Acute Oak Decline-Associated Bacteria: An Emerging Worldwide Threat to Forests
Abstract
1. Introduction
2. Role of Bacteria in AOD
3. Role of Other Biotic and Abiotic Factors in AOD Predisposition
4. Spatial Distribution of the Main Hosts and Bacteria
5. Role of Agrilus Biguttatus in AOD
6. Diagnostic Tools for AOD-Associated Bacteria
7. AOD Management Strategies
8. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AOD | Acute oak decline |
| PCR | Polymerase chain reaction |
| HRM | High-resolution melting analysis |
| EPPO | European and Mediterranean Plant Protection Organization |
| VOCs | Volatile organic compounds |
References
- Mölder, A.; Meyer, P.; Nagel, R.V. Integrative Management to Sustain Biodiversity and Ecological Continuity in Central European Temperate Oak (Quercus robur, Q. petraea) Forests: An Overview. For. Ecol. Manag. 2019, 437, 324–339. [Google Scholar] [CrossRef] [Scilit]
- Doonan, J.M.; Broberg, M.; Denman, S.; McDonald, J.E. Host-Microbiota-Insect Interactions Drive Emergent Virulence in a Complex Tree Disease. Proc. R. Soc. B Biol. Sci. 2020, 287, 20200956. [Google Scholar] [CrossRef] [Scilit]
- Mcmanus, M.L.; Liebhold, A.M.; Führer, E. Proceedings: Population Dynamics, Impacts, and Integrated Management of Forest Defoliating Insects; McManus, M.L., Liebhold, A.M., Eds.; US Department of Agriculture, Forest Service, Northeastern Research Station: Radnor, PA, USA, 1998; pp. 222–229. [Google Scholar]
- Gentilesca, T.; Camarero, J.J.; Colangelo, M.; Nolè, A.; Ripullone, F. Drought-Induced Oak Decline in the Western Mediterranean Region: An Overview on Current Evidences, Mechanisms and Management Options to Improve Forest Resilience. iForest 2017, 10, 796–806. [Google Scholar] [CrossRef] [Scilit]
- Nakajima, H.; Ishida, M. Decline of Quercus crispula in Abandoned Coppice Forests Caused by Secondary Succession and Japanese Oak Wilt Disease: Stand Dynamics over Twenty Years. For. Ecol. Manag. 2014, 334, 18–27. [Google Scholar] [CrossRef] [Scilit]
- Elliott, K.J.; Swank, W.T. Impacts of Drought on Tree Mortality and Growth in a Mixed Hardwood Forest. J. Veg. Sci. 1994, 5, 229–236. [Google Scholar] [CrossRef] [Scilit]
- Ragazzi, A.; Vagniluca, S.; Moricca, S. European Expansion of Oak Decline: Involved Microorganisms and Methodological Approaches. Phytopathol. Mediterr. 1995, 34, 207–226. [Google Scholar]
- Kowsari, M.; Karimi, E. A review on oak decline: The global situation, causative factors, and new research approaches. For. Syst. 2023, 32, 3. [Google Scholar] [CrossRef] [Scilit]
- Macháčová, M.; Nakládal, O.; Samek, M.; Baťa, D.; Zumr, V.; Pešková, V. Oak Decline Caused by Biotic and Abiotic Factors in Central Europe: A Case Study from the Czech Republic. Forests 2022, 13, 1223. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.; Kirk, S.; Webber, J. Managing Acute Oak Decline; Forestry Commission: Farnham, UK, 2010; pp. 1–6. [Google Scholar]
- Barnes, C. Remote of Sensing Larch Disease and Acute Oak Decline in Britain. Ph.D. Thesis, University of Leicester, Leicester, UK, 2018. [Google Scholar]
- Celma, L.; Zaļkalns, O.; Šmits, A.; Legzdiņa, L.; Silbauma, L.; Ozols, J.; Kļaviņa, D.; Bokuma, G.; Ruņģis, D. Assessment of Acute Oak Decline in Latvia. Balt. For. 2024, 30, 745. [Google Scholar] [CrossRef] [Scilit]
- Sapp, M.; Lewis, E.; Moss, S.; Barrett, B.; Kirk, S.; Elphinstone, J.G.; Denman, S. Metabarcoding of Bacteria Associated with the Acute Oak Decline Syndrome in England. Forests 2016, 7, 95. [Google Scholar] [CrossRef] [Scilit]
- Carluccio, G.; Vergine, M.; Vita, F.; Sabella, E.; Delle Donne, A.; De Bellis, L.; Luvisi, A. Long-Distance Finding of AOD-Related Bacteria in the Natural Environment: Risks to Quercus ilex (L.) in Italy. Forests 2024, 15, 2055. [Google Scholar] [CrossRef] [Scilit]
- Barsoum, N.; A’Hara, S.W.; Cottrell, J.E.; Forster, J.; Garcia, M.S.J.; Schonrogge, K.; Shaw, L. Root Ectomycorrhizal Status of Oak Trees Symptomatic and Asymptomatic for Acute Oak Decline in Southern Britain. For. Ecol. Manag. 2021, 482, 118800. [Google Scholar] [CrossRef] [Scilit]
- Eichenlaub, L.; Denman, S.; Brady, C.; Maddock, D.; Robledo-Garcia, F.; Aubert, A.; Husson, C.; Robin, C. First Report of Brenneria goodwinii, Gibbsiella quercinecans and Rahnella victoriana in Declining Oaks in France. New Dis. Rep. 2024, 49, 2023–2024. [Google Scholar] [CrossRef] [Scilit]
- Gathercole, L.A.P.; Nocchi, G.; Brown, N.; Coker, T.L.R.; Plumb, W.J.; Stocks, J.J.; Nichols, R.A.; Denman, S.; Buggs, R.J.A. Evidence for the Widespread Occurrence of Bacteria Implicated in Acute Oak Decline from Incidental Genetic Sampling. Forests 2021, 12, 1683. [Google Scholar] [CrossRef] [Scilit]
- Bonham, E. Pathways of Two Bacteria Associated with Acute Oak Decline Brenneria Goodwinii and Gibsiella Quercinecans. Ph.D.Thesis, Harper Adams University, Newport, UK, 2021. [Google Scholar]
- Araeinejhad, M.H.; Falahi Chrakhabi, N.; Rahimian, H.; Brady, C. Association of Dryocola boscaweniae, Gibbsiella greigii and Gibbsiella quercinecans with Oak Decline in Iran. Eur. J. For. Res. 2024, 143, 803–811. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.; Brady, C.; Kirk, S.; Cleenwerck, I.; Venter, S.; Coutinho, T.; De Vos, P. Brenneria goodwinii Sp. Nov., Associated with Acute Oak Decline in the UK. Int. J. Syst. Evol. Microbiol. 2012, 62, 2451–2456. [Google Scholar] [CrossRef] [Scilit]
- Brown, N.; Vanguelova, E.; Parnell, S.; Broadmeadow, S.; Denman, S. Predisposition of Forests to Biotic Disturbance: Predicting the Distribution of Acute Oak Decline Using Environmental Factors. For. Ecol. Manag. 2018, 407, 145–154. [Google Scholar] [CrossRef] [Scilit]
- Brady, C.; Arnold, D.; McDonald, J.; Denman, S. Taxonomy and Identification of Bacteria Associated with Acute Oak Decline. World J. Microbiol. Biotechnol. 2017, 33, 143. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.; Doonan, J.; Ransom-Jones, E.; Broberg, M.; Plummer, S.; Kirk, S.; Scarlett, K.; Griffiths, A.R.; Kaczmarek, M.; Forster, J.; et al. Microbiome and Infectivity Studies Reveal Complex Polyspecies Tree Disease in Acute Oak Decline. ISME J. 2018, 12, 386–399. [Google Scholar] [CrossRef] [Scilit]
- Brady, C.; Orsi, M.; Doonan, J.M.; Denman, S.; Arnold, D. Brenneria goodwinii Growth in Vitro Is Improved by Competitive Interactions with Other Bacterial Species Associated with Acute Oak Decline. Curr. Res. Microb. Sci. 2022, 3, 100102. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Fang, W.; Xue, H.; Liang, W.X.; Wang, L.F.; Tian, G.Z.; Wang, X.Z.; Lin, C.L.; Li, X.; Piao, C.G. Brenneria populi sp. Nov., Isolated from Symptomatic Bark of Populus X Euramericana Canker. Int. J. Syst. Evol. Microbiol. 2015, 65, 432–437. [Google Scholar] [CrossRef] [Scilit]
- Crampton, B.G.; Plummer, S.J.; Kaczmarek, M.; McDonald, J.E.; Denman, S. A Multiplex Real-Time PCR Assay Enables Simultaneous Rapid Detection and Quantification of Bacteria Associated with Acute Oak Decline. Plant Pathol. 2020, 69, 1301–1310. [Google Scholar] [CrossRef] [Scilit]
- Brady, C.; Denman, S.; Kirk, S.; Venter, S.; Rodríguez-Palenzuela, P.; Coutinho, T. Description of Gibbsiella quercinecans Gen. Nov., Sp. Nov., Associated with Acute Oak Decline. Syst. Appl. Microbiol. 2010, 33, 444–450. [Google Scholar] [CrossRef] [Scilit]
- Bakhshi ganje, M.; Shams-Bakhsh, M.; Mackay, J.; Rahimian, H. Identification and Characterization of Bacterial Strains Associated with Diseased Oak Trees in Northern Iran. For. Pathol. 2020, 50, 12571. [Google Scholar] [CrossRef] [Scilit]
- Basavand, E.; Khodaygan, P.; Doonan, J.M.; Rahimian, H. Gibbsiella Quercinecans as New Pathogen Involved in Bacterial Canker of Russian Olive. 3 Biotech 2021, 11, 286. [Google Scholar] [CrossRef] [Scilit]
- Araeinejhad, M.H.; Charkhabi, N.F.; Brady, C.; Rahimian, H. Reliable and Specific Detection and Identification of Brenneria goodwinii, the Causal Agent of Oak and Oriental Beech Decline. Front. For. Glob. Change 2024, 7, 1325897. [Google Scholar] [CrossRef] [Scilit]
- Broberg, M.; Doonan, J.; Mundt, F.; Denman, S.; McDonald, J.E. Integrated Multi-Omic Analysis of Hostmicrobiota Interactions in Acute Oak Decline. Microbiome 2018, 6, 21. [Google Scholar] [CrossRef] [Scilit]
- Doonan, J.; Denman, S.; Pachebat, J.A.; McDonald, J.E. Genomic Analysis of Bacteria in the Acute Oak Decline Pathobiome. Microb. Genom. 2019, 5. [Google Scholar] [CrossRef] [Scilit]
- Pettifor, B.J.; Doonan, J.; Denman, S.; McDonald, J.E. Survival of Brenneria goodwinii and Gibbsiella quercinecans, Associated with Acute Oak Decline, in Rainwater and Forest Soil. Syst. Appl. Microbiol. 2020, 43, 126052. [Google Scholar] [CrossRef] [Scilit]
- Tkaczyk, M.; Sikora, K. The Role of Bacteria in Acute Oak Decline in South-West Poland. Microorganisms 2024, 12, 993. [Google Scholar] [CrossRef] [Scilit]
- Reed, K.; Denman, S.; Leather, S.R.; Forster, J.; Inward, D.J.G. The Lifecycle of Agrilus biguttatus: The Role of Temperature in Its Development and Distribution, and Implications for Acute Oak Decline. Agric. For. Entomol. 2018, 20, 334–346. [Google Scholar] [CrossRef] [Scilit]
- Colangelo, M.; Camarero, J.J.; Borghetti, M.; Gentilesca, T.; Oliva, J.; Redondo, M.A.; Ripullone, F. Drought and Phytophthora are Associated with the Decline of Oak Species in Southern Italy. Front. Plant Sci. 2018, 871, 1595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jönsson, U. A Conceptual Model for the Development of Phytophthora Disease in Quercus Robur. New Phytol. 2006, 171, 55–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serrano, M.S.; Romero, M.Á.; Homet, P.; Gómez-Aparicio, L. Climate Change Impact on the Population Dynamics of Exotic Pathogens: The Case of the Worldwide Pathogen Phytophthora cinnamomi. Agric. For. Meteorol. 2022, 322, 109002. [Google Scholar] [CrossRef] [Scilit]
- Gosling, R.H.; Jackson, R.W.; Elliot, M.; Nichols, C.P. Oak Declines: Reviewing the Evidence for Causes, Management Implications and Research Gaps. Ecol. Solut. Evid. 2024, 5, 12395. [Google Scholar] [CrossRef] [Scilit]
- Bashiri, S.; Abdollahzadeh, J. Taxonomy and Pathogenicity of Fungi Associated with Oak Decline in Northern and Central Zagros Forests of Iran with Emphasis on Coelomycetous Species. Front. Plant Sci. 2024, 15, 1377441. [Google Scholar] [CrossRef] [Scilit]
- Moradi-Amirabad, Y.; Rahimian, H.; Babaeizad, V.; Denman, S. Brenneria Spp. and Rahnella victoriana Associated with Acute Oak Decline Symptoms on Oak and Hornbeam in Iran. For. Pathol. 2019, 49, 12535. [Google Scholar] [CrossRef] [Scilit]
- Wargo, P.M. Consequences of Environmental Stress on Oak: Predisposition to Pathogens. Ann. Des Sci. For. 1996, 53, 359–368. [Google Scholar] [CrossRef] [Scilit]
- Thomas, F.M.; Blank, R.; Hartmann, G. Abiotic and Biotic Factors and Their Interactions as Causes of Oak Decline in Central Europe. For. Pathol. 2002, 32, 277–307. [Google Scholar] [CrossRef] [Scilit]
- Losseau, J.; Jonard, M.; Vincke, C. Pedunculate Oak Decline in Southern Belgium: A Long-Term Process Highlighting the Complex Interplay among Drought, Winter Frost, Biotic Attacks, and Masting. Can. J. For. Res. 2020, 50, 380–389. [Google Scholar] [CrossRef] [Scilit]
- Prado, I.; Gauli, A.; Kohl, M. Influence of climate on the growth of oaks in forest and urban sites: A dendro climatological analysis. SSRN 2022, 24, 5–7. [Google Scholar]
- Petritan, A.M.; Petritan, I.C.; Hevia, A.; Walentowski, H.; Bouriaud, O.; Sánchez-Salguero, R. Climate Warming Predispose Sessile Oak Forests to Drought-Induced Tree Mortality Regardless of Management Legacies. For. Ecol. Manag. 2021, 491, 119097. [Google Scholar] [CrossRef] [Scilit]
- Sohar, K.; Helama, S.; Läänelaid, A.; Raisio, J.; Tuomenvirta, H. Oak Decline in a Southern Finnish Forest as Affected by a Drought Sequence. Geochronometria 2014, 41, 92–103. [Google Scholar] [CrossRef] [Scilit]
- Oliva, J.; Stenlid, J.; Martínez-Vilalta, J. The Effect of Fungal Pathogens on the Water and Carbon Economy of Trees: Implications for Drought-Induced Mortality. New Phytol. 2014, 203, 1028–1035. [Google Scholar] [CrossRef] [Scilit]
- Haavik, L.J.; Billings, S.A.; Guldin, J.M.; Stephen, F.M. Emergent Insects, Pathogens and Drought Shape Changing Patterns in Oak Decline in North America and Europe. For. Ecol. Manag. 2015, 354, 190–205. [Google Scholar] [CrossRef] [Scilit]
- Camarero, J.J.; Colangelo, M.; Gazol, A.; Azorín-Molina, C. Drought and Cold Spells Trigger Dieback of Temperate Oak and Beech Forests in Northern Spain. Dendrochronologia 2021, 66, 125812. [Google Scholar] [CrossRef] [Scilit]
- Ahmadi, E.; Kowsari, M.; Azadfar, D.; Jouzani, G.S. Cultivable Bacteriome Dynamics in Different Persian Oak Tissues and Soil during Oak Decline Syndrome Development in Iran. Authorea 2020, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.; Plummer, S.; Kirk, S.; Peace, A.; McDonald, J.E. Isolation Studies Reveal a Shift in the Cultivable Microbiome of Oak Affected with Acute Oak Decline. Syst. Appl. Microbiol. 2016, 39, 484–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kostić, S.; Kesić, L.; Matović, B.; Orlović, S.; Stojnić, S.; Stojanović, D.B. Soil Properties Are Significant Modifiers of Pedunculate Oak (Quercus robur L.) Radial Increment Variations and Their Sensitivity to Drought. Dendrochronologia 2021, 67, 125838. [Google Scholar] [CrossRef] [Scilit]
- Gaertig, T.; Schack-Kirchner, H.; Hildebrand, E.E.; Wilpert, K.V. The Impact of Soil Aeration on Oak Decline in Southwestern Germany. For. Ecol. Manag. 2002, 159, 15–25. [Google Scholar] [CrossRef] [Scilit]
- Quine, C.P.; Atkinson, N.; Denman, S.; Desprez-Loustau, M.-L.; Jackson, R.; Kirby, K. Action Oak Knowledge Review: An Assessment of the Current Evidence on Oak Health in the UK, Identification of Evidence Gaps and Prioritization of Research Needs; Action Oak: Haslemere, UK, 2019; ISBN 9781527241930. [Google Scholar]
- Gagen, M.; Matthews, N.; Denman, S.; Bridge, M.; Peace, A.; Pike, R.; Young, G. The Tree Ring Growth Histories of UK Native Oaks as a Tool for Investigating Chronic Oak Decline: An Example from the Forest of Dean. Dendrochronologia 2019, 55, 50–59. [Google Scholar] [CrossRef] [Scilit]
- Brown, N.; Jeger, M.; Kirk, S.; Williams, D.; Xu, X.; Pautasso, M.; Denman, S. Acute Oak Decline and Agrilus biguttatus: The Co-Occurrence of Stem Bleeding and D-Shaped Emergence Holes in Great Britain. Forests 2017, 8, 87. [Google Scholar] [CrossRef] [Scilit]
- Nixon, K.C. Global and Neotropical Distribution and Diversity of Oak (Genus Quercus) and Oak Forests. Ecol. Conserv. Neotrop. Mont. Oak For. 2006, 185, 3–13. [Google Scholar] [CrossRef] [Scilit]
- Eaton, E.; Caudullo, G.; Oliveira, S.; de Rigo, D. Quercus robur and Quercus petraea in Europe: Distribution, Habitat, Usage and Threats. In European Atlas of Forest Tree Species; Publication Office of the European Union: Luxembourg, 2016; pp. 160–163. [Google Scholar]
- Uzun, A.; Uzun, S.P. World Oak Trees (Quercus): Silent Guardians of the Forest Ecosystems in International Studies and Evaluations in the Field of Agriculture, Forestry and Aquaculture Sciences; Özrenk, K., Bolat, A., Eds.; Serüven Yayin Evi: Ankara, Turkey, 2024; Volume 11, ISBN 9788578110796. [Google Scholar]
- Denman, S.; Brown, N.; Kirk, S.; Jeger, M.; Webber, J. A Description of the Symptoms of Acute Oak Decline in Britain and a Comparative Review on Causes of Similar Disorders on Oak in Europe. Forestry 2014, 87, 535–551. [Google Scholar] [CrossRef] [Scilit]
- González, A.J.; Ciordia, M. Brenneria goodwinii and Gibbsiella quercinecans Isolated from Weeping Cankers on Quercus robur L. in Spain. Eur. J. Plant Pathol. 2020, 156, 965–969. [Google Scholar] [CrossRef] [Scilit]
- Ruffner, B.; Schneider, S.; Meyer, J.; Queloz, V.; Rigling, D. First Report of Acute Oak Decline Disease of Native and Non-native Oaks in Switzerland. New Dis. Rep. 2020, 41, 18. [Google Scholar] [CrossRef] [Scilit]
- Tkaczyk, M.; Celma, L.; Ruņģis, D.E.; Bokuma, G. First Report of Brenneria goodwinii and Gibbsiella quercinecans Bacteria, Detected on Weaken Oak Trees in Poland. Balt. For. 2021, 27, 563. [Google Scholar] [CrossRef] [Scilit]
- Zalkalns, O.; Celma, L. The Distribution of Bacteria Gibbsiella quercinecans and Brenneria goodwinii in Oak (Quercus robur L.) Stands in Latvia. IOP Conf. Ser. Earth Environ. Sci. 2021, 875, 012033. [Google Scholar] [CrossRef] [Scilit]
- Tkaczyk, M.; Sikora, K.; Galko, J. First Report of Bacteria Causing Acute Oak Decline on Quercus Robur in Slovakia. Eur. J. Plant Pathol. 2024, 169, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Fernandes, C.; Duarte, L.; Naves, P.; Sousa, E.; Cruz, L. First Report of Brenneria goodwinii causing Acute Oak Decline on Quercus suber in Portugal. J. Plant Pathol. 2022, 104, 837–838. [Google Scholar] [CrossRef] [Scilit]
- Carluccio, G.; Sabella, E.; Greco, D.; Vergine, M.; Delle Donne, A.G.; Nutricati, E.; Aprile, A.; De Bellis, L.; Luvisi, A. Acute and Chronic Oak Decline in Urban and Forest Ecosystems in Southern Italy. For. An Int. J. For. Res. 2024, 97, 739–749. [Google Scholar] [CrossRef] [Scilit]
- Biosca, E.G.; González, R.; López-López, M.J.; Soria, S.; Montón, C.; Pérez-Laorga, E.; López, M.M. Isolation and Characterization of Brenneria quercina, Causal Agent for Bark Canker and Drippy Nut of Quercus spp. in Spain. Phytopathology 2003, 93, 485–492. [Google Scholar] [CrossRef] [Scilit]
- Brady, C.L.; Cleenwerck, I.; Denman, S.; Venter, S.N.; Rodríguez-Palenzuela, P.; Coutinho, T.A.; De Vos, P. Proposal to reclassify Brenneria quercina (Hildebrand and Schroth 1967) Hauben et al. 1999 into a new genus, Lonsdalea gen. nov., as Lonsdalea quercina comb. nov., descriptions of Lonsdalea quercina subsp. quercina comb. nov., Lonsdalea quercina subsp. iberica subsp. nov. and Lonsdalea quercina subsp. britannica subsp. nov., emendation of the description of the genus Brenneria, reclassification of Dickeya dieffenbachiae as Dickeya dadantii subsp. dieffenbachiae comb. nov., and emendation of the description of Dickeya dadantii. Int. J. Syst. Evol. Microbiol. 2012, 62, 1592–1602. [Google Scholar] [CrossRef] [Scilit]
- Tkaczyk, M. Bioclimatic Variables and Their Impact on the Potential Distribution of Brenneria goodwinii in Europe. For. Pathol. 2023, 53, 12820. [Google Scholar] [CrossRef] [Scilit]
- Maddock, D.; Brady, C.; Denman, S.; Arnold, D. Bacteria Associated with Acute Oak Decline: Where Did They Come From? We Know Where They Go. Microorganisms 2023, 11, 2789. [Google Scholar] [CrossRef] [Scilit]
- Julius Kühn-Institut (JKI). Institut Für Nationale Und Internationale Angelegenheiten Der Pflanzengesundheit Notification of the Presence of a Harmful Organism–Closing Note; Julius Kühn-Institut (JKI): Quedlinburg, Germany, 2023; pp. 1–4. [Google Scholar]
- Pernek, M.; Kovač, M.; Jukić, A.; Dubravac, T.; Lacković, N.; Brady, C. Acute oak decline (AOD) new complex disease on holm oak (Quercus ilex L.) and possibilities of spread on other oak species in Croatia. Šumarski list. 2022, 146, 446. [Google Scholar] [CrossRef] [Scilit]
- Tkaczyk, M.; Sikora, K.; Milenković, I. First Report of Bacteria Associated With Bleeding Cankers on Oak Trees in Serbia. For. Pathol. 2025, 55, 70010. [Google Scholar] [CrossRef] [Scilit]
- Szewczyk, W.; Kuźmiński, R.; Mańka, M.; Kwaśna, H.; Łakomy, P.; Baranowska-Wasilewska, M.; Behnke-Borowczyk, J. Occurrence of Erysiphe alphitoides in oak stands affected by flood disaster. For. Res. Papers 2015, 76, 73–77. [Google Scholar] [CrossRef] [Scilit]
- Lynch, S.C.; Eskalen, A.; Zambino, P.J.; Mayorquin, J.S.; Wang, D.H. Identification and pathogenicity of Botryosphaeriaceae species associated with coast live oak (Quercus agrifolia) decline in southern California. Mycologia 2013, 105, 125–140. [Google Scholar] [CrossRef] [Scilit]
- Pearce, M.; Williams-Woodward, J. Key to diseases of oaks in the landscape. In Learning for Life; University of Georgia: Washington, DC, USA, 2009. [Google Scholar]
- Hrašovec, B.; Posarić, D.; Lukić, I.; Pernek, M. First record of oak lace bug (Corythucha arcuata) in Croatia. Šumarski list. 2013, 137, 499–503. Available online: https://hrcak.srce.hr/111641 (accessed on 2 April 2025).
- Sallé, A.; Nageleisen, L.M.; Lieutier, F. Bark and Wood Boring Insects Involved in Oak Declines in Europe: Current Knowledge and Future Prospects in a Context of Climate Change. For. Ecol. Manag. 2014, 328, 79–93. [Google Scholar] [CrossRef] [Scilit]
- Flø, D.; Krokene, P.; Økland, B. Invasion Potential of Agrilus Planipennis and Other Agrilus Beetles in Europe: Import Pathways of Deciduous Wood Chips and MaxEnt Analyses of Potential Distribution Areas. EPPO Bull. 2015, 45, 259–268. [Google Scholar] [CrossRef] [Scilit]
- Mattson, W.J.; Haack, R.A. The Role of Drought in Outbreaks of Plant-Eating Insects. Bioscience 1987, 37, 110–118. [Google Scholar] [CrossRef] [Scilit]
- Hedde, M.; Aubert, M.; Bureau, F.; Margerie, P.; Decaëns, T. Soil detritivore macro-invertebrate assemblages throughout a managed beech rotation. Ann. For. Sci. 2007, 64, 219–228. [Google Scholar] [CrossRef] [Scilit]
- Vermunt, B.; Cuddington, K.; Sobek-Swant, S.; Crosthwaite, J. Cold Temperature and Emerald Ash Borer: Modelling the Minimum under-Bark Temperature of Ash Trees in Canada. Ecol. Modell. 2012, 235–236, 19–25. [Google Scholar] [CrossRef] [Scilit]
- Brown, N.; Jeger, M.; Kirk, S.; Xu, X.; Denman, S. Spatial and Temporal Patterns in Symptom Expression within Eight Woodlands Affected by Acute Oak Decline. For. Ecol. Manag. 2016, 360, 97–109. [Google Scholar] [CrossRef] [Scilit]
- Parmain, G.; Bouget, C. Large Solitary Oaks as Keystone Structures for Saproxylic Beetles in European Agricultural Landscapes. Insect Conserv. Divers. 2018, 11, 100–115. [Google Scholar] [CrossRef] [Scilit]
- Brown, N.; Inward, D.J.G.; Jeger, M.; Denman, S. A Review of Agrilus biguttatus in UK Forests and Its Relationship with Acute Oak Decline. Forestry 2014, 88, 53–63. [Google Scholar] [CrossRef] [Scilit]
- Bale, J.S.; Gerday, C.; Parker, A.; Marahiel, M.A.; Shanks, I.A.; Davies, P.L.; Warren, G. Insects and Low Temperatures: From Molecular Biology to Distributions and Abundance. Philos. Trans. R. Soc. B Biol. Sci. 2002, 357, 849–862. [Google Scholar] [CrossRef] [Scilit]
- Gallardo, A.; Jiménez, A.; Antonietty, C.A.; Villagrán, M.; Ocete, M.E.; Soria, F.J. Forecasting Infestation by Coraebus undatus (Coleoptera, Buprestidae) in Cork Oak Forests. Int. J. Pest Manag. 2012, 58, 275–280. [Google Scholar] [CrossRef] [Scilit]
- Bueno-Gonzalez, V. Towards a Rapid Diagnostic Method to Identify Bacteria Associated with AOD. Ph.D. Thesis, University of the West of England, Bristol, UK, 2022. [Google Scholar]
- López, M.M.; Llop, P.; Olmos, A.; Marco-Noales, E.; Cambra, M.; Bertolini, E. Are Molecular Tools Solving the Challenges Posed by Detection of Plant Pathogenic Bacteria and Viruses? Curr. Issues Mol. Biol. 2009, 11, 13–46. [Google Scholar] [CrossRef] [Scilit]
- Caruso, P.; Gorris, M.T.; Cambra, M.; Palomo, J.L.; Collar, J.; López, M.M. Enrichment Double-Antibody Sandwich Indirect Enzyme-Linked Immunosorbent Assay That Uses a Specific Monoclonal Antibody for Sensitive Detection of Ralstonia Solanacearum in Asymptomatic Potato Tubers. Appl. Environ. Microbiol. 2002, 68, 3634–3638. [Google Scholar] [CrossRef] [Scilit]
- Kushalappa, A.C.; Lui, L.H.; Chen, C.R.; Lee, B. Volatile Fingerprinting (SPME-GC-FID) to Detect and Discriminate Diseases of Potato Tubers. Plant Dis. 2002, 86, 131–137. [Google Scholar] [CrossRef] [Scilit]
- Laothawornkitkul, J.; Moore, J.P.; Taylor, J.E.; Possell, M.; Gibson, T.D.; Hewitt, C.N.; Paul, N.D. Discrimination of Plant Volatile Signatures by an Electronic Nose: A Potential Technology for Plant Pest and Disease Monitoring. Environ. Sci. Technol. 2008, 42, 8433–8439. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Yu, T.; Paul, R.; Fan, J.; Yang, Y.; Wei, Q. Agricultural Nanodiagnostics for Plant Diseases: Recent Advances and Challenges. Nanoscale Adv. 2020, 2, 3083–3094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woo, P.C.Y.; Lau, S.K.P.; Teng, J.L.L.; Tse, H.; Yuen, K.Y. Then and Now: Use of 16S RDNA Gene Sequencing for Bacterial Identification and Discovery of Novel Bacteria in Clinical Microbiology Laboratories. Clin. Microbiol. Infect. 2008, 14, 908–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lan, Y.; Rosen, G.; Hershberg, R. Marker Genes That Are Less Conserved in Their Sequences Are Useful for Predicting Genome-Wide Similarity Levels between Closely Related Prokaryotic Strains. Microbiome 2016, 4, 18. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.; Webber, J. Rapid PRA for Acute Oak Decline. For. Res. 2014, 1, 1–27. [Google Scholar]
- Hacck, R.A.; Petrice, T.R.; Wiedenhoeft, A.C. Incidence of Bark- and Wood-Boring Insects in Firewood: A Survey at Michigan’s Mackinac Bridge. J. Econ. Entomol. 2010, 103, 1682–1692. [Google Scholar] [CrossRef] [Scilit]
- Kenis, M.; Hilszczanski, J. Natural Enemies of Cerambycidae and Buprestidae Infesting Living Trees. In Bark and Wood Boring Insects in Living Trees in Europe, a Synthesis 2007; Springer: Dordrecht, The Netherlands, 2004; ISBN 9781402022401. [Google Scholar]
- Duan, J.J.; Ulyshen, M.D.; Bauer, L.S.; Gould, J.; Driesche, R. Van Measuring the Impact of Biotic Factors on Populations of Immature Emerald Ash Borers (Coleoptera: Buprestidae). Environ. Entomol. 2010, 39, 1513–1522. [Google Scholar] [CrossRef] [Scilit]
- Habermann, M.; Preller, J. Studies on the biology and control of two-spotted lichen buprestid (Agrilus biguttatus Fabr.). Forst und Holz. 2003, 58, 215–220. [Google Scholar]
- Herms, D.A.; Mccullough, D.G.; Smitley, D.R.; Sadof, C.S.; Cranshaw, W. Insecticide Options for Protecting Ash Trees from Emerald Ash Borer, 3rd ed.; North Central IPM Center Bulletin, U.S. Department of Agriculture’s National Institute of Food and Agriculture: Ames, IA, USA, 2019; 16p. [Google Scholar]
- Mitchell, J.R.; Bellamy, P.E.; Ellis, C.J.; Hewison, R.L.; Hodgetts, N.G.; Iason, G.R.; Littlewood, N.A.; Newey, S.; Stockan, J.A.; Taylor, A.F.S. Collapsing foundations: The ecology of the British oak, implications of its decline and mitigation options. Biol. Conserv. 2019, 223, 316–327. [Google Scholar] [CrossRef] [Scilit]


| Bacterium | Gram Stain | Characteristic | Role in AOD |
|---|---|---|---|
| Brenneria goodwinii | Gram-negative | Facultative anaerobe, necrotrophic behavior | Production of enzymes such as pectinases, cellulases, and tannins that degrade wood cell walls, secretion of virulence factors that promote necrosis |
| Gibbsiella quercinecans | Gram-negative | Facultative anaerobe, facultative necrotrophic behavior | Production of enzymes such as pectinases, cellulases, and tannins that degrade wood cell walls, secretion of virulence factors that promote necrosis |
| Rahnella victoriana | Gram-negative | Facultative anaerobe, opportunist behavior | Role not clear, probable synergy with B. goodwinii and G. quercinecans |
| Lonsdalea britannica | Gram-negative | Facultative anaerobe, facultative necrotrophic behavior | Role not clear, probable synergy with B. goodwinii and G. quercinecans |
| Pathogen | Host | Country | Reference |
|---|---|---|---|
| AOD-associated bacteria | Q. robur | Britain | [61] |
| Spain | [62] | ||
| Switzerland | [63] | ||
| Poland | [64] | ||
| Latvia | [65] | ||
| Slovakia | [66] | ||
| Q. petraea | Britain | [61] | |
| Switzerland | [63] | ||
| Q. suber | Portugal | [67] | |
| Q. ilex | Spain | [62] | |
| Italy | [68] | ||
| Q. cerris | Switzerland | [63] | |
| Q. pubescens | Switzerland | [63] | |
| Q. rubra | Switzerland | [63] | |
| Q. pyrenaica | Spain | [62] | |
| Brenneria quercina | Q. ilex | Spain | [69] |
| Q. pyrenaica | Spain | [69] |
| Bacteria | qPCR | Reference |
|---|---|---|
| Brenneria goodwinii | Bg99F: CTGGCCGAGCCTGGAAAC Bg179R: AGTTCAGGAAGGAGAGTTCGC FAM-CCAGAATCTCATATTCGAACTCCACCATGTT-BHQ1 | [26] |
| Gibbsiella quercinecans | Gq284F: GGCTTTGATAGTGGTGGCC Gq418R: CGTTCCGTTATCACCGTGG Cy5-AACAGTTCCAGCGCCATTTTCTTCG-BHQ3 | [26] |
| Lonsdalea britannica | Lq503F: GCAAGAAAGCCAAAATCAGC Lq634R: TCTTCACTTCGGACGACACC JOE-TGCTGTGGTATCGGTGAAAGTGCCC-BHQ1 | [26] |
| Rahnella victoriana | Rv15F: CACCCAGACTTACGTGCAT Rv134R: TCAGTGTGATTGGTGAAGGT ROX-AGTGATTGGCGATACTGACGTGACC-BHQ2 | [26] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bene, A.; Vergine, M.; Carluccio, G.; Portaccio, L.; Delle Donne, A.G.; De Bellis, L.; Luvisi, A. Acute Oak Decline-Associated Bacteria: An Emerging Worldwide Threat to Forests. Microorganisms 2025, 13, 1127. https://doi.org/10.3390/microorganisms13051127
Bene A, Vergine M, Carluccio G, Portaccio L, Delle Donne AG, De Bellis L, Luvisi A. Acute Oak Decline-Associated Bacteria: An Emerging Worldwide Threat to Forests. Microorganisms. 2025; 13(5):1127. https://doi.org/10.3390/microorganisms13051127
Chicago/Turabian StyleBene, Alessandro, Marzia Vergine, Giambattista Carluccio, Letizia Portaccio, Angelo Giovanni Delle Donne, Luigi De Bellis, and Andrea Luvisi. 2025. "Acute Oak Decline-Associated Bacteria: An Emerging Worldwide Threat to Forests" Microorganisms 13, no. 5: 1127. https://doi.org/10.3390/microorganisms13051127
APA StyleBene, A., Vergine, M., Carluccio, G., Portaccio, L., Delle Donne, A. G., De Bellis, L., & Luvisi, A. (2025). Acute Oak Decline-Associated Bacteria: An Emerging Worldwide Threat to Forests. Microorganisms, 13(5), 1127. https://doi.org/10.3390/microorganisms13051127

