The PP2A Catalytic Subunit PPH21 Regulates Biofilm Formation and Drug Resistance of Candida albicans
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Growth Conditions
2.2. Planktonic Cells Growth
2.3. Biofilm Formation
2.4. XTT Reduction Assay
2.5. Crystal Violet (CV) Staining
2.6. Scanning Electronic Microscopy (SEM)
2.7. Antifungal Susceptibility Analysis
2.8. Reactive Oxygen Species (ROS)
2.9. Mitochondrial Membrane Potential (MMP)
2.10. Alkaline Phosphatase (ALP) Activity
2.11. Transmission Electron Microscopy (TEM)
2.12. RT-qPCR
2.13. Western Blotting
2.14. Construction of Murine Oral Candidiasis Model
2.15. Statistical Analysis
3. Results
3.1. PPH21 Deletion Led to Increased Oxidative Stress in C. albicans Biofilm
3.2. PPH21 Deletion Induced Increased Autophagic Activity in C. albicans Biofilm
3.3. The Increased Oxidative Stress and Autophagic Activity of pph21Δ/Δ Biofilm Was Reversed by ROS Inhibitor (NAC)
3.4. PPH21 Deletion Reduced the Biofilm Formation Ability of C. albicans
3.5. PPH21 Deletion Showed Increased Susceptibility to Antifungal Agents
3.6. PPH21 Deletion Presented Weakened Pathogenicity of C. albicans and Reduced the Oral Infection of Murine Tongues
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sparber, F.; LeibundGut-Landmann, S. Interleukin 17-Mediated Host Defense against Candida albicans. Pathogens 2015, 4, 606–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wall, G.; Montelongo-Jauregui, D.; Vidal Bonifacio, B.; Lopez-Ribot, J.L.; Uppuluri, P. Candida albicans biofilm growth and dispersal: Contributions to pathogenesis. Curr. Opin. Microbiol. 2019, 52, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pereira, R.; Dos Santos Fontenelle, R.O.; de Brito, E.H.S.; de Morais, S.M. Biofilm of Candida albicans: Formation, regulation and resistance. J. Appl. Microbiol. 2021, 131, 11–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ponde, N.O.; Lortal, L.; Ramage, G.; Naglik, J.R.; Richardson, J.P. Candida albicans biofilms and polymicrobial interactions. Crit. Rev. Microbiol. 2021, 47, 91–111. [Google Scholar] [CrossRef] [Scilit]
- Kaur, J.; Nobile, C.J. Antifungal drug-resistance mechanisms in Candida biofilms. Curr. Opin. Microbiol. 2023, 71, 102237. [Google Scholar] [CrossRef] [Scilit]
- Cowen, L.E. The evolution of fungal drug resistance: Modulating the trajectory from genotype to phenotype. Nat. Rev. Microbiol. 2008, 6, 187–198. [Google Scholar] [CrossRef] [Scilit]
- Hale, A.N.; Ledbetter, D.J.; Gawriluk, T.R.; Rucker, E.B., 3rd. Autophagy: Regulation and role in development. Autophagy 2013, 9, 951–972. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Jin, R.; Dobry, C.J.; Lawson, S.K.; Kumar, A. Overexpression of autophagy-related genes inhibits yeast filamentous growth. Autophagy 2007, 3, 604–609. [Google Scholar] [CrossRef] [Scilit]
- Bartoszewska, M.; Kiel, J.A. The role of macroautophagy in development of filamentous fungi. Antioxid. Redox Signal. 2011, 14, 2271–2287. [Google Scholar] [CrossRef] [Scilit]
- Pallichankandy, S.; Rahman, A.; Thayyullathil, F.; Galadari, S. ROS-dependent activation of autophagy is a critical mechanism for the induction of anti-glioma effect of sanguinarine. Free Radic. Biol. Med. 2015, 89, 708–720. [Google Scholar] [CrossRef] [Scilit]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef] [Scilit]
- Shekhova, E.; Kniemeyer, O.; Brakhage, A.A. Induction of Mitochondrial Reactive Oxygen Species Production by Itraconazole, Terbinafine, and Amphotericin B as a Mode of Action against Aspergillus fumigatus. Antimicrob. Agents Chemother. 2017, 61, e00978-17. [Google Scholar] [CrossRef] [Scilit]
- Roy, S.; Batra, L. Protein Phosphatase 2A: Role in T Cells and Diseases. J. Immunol. Res. 2023, 2023, 4522053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Q.; Pan, C.; Wang, Y.; Wang, N.; Wang, Y.; Sang, J. The PP2A regulatory subunits, Cdc55 and Rts1, play distinct roles in Candida albicans’ growth, morphogenesis, and virulence. Fungal Genet. Biol. 2019, 131, 103240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y. Regulation of the cell cycle by protein phosphatase 2A in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 2006, 70, 440–449. [Google Scholar] [CrossRef] [Scilit]
- Xu, Q.R.; Yan, L.; Lv, Q.Z.; Zhou, M.; Sui, X.; Cao, Y.B.; Jiang, Y.Y. Molecular genetic techniques for gene manipulation in Candida albicans. Virulence 2014, 5, 507–520. [Google Scholar] [CrossRef] [Scilit]
- Noble, S.M.; Johnson, A.D. Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot. Cell 2005, 4, 298–309. [Google Scholar] [CrossRef] [Scilit]
- Woolford, C.A.; Lagree, K.; Xu, W.; Aleynikov, T.; Adhikari, H.; Sanchez, H.; Cullen, P.J.; Lanni, F.; Andes, D.R.; Mitchell, A.P. Bypass of Candida albicans Filamentation/Biofilm Regulators through Diminished Expression of Protein Kinase Cak1. PLoS Genet. 2016, 12, e1006487. [Google Scholar] [CrossRef] [Scilit]
- Lee, W.; Lee, D.G. Reactive oxygen species modulate itraconazole-induced apoptosis via mitochondrial disruption in Candida albicans. Free Radic. Res. 2018, 52, 39–50. [Google Scholar] [CrossRef] [Scilit]
- Ramage, G.; Vande Walle, K.; Wickes, B.L.; López-Ribot, J.L. Standardized method for in vitro antifungal susceptibility testing of Candida albicans biofilms. Antimicrob. Agents Chemother. 2001, 45, 2475–2479. [Google Scholar] [CrossRef] [Scilit]
- Doll, K.; Jongsthaphongpun, K.L.; Stumpp, N.S.; Winkel, A.; Stiesch, M. Quantifying implant-associated biofilms: Comparison of microscopic, microbiologic and biochemical methods. J. Microbiol. Methods 2016, 130, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Mao, M.Y.; Li, M.; Lei, L.; Yin, J.X.; Yang, Y.M.; Hu, T. The Regulator Gene rnc Is Closely Involved in Biofilm Formation in Streptococcus mutans. Caries Res. 2018, 52, 347–358. [Google Scholar] [CrossRef] [Scilit]
- Kuhn, D.M.; George, T.; Chandra, J.; Mukherjee, P.K.; Ghannoum, M.A. Antifungal susceptibility of Candida biofilms: Unique efficacy of amphotericin B lipid formulations and echinocandins. Antimicrob. Agents Chemother. 2002, 46, 1773–1780. [Google Scholar] [CrossRef] [Scilit]
- Canonico, B.; Candiracci, M.; Citterio, B.; Curci, R.; Squarzoni, S.; Mazzoni, A.; Papa, S.; Piatti, E. Honey flavonoids inhibit Candida albicans morphogenesis by affecting DNA behavior and mitochondrial function. Future Microbiol. 2014, 9, 445–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salvioli, S.; Ardizzoni, A.; Franceschi, C.; Cossarizza, A. JC-1, but not DiOC6(3) or rhodamine 123, is a reliable fluorescent probe to assess delta psi changes in intact cells: Implications for studies on mitochondrial functionality during apoptosis. FEBS Lett. 1997, 411, 77–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chazotte, B. Labeling Mitochondria with JC-1; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2011; Volume 2011. [Google Scholar] [CrossRef] [Scilit]
- Nothwehr, S.F.; Bryant, N.J.; Stevens, T.H. The newly identified yeast GRD genes are required for retention of late-Golgi membrane proteins. Mol. Cell. Biol. 1996, 16, 2700–2707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, S.D.; Robbins, N.; Zaas, A.K.; Schell, W.A.; Perfect, J.R.; Cowen, L.E. Hsp90 governs echinocandin resistance in the pathogenic yeast Candida albicans via calcineurin. PLoS Pathog. 2009, 5, e1000532. [Google Scholar] [CrossRef] [Scilit]
- Takakura, N.; Sato, Y.; Ishibashi, H.; Oshima, H.; Uchida, K.; Yamaguchi, H.; Abe, S. A novel murine model of oral candidiasis with local symptoms characteristic of oral thrush. Microbiol. Immunol. 2003, 47, 321–326. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Xu, Z.; Liu, S.; Huang, R.; Duan, W.; Wei, X. In vivo antifungal activities of farnesol combined with antifungal drugs against murine oral mucosal candidiasis. Biofouling 2021, 37, 818–829. [Google Scholar] [CrossRef] [Scilit]
- Nakatogawa, H.; Suzuki, K.; Kamada, Y.; Ohsumi, Y. Dynamics and diversity in autophagy mechanisms: Lessons from yeast. Nat. Rev. Mol. Cell Biol. 2009, 10, 458–467. [Google Scholar] [CrossRef] [Scilit]
- Ohsumi, Y. Historical landmarks of autophagy research. Cell Res. 2014, 24, 9–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Jiang, L.; Miao, H.; Lv, Y.; Zhang, Q.; Ma, M.; Duan, W.; Huang, Y.; Wei, X. Autophagy regulation of ATG13 and ATG27 on biofilm formation and antifungal resistance in Candida albicans. Biofouling 2022, 38, 926–939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Z.; Thompson, A.; Sobue, T.; Kashleva, H.; Xu, H.; Vasilakos, J.; Dongari-Bagtzoglou, A. Candida albicans biofilms do not trigger reactive oxygen species and evade neutrophil killing. J. Infect. Dis. 2012, 206, 1936–1945. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andreyev, A.Y.; Kushnareva, Y.E.; Murphy, A.N.; Starkov, A.A. Mitochondrial ROS Metabolism: 10 Years Later. Biochemistry 2015, 80, 517–531. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Tan, J.; Miao, Y.; Lei, P.; Zhang, Q. ROS and Autophagy: Interactions and Molecular Regulatory Mechanisms. Cell. Mol. Neurobiol. 2015, 35, 615–621. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.; Puumala, E.; Robbins, N.; Cowen, L.E. Antifungal Drug Resistance: Molecular Mechanisms in Candida albicans and Beyond. Chem. Rev. 2021, 121, 3390–3411. [Google Scholar] [CrossRef] [Scilit]
- Yin, H.; Xu, L.; Porter, N.A. Free radical lipid peroxidation: Mechanisms and analysis. Chem. Rev. 2011, 111, 5944–5972. [Google Scholar] [CrossRef] [Scilit]
- Circu, M.L.; Aw, T.Y. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 2010, 48, 749–762. [Google Scholar] [CrossRef] [Scilit]
- Davies, D.G.; Parsek, M.R.; Pearson, J.P.; Iglewski, B.H.; Costerton, J.W.; Greenberg, E.P. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 1998, 280, 295–298. [Google Scholar] [CrossRef] [Scilit]
- Shapiro, R.S.; Uppuluri, P.; Zaas, A.K.; Collins, C.; Senn, H.; Perfect, J.R.; Heitman, J.; Cowen, L.E. Hsp90 orchestrates temperature-dependent Candida albicans morphogenesis via Ras1-PKA signaling. Curr. Biol. 2009, 19, 621–629. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wang, C.; Mei, H.; Shen, Y.; Lv, G.; Zeng, R.; Zhan, P.; Li, D.; Liu, W. Combination of Estrogen and Immunosuppressive Agents to Establish a Mouse Model of Candidiasis with Concurrent Oral and Vaginal Mucosal Infection. Mycopathologia 2016, 181, 29–39. [Google Scholar] [CrossRef] [Scilit]








| Genotype | Reference | |
|---|---|---|
| C. albicans strains | ||
| SN152 | arg4/arg4 leu2/leu2 his1/his1 URA3/ura3::imm434 IRO1/iro1::imm434 | [17] |
| pph21Δ/Δ | arg4/arg4 leu2/leu2 his1/his1 URA3/ura3::imm434 IRO1/iro1::imm434 PPH21::C.d.LEU2/pph21::C.d.HIS1 | this study |
| Plasmids | ||
| pSN52 | With HIS1 marker | [17] |
| pSN40 | With LEU2 marker | [17] |
| Primer Name | Sequence (5′→3′) |
|---|---|
| ATG1-F | TACAACCCAACTGAGCGGAT |
| ATG1-R | GTAGTGGGTGATGGGCTTCT |
| ATG13-F | GCCAAGACTACGGGGTATGA |
| ATG13-R | AAGCATTGGAATTGCGTCGA |
| ATG17-F | TTCAACGCCTTCCAGCAA |
| ATG17-R | TGGTTTGATCTCTGGCATTGA |
| ATG27-F | ACTCCAACAGCTATCTCGCA |
| ATG27-R | TATAACGTCGCCAACCCT |
| β-actin-F | GACCAAGAAGACATCAAGGTATCAT |
| β-actin-R | GTGTTCAATTGGGTATCTCAAG |
| Strains | SMIC50 of Antifungal Agents (µg/mL) | |||
|---|---|---|---|---|
| 6 h | 12 h | 24 h | 48 h | |
| fluconazole | ||||
| SN152 | 512 | 1024 | 1024 | 1024 |
| pph21Δ/Δ | 256 | 512 | 512 | 1024 |
| itraconazole | ||||
| SN152 | 512 | 512 | 1024 | 1024 |
| pph21Δ/Δ | 256 | 512 | 512 | 512 |
| amphotericin B | ||||
| SN152 | 2 | 2 | 4 | 8 |
| pph21Δ/Δ | 2 | 2 | 4 | 4 |
| caspofungin | ||||
| SN152 | 16 | 32 | 64 | 64 |
| pph21Δ/Δ | 16 | 16 | 32 | 64 |
| terbinafine | ||||
| SN152 | 256 | 512 | 1024 | 1024 |
| pph21Δ/Δ | 256 | 256 | 512 | 1024 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, J.; Li, Y.; Miao, H. The PP2A Catalytic Subunit PPH21 Regulates Biofilm Formation and Drug Resistance of Candida albicans. Microorganisms 2025, 13, 2093. https://doi.org/10.3390/microorganisms13092093
Shen J, Li Y, Miao H. The PP2A Catalytic Subunit PPH21 Regulates Biofilm Formation and Drug Resistance of Candida albicans. Microorganisms. 2025; 13(9):2093. https://doi.org/10.3390/microorganisms13092093
Chicago/Turabian StyleShen, Jiadi, Yuzhi Li, and Haochen Miao. 2025. "The PP2A Catalytic Subunit PPH21 Regulates Biofilm Formation and Drug Resistance of Candida albicans" Microorganisms 13, no. 9: 2093. https://doi.org/10.3390/microorganisms13092093
APA StyleShen, J., Li, Y., & Miao, H. (2025). The PP2A Catalytic Subunit PPH21 Regulates Biofilm Formation and Drug Resistance of Candida albicans. Microorganisms, 13(9), 2093. https://doi.org/10.3390/microorganisms13092093

