Repercussions of Symbiotic Bacteria Associated with Entomopathogenic Nematodes and Their Biogenic Silver Nanoparticles on Immune Responses at Root-Knot Nematode Suppression
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Samples
2.1.1. Preparation of Root-Knot Nematode Inocula
2.1.2. Preparation of Culture Medium of Nematode Symbiotic Bacteria
2.1.3. Identification of Symbiotic Bacterial Isolate
16S rRNA Amplification and Sequencing
Phylogenetic Analysis Using the 16S rRNA Gene’s Obtained DNA Sequence
2.2. Synthesis of Biogenic Silver Nanoparticles (Ag-Nps)
Uv-Vis Spectrophotometer
2.3. Characterization of Biogenic Silver Nanoparticles
2.3.1. Transmission Electron Microscopy (TEM)
2.3.2. Microscopy (SEM)
2.3.3. Fourier Transforms Infrared Spectroscopy (FT-IR) Analysis
2.4. Laboratory Assessment of Bacterial Filtrate (Cell-Free) and Its Biogenic Silver Nanoparticle Activity
2.4.1. Mortality of Second-Stage Juveniles (J2s) of M. incognita
2.4.2. Hatchability of M. incognita Eggs
2.5. Detection of Gene Expression of Root-Knot Nematode
2.6. Cytotoxicity Determination
2.7. Data Analysis
2.8. Molecular Data Analysis
3. Results
3.1. Molecular Identification of Symbiotic Bacteria Strains
3.2. Characterization of Biogenic Ag-Nps
3.2.1. Uv–Vis Spectral
3.2.2. Transmission and Scanning Electron Microscopy (TEM and SEM)
3.2.3. FT-IR Analysis
3.3. Toxicity of Symbiotic X. indica’s Bacteria and Their Biogenic Ag-Nps on Second-Stage Juveniles (J2s) of M. incognita
3.4. Toxicity of Symbiotic X. indica’s Bacteria and Their Biogenic Ag-Nps on Hatchability of M. incognita Egg
3.5. Quantitative Real-Time PCR
3.6. Effect on Human Normal Cell Proliferation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Elling, A.-A. Major emerging problems with minor Meloidogyne species. Phytopathology 2013, 103, 1092–1102. [Google Scholar] [CrossRef] [Scilit]
- Tapia-Vázquez, I.; Montoya-Martínez, A.C.; De Los Santos-Villalobos, S.; Ek-Ramos, M.J.; Montesinos-Matías, R.; Martínez-Anaya, C. Root-knot nematodes (Meloidogyne spp.) a threat to agriculture in Mexico: Biology, current control strategies, and perspectives. World J. Microbiol. Biotechnol. 2022, 38, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sasser, J.-N. Root-knot nematodes: A global menace to crop production. Plant Dis. 1980, 64, 36–41. [Google Scholar] [CrossRef] [Scilit]
- Sikora, R.-A.; Fernandez, E. Nematode parasites of vegetables. In Plant-Parasitic Nematodes in Subtropical and Tropical Countries; Luc, M., Sikora, R.A., Bridge, J., Eds.; CABI Publishing: Wallingford, UK, 2005; pp. 319–392. [Google Scholar]
- Topalovi, O.; Elhady, A.; Hallmann, J.; Richert-Pggeler, K.-R.; Heuer, H. Bacteria isolated from the cuticle of plant-parasitic nematodes attached to and antagonized the root-knot nematode Meloidogyne hapla. Sci. Rep. 2019, 9, 11477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abebew, D.; Sayedain, F.-S.; Bode, E.; Bode, B.-H. Uncovering Nematicidal Natural Products from Xenorhabdus Bacteria. J. Agric. Food Chem. 2022, 70, 498–506. [Google Scholar] [CrossRef] [Scilit]
- Thies, J.-A.; Ariss, J.-J.; Hassell, R.-L.; Olson, S.; Kousik, C.-S.; Lev, A. Grafting for management of southern root-knot nematodes, Meloidogyne incognita, in watermelon. Plant Dis. 2010, 94, 1195–1199. [Google Scholar] [CrossRef] [Scilit]
- Ferris, H. Dynamic action thresholds for diseases induced by nematodes. Annu. Rev. Phytopathol. 1981, 19, 427–436. [Google Scholar] [CrossRef] [Scilit]
- Barbary, A.; Djian-Caporalino, C.; Marteu, N.; Fazari, A.; Caromel, B.; Castagnone-Sereno, P.; Palloix, A. Plant genetic background increasing the efficiency and durability of major resistance genes to root-knot nematodes can be resolved into a few resistance QTLs. Front. Plant Sci. 2016, 7, 632. [Google Scholar] [CrossRef] [Scilit]
- Jones, J.; Haegeman, A.; Danchin, E.; Gaur, H.-S.; Helder, J.; Jones, M.-G.-K.; Kikuchi, T.; Manzanilla, L.; Rosa, H.; Palomares-Rius, J.; et al. Top 10 plant-parasitic nematodes in molecular plant pathology. Mol. Plant Pathol. 2013, 14, 946–961. [Google Scholar] [CrossRef] [Scilit]
- Ralmi, N.-H.-A.; Khandaker, M.-M.; Mat, N. Occurrence and control of root knot nematode in crops: A review. Aust. J. Crop Sci. 2016, 11, 1649–1654. [Google Scholar] [CrossRef] [Scilit]
- Verdejo-Lucas, S.; Talavera, M. Root-knot nematodes on zucchini (Cucurbita pepo subsp. Pepo): Pathogenicity and management. Crop Prot. 2019, 126, 104943. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Grabau, Z. Meloidogyne incognita Management using Fumigant and Non-fumigant Nematicides on Sweet Potato. J. Nematol. 2022, 54, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed] [PubMed Central]
- Chen, P.; Wang, Y.; Liu, Q.; Zhang, Y.; Li, X.; Li, H.; Li, W. Phase changes of continuous cropping obstacles in strawberry (Fragaria×ananassa Duch.) production. Appl. Soil Ecol. 2020, 155, 103626. [Google Scholar] [CrossRef] [Scilit]
- Oka, Y. From old-generation to next-generation nematicides. Agronomy 2020, 10, 1387. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, G.; Nishat, Y.; Ansari, M.; Khan, A.; Haris, M.; Khan, A. Eco-Friendly Approaches for the Alleviation of Root-Knot Nematodes. In Plant Growth-Promoting Microbes for Sustainable Biotic and Abiotic Stress Management; Springer International Publishing: Cham, Switzerland, 2021; pp. 557–575. [Google Scholar] [CrossRef] [Scilit]
- Rasmann, S.; Köllner, T.-G.; Degenhardt, J.; Hiltpold, I.; Toepfer, S.; Kuhlmann, U.; Gershenzon, J.; Turlings, T.-C.-J. Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 2005, 434, 732–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tonelli, M.; Peñaflor, M.-F.-G.-V.; Leite, L.-G. Attraction of entomopathogenic nematodes to sugarcane root volatiles under herbivory by a sap-sucking insect. Chemoecology 2006, 26, 59–66. [Google Scholar] [CrossRef] [Scilit]
- Divya, K.; Sankar, M. Entomopathogenic nematodes in pest management. Indian J. Sci. Technol. 2009, 2, 53–60. [Google Scholar] [CrossRef] [Scilit]
- Shapiro-Ilan, D.I.; Garrigos Leite, L.; Han, R. Production of entomopathogenic nematodes. In Mass Production of Beneficial Organisms: Invertebrates and Entomopathogens; Morales-Ramos, J., Rojas, G., Shapiro-Ilan, D.I., Eds.; Academic Press: San Diego, CA, USA, 2023; pp. 293–316. [Google Scholar]
- Zhang, Y.; Li, S.; Li, H.; Wang, R.; Zhang, K.; Xu, J. Fungi–Nematode Interactions: Diversity, Ecology, and Biocontrol Prospects in Agriculture. J. Fungi 2020, 6, 206. [Google Scholar] [CrossRef] [Scilit]
- Ehlers, R.-U. Mass production of entomopathogenic nematodes for plant protection. Appl. Microbiol. Biotechnol. 2001, 56, 623–633. [Google Scholar] [CrossRef] [Scilit]
- Rumbos, C.-I.; Athanassiou, C.-G. The use of entomopathogenic nematodes in the control of stored-product insects. J. Pest Sci. 2017, 90, 39–49. [Google Scholar] [CrossRef] [Scilit]
- Kaya, H.-K. Status of entomopathogenic nematodes and their symbiotic bacteria from selected countries of regions of the world. Biol. Control 2006, 38, 134–155. [Google Scholar] [CrossRef] [Scilit]
- Grewal, P.-S.; Wang, X.; Taylor, R.-A.-J. Dauer juvenile longevity and stress tolerance in natural populations of entomopathogenic nematodes: Is there a relationship? Int. J. Parasitol. 2002, 32, 717–725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malan, A.-P.; Manrakhan, A. Susceptibility of the Mediterranean fruit fly (Ceratitis capitata) and the Natal fruit fly (Ceratitis rosa) to entomopathogenic nematodes. J. Invertebr. Pathol. 2009, 100, 47–749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- James, M.; Malan, A.P.; Addison, P. Surveying and screening South African entomopathogenic nematodes for the control of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). Crop Prot. 2018, 105, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Benseddik, Y. Occurrence and distribution of entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) in Morocco. Biocontrol Sci. Technol. 2020, 30, 1060–1072. [Google Scholar] [CrossRef] [Scilit]
- Gazit, Y.; Rossler, Y.; Glazer, I. Evaluation of entomopathogenic nematodes for the control of Mediterranean fruit fly (Diptera: Tephritidae). Biocontrol Sci. Technol. 2000, 10, 157–164. [Google Scholar] [CrossRef] [Scilit]
- Mokrini, F.; Laasli, S.; Benseddik, Y.; Joutei, A.-B.; Blenzar, A.; Lakhal, H.; Sbaghi, M.; Imren, M.; Özer, G.; Paulitz, T.; et al. Potential of Moroccan entomopathogenic nematodes for the control of the Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae). Sci. Rep. 2020, 10, 19204. [Google Scholar] [CrossRef] [Scilit]
- Bal, H.-K.; Grewal, P.-S. Lateral dispersal and foraging behavior of entomopathogenic nematodes in the absence and presence of mobile and non-mobile hosts. PLoS ONE 2015, 10, e0129887. [Google Scholar] [CrossRef] [Scilit]
- Langford, E.-A.; Nielsen, U.-N.; Johnson, S.-N.; Riegler, M. Susceptibility of Queensland fruit fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae), to entomopathogenic nematodes. Biol. Control. 2014, 69, 34–39. [Google Scholar] [CrossRef] [Scilit]
- Karagoz, M.; Gulcu, B.; Hazir, C.; Kaya, H.-K.; Hazir, S. Biological control potential of Turkish entomopathogenic nematodes against the Mediterranean fruit fly Ceratitis capitata. Phytoparasitica 2009, 37, 153–159. [Google Scholar] [CrossRef] [Scilit]
- Aatif, H.-M. Assessment of the entomopathogenic nematodes against maggots and pupae of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), under laboratory conditions. Egypt. J. Biol. Pest Control. 2019, 29, 51. [Google Scholar] [CrossRef] [Scilit]
- Vyas, R.-V.; Patel, B.; Maghodia, A.; Patel, D.-J. Signifcance of metabolites of native Xenorhabdus, a bacterial symbiont of Steinernema, for suppression of collar rot and root knot diseases of groundnut. Indian J. Biotechnol. 2008, 7, 371–373. [Google Scholar]
- Caccia, M.; Marro, N.; Dueñas, J.-R.; Doucet, M.-E.; Lax, P. Effect of the entomopathogenic nematode-bacterial symbiont complex on Meloidogyne hapla and Nacobbus aberrans in short-term greenhouse trials. Crop Prot. 2018, 114, 162–166. [Google Scholar] [CrossRef] [Scilit]
- Hussey, R.-S.; Barker, K.-R. A comparison of methods of collecting inocula of Meloidogyne spp., including a new technique. Plant Dis. Report. 1973, 57, 1025–1028. [Google Scholar]
- Mahar, A.-N.; Munir, M.; Elawad, S.; Gowen, S.-R.; Meckenzi, H.-N.-G. Pathogenicity of bacterium, Xenorhabdus nematophila isolated from entomopathogenic nematode (Steinernema carpocapsae) and its secretion against Galleria mellonella larvae. J. Zhejiang Univ. Sci. B 2005, 6, 457. [Google Scholar] [CrossRef] [Scilit]
- Hamida, R.-S.; Abdelmeguid, N.-E.; Ali, M.-A.; Bin-Meferij, M.-M.; Khalil, M.-I. Synthesis of Silver Nanoparticles Using a Novel Cyanobacteria Desertifilum sp. extract: Their Antibacterial and Cytotoxicity Effects. Int. J. Nanomed. 2020, 15, 49–63. [Google Scholar] [CrossRef] [Scilit] [PubMed] [PubMed Central]
- Ferrer, C.; Colom, F.; Frasés, S.; Mulet, E.; Abad, J.-L.; Alió, J.-L. Detection and identification of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections. J. Clin. Microbiol. 2001, 39, 2873–2879. [Google Scholar] [CrossRef] [Scilit] [PubMed] [PubMed Central]
- Kumar, P.; Elsaidi, H.; Zorniak, B.; Laurens, E.; Yang, J.; Bacchu, V.; Wang, M.; Wiebe, L. Synthesis and Biological Evaluation of Iodoglucoazomycin (I-GAZ), an Azomycin-Glucose Adduct with Putative Applications in Diagnostic Imaging and Radiotherapy of Hypoxic Tumors. ChemMedChem 2016, 11, 1638–1645. [Google Scholar] [CrossRef] [Scilit]
- Abbott, W.-H. The Development and Performance Characteristics of Mixed Flowing Gas Test Environments. IEEE Trans. Compon. Hybrids Manuf. Technol. 1987, 11, 22–35. [Google Scholar]
- Huang, K.; Wu, S.; Peng, H.; Kong, A.; Liu, M.; Yin, Q.; Cui, Q.; Zhan, P.; Cui, K.; Peng, L. Mutations in Acetylcholinesterase2 (ace2) increase the insensitivity of acetylcholinesterase to fosthiazate in the root-knot nematode Meloidogyne incognita. Sci. Rep. 2016, 6, 38102. [Google Scholar] [CrossRef] [Scilit]
- Wram, C.; Hesse, C.; Zasada, I. Transcriptional response of Meloidogyne incognita to non- fumigant nematicides. Sci. Rep. 2022, 12, 9814. [Google Scholar] [CrossRef] [Scilit]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghareeb, R.-Y.; Abu-Serie, M.-M.; Alrawiq, H.-S.; Hamdy, A.; Kabeil, S.-A.; Zaki, S. Usage of Copper Nanoparticles as a Nematicidal Agent for Root-Knot Nematodes in Naturally Infested Open-Field Pepper. AMP Express 2025, 15, 166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abu-Serie, M.-M.; Gutiérrez-García, A.-K.; Enman, M.; Vaish, U.; Fatima, H.; Dudeja, V. Ferroptosis and stemness inhibition-mediated therapeutic potency of ferrous oxide nanoparticles-diethyldithiocarbamate using a co-spheroid 3D model of pancreatic cancer. J. Gastroenterol. 2025, 60, 641–657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steel, R.-G.-D.; Torrie, J.-H. Principles and Procedures of Statistics with Special Reference to the Biological Sciences; McGraw Hill: New York, NY, USA, 1960; pp. 187–287. [Google Scholar]
- Srivastava, S.; Chaubey, A.K. In vitro study on the nematicidal activity of entomopathogenic bacteria against the root-knot nematode Meloidogyne incognita. J. Appl. Nat. Sci. 2024, 16, 3181–3190. [Google Scholar] [CrossRef] [Scilit]
- Fanelli, E.; Vovlas, A.; D’Addabbo, T.; De Luca, F. Molecular mechanism of Cinnamomum zeylanicum and Citrus aurantium essential oils against the root-knot nematode, Meloidogyne incognita. Sci. Rep. 2025, 15, 6077. [Google Scholar] [CrossRef] [Scilit]
- Zhao, D.; Zhao, H.; Zhao, D.; Zhu, X.; Wang, Y.; Duan, Y.; Xuan, Y.; Chen, L. Isolation and Identification of Bacteria from Rhizosphere Soil and Their Effect on Plant Growth Promotion and Root-Knot Nematode Disease. Biol. Control 2018, 119, 12–19. [Google Scholar] [CrossRef] [Scilit]
- Kroemer, G.; Galluzzi, L.; Brenner, C. Mitochondrial membrane permeabilization in cell death. Physiol. Rev. 2007, 87, 99–163. [Google Scholar] [CrossRef] [Scilit]
- Furmanczyk, E.M.; Kozacki, D.; Hyk, W.; Muszyńska, M.; Sekrecka, M.; Skwiercz, A.T. In vitro study on the nematicidal effect of silver nanoparticles against Meloidogyne incognita. Molecules 2025, 30, 1132. [Google Scholar] [CrossRef] [Scilit]
- Sheets, J.; Aktories, K. Insecticidal Toxin Complexes from Photorhabdus luminescens. In The Molecular Biology of Photorhabdus Bacteria; Ffrench-Constant, R., Ed.; Current Topics in Microbiology and Immunology; Springer: Cham, Switzerland, 2016; Volume 402. [Google Scholar] [CrossRef] [Scilit]
- Bowen, D.; Blackburn, M.; Rocheleau, T.; Grutzmacher, C. Secreted proteases from Photorhabdus luminescens: Separation of the extracellular proteases from the insecticidal Tc toxin complexes. Insect Biochem. Mol. Biol. 2000, 30, 69–74. [Google Scholar] [CrossRef] [Scilit]
- Pathipati, U.-R.; Kanuparthi, P.-L. Silver nanoparticles for insect control: Bioassays and mechanisms. In Silver Nanomaterials for Agri-Food Applications; Elsevier: Amsterdam, The Netherlands, 2021; pp. 471–494. [Google Scholar]
- Seo, S.; Lee, S.; Hong, Y.; Kim, Y. Phospholipase A2 inhibitors synthesized by two entomopathogenic bacteria, Xenorhabdus nematophila and Photorhabdus temperata subsp. temperata. Appl. Environ. Microbiol. 2012, 78, 3816–3823. [Google Scholar] [CrossRef] [Scilit]
- Kamita, S.-G.; Hammock, B.-D. Juvenile hormone esterase: Biochemistry and structure. J. Pesti. Sci. 2010, 35, 265–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daborn, P.-J.; Waterfield, N.; Silva, C.-P.; Au, C.-P.; Sharma, S.; French-Constant, R.-H. A single Photorhabdus gene, makes caterpillars floppy (mcf), allows Escherichia coli to persist within and kill insects. Proc. Natl. Acad. Sci. USA 2002, 99, 10742–10747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adithya, S.; Shivaprakash, M.; Sowmya, E. Evaluation of insecticidal activity of entomopathogenic bacteria Photorhabdus and Xenorhabdus against shoot and fruit borer Earias vittella (Lepidoptera: Noctuidae) of vegetable crops. J. Èntomol. Zoöl. Stud. 2020, 8, 2343–2348. [Google Scholar] [CrossRef] [Scilit]
- Grewal, P.-S.; Lewis, E.-E.; Venkatachari, S. Allelopathy: A possible mechanism of suppression of plant-parasitic nematodes by entomopathogenic nematodes. Nematology 1999, 1, 735−743. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.-S.; Moon, Y.-S.; Lee, S.-H. Inhibition properties of three acetylcholinesterases of the pinewood nematode Bursaphelenchus xylophilus by organophosphates and carbamates. Pestic. Biochem. Physiol. 2012, 104, 157–162. [Google Scholar] [CrossRef] [Scilit]
- Hanan, A.; Rehab, Y.G.; Ahmed, M.E.; Marian, M. The Double Face Effect of Algae Extracts as Bio-Pesticides Against Fall Armyworm, Spodoptera Frugiperda, and Root-Knot Nematodes, Meloidogyne incognita. Int. J. Environ. Sci. 2025, 11, 2s. [Google Scholar]
- Selkirk, M.-E.; Lazari, O.; Matthews, J.-B. Functional genomics of nematode acetylcholinesterases. Parasitology 2005, 131, S3–S18. [Google Scholar] [CrossRef] [Scilit]
- Combes, D.; Fedon, Y.; Toutant, J.-P.; Arpagaus, M. Acetylcholinesterase genes in the nematode Caenorhabditis elegans. Int. Rev. Cytol. 2001, 209, 207–239. [Google Scholar]
- Costa, J.-C.; Lilley, C.-J.; Atkinson, H.-J.; Urwin, P.-E. Functional characterisation of a cyst nematode acetylcholinesterase gene using Caenorhabditis elegans as a heterologous system. Int. J. Parasitol. 2009, 39, 849–858. [Google Scholar] [CrossRef] [Scilit]
- Laffaire, J.; Jaubert, S.; Abad, P.; Rosso, M. Molecular cloning and life stage expression pattern of a new acetylcholinesterase gene from the plant-parasitic nematode Meloidogyne incognita. Nematology 2003, 5, 213–217. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.-S.; Lee, D.-W.; Choi, J.Y.; Je, Y.H.; Koh, Y.H.; Lee, S.H. Three acetylcholinesterases of the pinewood nematode, Bursaphelenchus xylophilus: Insights into distinct physiological functions. Mol. Biochem. Parasitol. 2011, 175, 154–161. [Google Scholar] [CrossRef] [Scilit]
- Johnson, G.; Moore, S.W. The peripheral anionic site of acetylcholinesterase: Structure, functions and potential role in rational drug design. Curr. Pharm. Des. 2006, 12, 217–222. [Google Scholar] [CrossRef] [Scilit]
- Elnady, A.; Sorour, N.-M.; Abbas, R.-N. Characterization, cytotoxicity, and genotoxicity properties of novel biomediated nanosized-silver by Egyptian Streptomyces roseolus for safe antimicrobial applications. World J. Micro. Biotech. 2022, 38, 47. [Google Scholar] [CrossRef] [Scilit]
- Fu, M.; Yang, Y.; Zhang, X.; Lei, B.; Chen, T.; Chen, Y. In vitro profiling of toxicity effects of different environmental factors on skin cells. Toxics 2024, 12, 108. [Google Scholar] [CrossRef] [Scilit]
- Ortega-Llamas, L.; Quiñones-Vico, M.I.; García-Valdivia, M.; Fernández-González, A.; Ubago-Rodríguez, A.; Sanabria-de la Torre, R.; Arias-Santiago, S. Cytotoxicity and Wound Closure Evaluation in Skin Cell Lines after Treatment with Common Antiseptics for Clinical Use. Cells 2022, 11, 1395. [Google Scholar] [CrossRef] [Scilit]
- Elje, E.; Camassa, L.M.A.; Shaposhnikov, S.; Anmarkrud, K.H.; Skare, Ø.; Nilsen, A.M.; Zienolddiny-Narui, S.; Rundén-Pran, E. Toward Standardization of a Lung New Approach Model for Toxicity Testing of Nanomaterials. Nanomaterials 2024, 14, 1888. [Google Scholar] [CrossRef] [Scilit]
- ISO 10993-5:2009; Biological Evaluation of Medical Devices—Part 5: Tests for In Vitro Cytotoxicity. International Organization for Standardization: Geneva, Switzerland, 2009.











| Primers | Primer Sequence 5′→3′ | Reference |
|---|---|---|
| Mi-AChE1-F | ATGATGGATTATTCAATAGAGGACAG | [43] |
| Mi-AChE1-R | CTATTTTATTCCACAAACATCATTATCACC | [44] |
| Mi-AChE2-F | GTGGATCCGTTGACGTTCTTA | [45] |
| Mi-AChE2-R | ACGTCTAACCAAATGAGCAATAAC | [46] |
| q-Actin-F | GGGTATGGAATCTGCTGGTAT | [45] |
| q-Actin-R | AGAAAGGACAGTGTTGGCGTA | [45] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ghareeb, R.Y.; Eid, S.M.; Alfy, H.; Elsheikh, M.H. Repercussions of Symbiotic Bacteria Associated with Entomopathogenic Nematodes and Their Biogenic Silver Nanoparticles on Immune Responses at Root-Knot Nematode Suppression. Microorganisms 2026, 14, 92. https://doi.org/10.3390/microorganisms14010092
Ghareeb RY, Eid SM, Alfy H, Elsheikh MH. Repercussions of Symbiotic Bacteria Associated with Entomopathogenic Nematodes and Their Biogenic Silver Nanoparticles on Immune Responses at Root-Knot Nematode Suppression. Microorganisms. 2026; 14(1):92. https://doi.org/10.3390/microorganisms14010092
Chicago/Turabian StyleGhareeb, Rehab Y., Shawky M. Eid, Hanan Alfy, and Mohamed H. Elsheikh. 2026. "Repercussions of Symbiotic Bacteria Associated with Entomopathogenic Nematodes and Their Biogenic Silver Nanoparticles on Immune Responses at Root-Knot Nematode Suppression" Microorganisms 14, no. 1: 92. https://doi.org/10.3390/microorganisms14010092
APA StyleGhareeb, R. Y., Eid, S. M., Alfy, H., & Elsheikh, M. H. (2026). Repercussions of Symbiotic Bacteria Associated with Entomopathogenic Nematodes and Their Biogenic Silver Nanoparticles on Immune Responses at Root-Knot Nematode Suppression. Microorganisms, 14(1), 92. https://doi.org/10.3390/microorganisms14010092

