuscript, we have carefully checked the entire text and standardized the formatting so thatin vitro and all Latin names of microorganisms are consistently written in italics throughout the manuscript, in accordance with standard scientific conventions.

We appreciate these helpful suggestions, which have improved the clarity and consistency of the manuscript.

 

Acknowledgment

Dear Editor and Reviewers,

We would like to express our heartfelt gratitude for the detailed and insightful feedback and suggestions you have provided for our manuscript. Your valuable time, effort, and professional guidance have not only helped us identify areas for improvement but also provided us with a clear direction for revising our work. Based on your comments, we have made comprehensive revisions to the manuscript, which have significantly enhanced both the academic quality and readability of our research.

Throughout this process, we have deeply appreciated your high standards of academic rigor and your dedicated attitude toward ensuring the accuracy and clarity of research work. It is through your meticulous and thoughtful review that our findings are now presented in a more precise and comprehensible manner. For this, we express our sincere gratitude and respect.

We sincerely look forward to the acceptance and publication of this manuscript. If you have any further questions or additional suggestions, we warmly welcome continued communication and will spare no effort in addressing and incorporating any necessary revisions.

Finally, we would like to once again thank you for the time and expertise you have devoted to our work. We wish you continued success in your professional endeavors, good health, and a fulfilling life.

Sincerely,

Dongyuan Zhou

*Corresponding Author E-mail:

 lijinyu234@163.com

Author Response File: Author Response.pdf

Round 2

Reviewer 2 Report

Comments and Suggestions for Authors

The authors responded at all request and modify accordingly. 

The manuscript can be accepted in the present form.

All the best!