Hesperetin Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by Downregulating the P38/JUN/FOS Pathway In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Preparation of Hst and Chemicals
2.3. Cytotoxicity Assay
2.4. Antiviral Activity Assay
2.5. Indirect Immunofluorescence Assay (IFA)
2.6. RNA Extraction and Real-Time PCR Analysis
2.7. Western Blot Analysis
2.8. Time Course Analysis of Hst Anti-PRRSV
2.9. Direct Inactivation Activity of Hst on Virus Particles
2.10. Comparative Transcriptomic Analysis
2.11. siRNA Assay
2.12. The Effect of Hst on the P38/JUN/FOS Signaling Pathway in PRRSV-Infected Cells
2.13. Statistical Analysis
3. Results
3.1. In Vitro Inhibition of PRRSV Infection by Hst
3.2. Inhibition of PRRSV Infection by Different Treatment Protocols of Hst
3.3. Hst Does Not Directly Interact with PRRSV
3.4. Transcriptional Response of PRRSV-Infected Cells to Hst Treatment
3.5. GO and KEGG Pathway Analysis
3.6. Hst Inhibits PRRSV Proliferation by Downregulating the P38/JUN/FOS Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Montaner-Tarbes, S.; Del Portillo, H.A.; Montoya, M.; Fraile, L. Key Gaps in the Knowledge of the Porcine Respiratory Reproductive Syndrome Virus (PRRSV). Front. Vet. Sci. 2019, 6, 38. [Google Scholar] [CrossRef]
- Snijder, E.J.; Kikkert, M.; Fang, Y. Arterivirus molecular biology and pathogenesis. J. Gen. Virol. 2013, 94 Pt 10, 2141–2163. [Google Scholar] [CrossRef] [PubMed]
- Kappes, M.A.; Faaberg, K.S. PRRSV structure, replication and recombination: Origin of phenotype and genotype diversity. Virology 2015, 479–480, 475–486. [Google Scholar] [CrossRef]
- Nelsen, C.J.; Murtaugh, M.P.; Faaberg, K.S. Porcine reproductive and respiratory syndrome virus comparison: Divergent evolution on two continents. J. Virol. 1999, 73, 270–280. [Google Scholar] [CrossRef] [PubMed]
- Meulenberg, J.J.; Hulst, M.M.; de Meijer, E.J.; Moonen, P.L.; den Besten, A.; de Kluyver, E.P.; Wensvoort, G.; Moormann, R.J. Lelystad virus belongs to a new virus family, comprising lactate dehydrogenase-elevating virus, equine arteritis virus, and simian hemorrhagic fever virus. Arch. Virol. Suppl. 1994, 9, 441–448. [Google Scholar] [CrossRef] [PubMed]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef] [PubMed]
- Shi, M.; Lam, T.T.; Hon, C.C.; Murtaugh, M.P.; Davies, P.R.; Hui, R.K.; Li, J.; Wong, L.T.; Yip, C.W.; Jiang, J.W.; et al. Phylogeny-based evolutionary, demographical, and geographical dissection of North American type 2 porcine reproductive and respiratory syndrome viruses. J. Virol. 2010, 84, 8700–8711. [Google Scholar] [CrossRef]
- Hancox, L.; Balasch, M.; Angulo, J.; Scott-Baird, E.; Mah, C.K. Comparison of viraemia and nasal shedding after PRRSV-1 challenge following vaccination with three commercially available PRRS modified live virus vaccines. Res. Vet. Sci. 2024, 180, 105416. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Miller, L.C.; Sang, Y. Current Status of Vaccines for Porcine Reproductive and Respiratory Syndrome: Interferon Response, Immunological Overview, and Future Prospects. Vaccines 2024, 12, 606. [Google Scholar] [CrossRef] [PubMed]
- Piras, F.; Bollard, S.; Laval, F.; Joisel, F.; Reynaud, G.; Charreyre, C.; Andreoni, C.; Juillard, V. Porcine reproductive and respiratory syndrome (PRRS) virus-specific interferon-gamma(+) T-cell responses after PRRS virus infection or vaccination with an inactivated PRRS vaccine. Viral Immunol. 2005, 18, 381–389. [Google Scholar] [CrossRef] [PubMed]
- Bassaganya-Riera, J.; Thacker, B.J.; Yu, S.; Strait, E.; Wannemuehler, M.J.; Thacker, E.L. Impact of immunizations with porcine reproductive and respiratory syndrome virus on lymphoproliferative recall responses of CD8+ T cells. Viral Immunol. 2004, 17, 25–37. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Ge, X.; Yang, H. Porcine Reproductive and Respiratory Syndrome Modified Live Virus Vaccine: A "Leaky" Vaccine with Debatable Efficacy and Safety. Vaccines 2021, 9, 362. [Google Scholar] [CrossRef]
- Feng, L.; Luo, X.; Huang, L.; Zhang, Y.; Li, F.; Li, S.; Zhang, Z.; Yang, X.; Wang, X.; OuYang, X.; et al. A viral protein activates the MAPK pathway to promote viral infection by downregulating callose deposition in plants. Nat. Commun. 2024, 15, 10548. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Sun, F.; Wang, L.; Gao, M.; Xie, Y.; Sun, Y.; Liu, H.; Yuan, Y.; Yi, W.; Huang, Z.; et al. Virus-induced p38 MAPK activation facilitates viral infection. Theranostics 2020, 10, 12223–12240. [Google Scholar] [CrossRef]
- Law, A.H.; Tam, A.H.; Lee, D.C.; Lau, A.S. A role for protein phosphatase 2A in regulating p38 mitogen activated protein kinase activation and tumor necrosis factor-alpha expression during influenza virus infection. Int. J. Mol. Sci. 2013, 14, 7327–7340. [Google Scholar] [CrossRef] [PubMed]
- Roth, H.; Magg, V.; Uch, F.; Mutz, P.; Klein, P.; Haneke, K.; Lohmann, V.; Bartenschlager, R.; Fackler, O.T.; Locker, N.; et al. Flavivirus Infection Uncouples Translation Suppression from Cellular Stress Responses. mBio 2017, 8, 10-1128. [Google Scholar] [CrossRef]
- Guo, Y.J.; Pan, W.W.; Liu, S.B.; Shen, Z.F.; Xu, Y.; Hu, L.L. ERK/MAPK signalling pathway and tumorigenesis. Exp. Ther. Med. 2020, 19, 1997–2007. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Huang, C.; Zhang, Q.; Feng, W.H. Porcine reproductive and respiratory syndrome virus (PRRSV) induces IL-12p40 production through JNK-AP-1 and NF-kappaB signaling pathways. Virus Res. 2016, 225, 73–81. [Google Scholar] [CrossRef]
- Song, S.; Bi, J.; Wang, D.; Fang, L.; Zhang, L.; Li, F.; Chen, H.; Xiao, S. Porcine reproductive and respiratory syndrome virus infection activates IL-10 production through NF-kappaB and p38 MAPK pathways in porcine alveolar macrophages. Dev. Comp. Immunol. 2013, 39, 265–272. [Google Scholar] [CrossRef]
- Lee, Y.J.; Lee, C. Stress-activated protein kinases are involved in porcine reproductive and respiratory syndrome virus infection and modulate virus-induced cytokine production. Virology 2012, 427, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Lee, C. Porcine reproductive and respiratory syndrome virus replication is suppressed by inhibition of the extracellular signal-regulated kinase (ERK) signaling pathway. Virus Res. 2010, 152, 50–58. [Google Scholar] [CrossRef]
- Hu, J.; Li, C.; Zhou, Y.; Ding, J.; Li, X.; Li, Y. Allicin Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection In Vitro and Alleviates Inflammatory Responses. Viruses 2023, 15, 1050. [Google Scholar] [CrossRef]
- Liu, X.; Song, Z.; Bai, J.; Nauwynck, H.; Zhao, Y.; Jiang, P. Xanthohumol inhibits PRRSV proliferation and alleviates oxidative stress induced by PRRSV via the Nrf2-HMOX1 axis. Vet. Res. 2019, 50, 61. [Google Scholar] [CrossRef] [PubMed]
- Sun, P.; Sun, N.; Yin, W.; Sun, Y.; Fan, K.; Guo, J.; Khan, A.; He, Y.; Li, H. Matrine inhibits IL-1β secretion in primary porcine alveolar macrophages through the MyD88/NF-κB pathway and NLRP3 inflammasome. Vet. Res. 2019, 50, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Guang, Q.; Zhang, L.Z.; Tang, X.; Li, J.K.; Cao, C.; Chen, H.B.; Qiu, L.X. Quercetin alleviates inflammation induced by porcine reproductive and respiratory syndrome virus in MARC-145 cells through the regulation of arachidonic acid and glutamine metabolism. Vet. Med. Sci. 2024, 10, e1536. [Google Scholar] [CrossRef]
- Long, F.; Zhang, M.; Yang, X.; Liang, X.; Su, L.; An, T.; Zhang, G.; Zeng, Z.; Liu, Y.; Chen, W.; et al. The Antimalaria Drug Artesunate Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by Activating AMPK and Nrf2/HO-1 Signaling Pathways. J. Virol. 2022, 96, e0148721. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.-W.; Fu, P.-F.; Zeng, L.; Qi, Y.-L.; Li, X.-Q.; Wang, Q.; Yang, G.-Y.; Li, H.-W.; Wang, J.; Chu, B.-B.; et al. EGCG Restricts PRRSV Proliferation by Disturbing Lipid Metabolism. Microbiol. Spectr. 2022, 10, e02276-21. [Google Scholar] [CrossRef]
- Garg, A.; Garg, S.; Zaneveld, L.J.D.; Singla, A.K. Chemistry and pharmacology of the citrus bioflavonoid hesperidin. Phytother. Res. 2001, 15, 655–669. [Google Scholar] [CrossRef] [PubMed]
- Parhiz, H.; Roohbakhsh, A.; Soltani, F.; Rezaee, R.; Iranshahi, M. Antioxidant and Anti-Inflammatory Properties of the Citrus Flavonoids Hesperidin and Hesperetin: An Updated Review of their Molecular Mechanisms and Experimental Models. Phytother. Res. 2015, 29, 323–331. [Google Scholar] [CrossRef] [PubMed]
- Khezri, M.R.; Ghasemnejad-Berenji, M.; Moloodsouri, D. Hesperetin and the PI3K/AKT pathway: Could their interaction play a role in the entry and replication of the SARS-CoV-2? J. Food Biochem. 2022, 46, e14212. [Google Scholar] [CrossRef] [PubMed]
- Sohel, M.; Sultana, H.; Sultana, T.; Al Amin, M.; Aktar, S.; Ali, M.C.; Rahim, Z.B.; Hossain, M.A.; Al Mamun, A.; Amin, M.N.; et al. Chemotherapeutic potential of hesperetin for cancer treatment, with mechanistic insights: A comprehensive review. Heliyon 2022, 8, e08815. [Google Scholar] [CrossRef]
- Zalpoor, H.; Bakhtiyari, M.; Shapourian, H.; Rostampour, P.; Tavakol, C.; Nabi-Afjadi, M. Hesperetin as an anti-SARS-CoV-2 agent can inhibit COVID-19-associated cancer progression by suppressing intracellular signaling pathways. Inflammopharmacology 2022, 30, 1533–1539. [Google Scholar] [CrossRef] [PubMed]
- Greig, A. The use of a microtitration technique for the routine assay of African swine fever virus. Brief Report. Arch. Virol. 1975, 47, 287–289. [Google Scholar] [CrossRef] [PubMed]
- Khatun, A.; Shabir, N.; Yoon, K.J.; Kim, W.I. Effects of ribavirin on the replication and genetic stability of porcine reproductive and respiratory syndrome virus. BMC Vet. Res. 2015, 11, 21. [Google Scholar] [CrossRef]
- Jo, S.H.; Kim, M.E.; Cho, J.H.; Lee, Y.; Lee, J.; Park, Y.D.; Lee, J.S. Hesperetin inhibits neuroinflammation on microglia by suppressing inflammatory cytokines and MAPK pathways. Arch. Pharm. Res. 2019, 42, 695–703. [Google Scholar] [CrossRef]
- Fan, J.; Xu, C.; Shi, H.; Wang, X.; Zheng, T.; Zhou, M.; Zhang, Z.; Fu, Y.; Tang, B. Hesperetin affects osteoclast differentiation via MAPK signaling pathway. Adv. Clin. Exp. Med. 2024, 33, 1131–1139. [Google Scholar] [CrossRef]
- Lu, C.; Yang, W.; Chu, F.; Wang, S.; Ji, Y.; Liu, Z.; Yu, H.; Qin, S.; Sun, D.; Jiao, Z.; et al. Hesperetin Attenuates T-2 Toxin-Induced Chondrocyte Injury by Inhibiting the p38 MAPK Signaling Pathway. Nutrients 2024, 16, 3107. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Kim, H.J.; Bar-Sagi, D. Modulation of signalling by Sprouty: A developing story. Nat. Rev. Mol. Cell Biol. 2004, 5, 441–450. [Google Scholar] [CrossRef] [PubMed]
- Clements, J.E.; Zink, M.C.; Narayan, O.; Gabuzda, D.H. Lentivirus infection of macrophages. Immunol. Ser. 1994, 60, 589–600. [Google Scholar] [PubMed]
- Zhao, Y.; Ling, X.; Zhang, H.; Sun, P.; Sun, Y.; Yin, W.; Fan, K.; Yang, H.; Zhong, J.; Zhang, Z.; et al. Network pharmacology and experimental validation to reveal the target of matrine against PRRSV. iScience 2023, 26, 106371. [Google Scholar] [CrossRef]
- Eberle, R.J.; Olivier, D.S.; Amaral, M.S.; Willbold, D.; Arni, R.K.; Coronado, M.A. Promising Natural Compounds against Flavivirus Proteases: Citrus Flavonoids Hesperetin and Hesperidin. Plants 2021, 10, 2183. [Google Scholar] [CrossRef]
- Kim, H.K.; Jeon, W.K.; Ko, B.S. Flavanone glycosides from Citrus junos and their anti-influenza virus activity. Planta Med. 2001, 67, 548–549. [Google Scholar] [CrossRef]
- Delang, L.; Segura Guerrero, N.; Tas, A.; Querat, G.; Pastorino, B.; Froeyen, M.; Dallmeier, K.; Jochmans, D.; Herdewijn, P.; Bello, F.; et al. Mutations in the chikungunya virus non-structural proteins cause resistance to favipiravir (T-705), a broad-spectrum antiviral. J. Antimicrob. Chemother. 2014, 69, 2770–2784. [Google Scholar] [CrossRef] [PubMed]
- Sanjuan, R.; Nebot, M.R.; Chirico, N.; Mansky, L.M.; Belshaw, R. Viral mutation rates. J. Virol. 2010, 84, 9733–9748. [Google Scholar] [CrossRef]
- Khatun, A.; Shabir, N.; Seo, B.J.; Kim, B.S.; Yoon, K.J.; Kim, W.I. The Attenuation Phenotype of a Ribavirin-Resistant Porcine Reproductive and Respiratory Syndrome Virus Is Maintained during Sequential Passages in Pigs. J. Virol. 2016, 90, 4454–4468. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Du, Y.; Wang, H.; Du, L.; Feng, W.H. Porcine reproductive and respiratory syndrome virus (PRRSV) up-regulates IL-8 expression through TAK-1/JNK/AP-1 pathways. Virology 2017, 506, 64–72. [Google Scholar] [CrossRef]
- Xu, Y.; Wang, H.; Zhang, X.; Zheng, X.; Zhu, Y.; Han, H.; Feng, W.H. Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) induces IL-6 production through TAK-1/JNK/AP-1 and TAK-1/NF-kappaB signaling pathways. Vet. Microbiol. 2021, 256, 109061. [Google Scholar] [CrossRef] [PubMed]
- Verma, I.M.; Ransone, L.J.; Visvader, J.; Sassone-Corsi, P.; Lamph, W.W. fos-jun conspiracy: Implications for the cell. Ciba Found. Symp. 1990, 150, 128–137, discussion 137–146. [Google Scholar] [CrossRef] [PubMed]
- Castellazzi, M.; Sergeant, A. The C-Jun oncoprotein. Bull. Cancer 1993, 80, 757–759. [Google Scholar] [PubMed]
- Watanabe, T.; Hiasa, Y.; Tokumoto, Y.; Hirooka, M.; Abe, M.; Ikeda, Y.; Matsuura, B.; Chung, R.T.; Onji, M. Protein kinase R modulates c-Fos and c-Jun signaling to promote proliferation of hepatocellular carcinoma with hepatitis C virus infection. PLoS ONE 2013, 8, e67750. [Google Scholar] [CrossRef] [PubMed]
- Shih, D.S.; Carruth, L.M.; Anderson, M.; Clements, J.E. Involvement of FOS and JUN in the activation of visna virus gene expression in macrophages through an AP-1 site in the viral LTR. Virology 1992, 190, 84–91. [Google Scholar] [CrossRef] [PubMed]
- Wan, P.; Zhang, S.; Ruan, Z.; Liu, X.; Yang, G.; Jia, Y.; Li, Y.; Pan, P.; Wang, W.; Li, G.; et al. AP-1 signaling pathway promotes pro-IL-1beta transcription to facilitate NLRP3 inflammasome activation upon influenza A virus infection. Virulence 2022, 13, 502–513. [Google Scholar] [CrossRef]
- Dong, N.; Li, X.; Xue, C.; Zhang, L.; Wang, C.; Xu, X.; Shan, A. Astragalus polysaccharides alleviates LPS-induced inflammation via the NF-kappaB/MAPK signaling pathway. J. Cell Physiol. 2020, 235, 5525–5540. [Google Scholar] [CrossRef]
- Yang, S.; Wang, L.; Pan, X.; Liang, Y.; Zhang, Y.; Li, J.; Zhou, B. 5-Methoxyflavone-induced AMPKalpha activation inhibits NF-kappaB and P38 MAPK signaling to attenuate influenza A virus-mediated inflammation and lung injury in vitro and in vivo. Cell Mol. Biol. Lett. 2022, 27, 82. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Wang, L.; Yang, S.; Liang, Y.; Zhang, Y.; Pan, X.; Li, J. Diosmetin alleviates benzo[a]pyrene-exacerbated H1N1 influenza virus-induced acute lung injury and dysregulation of inflammation through modulation of the PPAR-gamma-NF-kappaB/P38 MAPK signaling axis. Food Funct. 2023, 14, 3357–3378. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.M.; Kleiboeker, S.B. Porcine arterivirus activates the NF-kappaB pathway through IkappaB degradation. Virology 2005, 342, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Han, M.; Kim, C.; Calvert, J.G.; Yoo, D. Interplay between interferon-mediated innate immunity and porcine reproductive and respiratory syndrome virus. Viruses 2012, 4, 424–446. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Cao, L.; Xu, Z.; Fang, L.; Zhong, Y.; Chen, Q.; Luo, R.; Chen, H.; Li, K.; Xiao, S. MiR-125b reduces porcine reproductive and respiratory syndrome virus replication by negatively regulating the NF-kappaB pathway. PLoS ONE 2013, 8, e55838. [Google Scholar] [CrossRef]
- Zhang, A.; Zhao, L.; Li, N.; Duan, H.; Liu, H.; Pu, F.; Zhang, G.; Zhou, E.M.; Xiao, S. Carbon Monoxide Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by the Cyclic GMP/Protein Kinase G and NF-kappaB Signaling Pathway. J. Virol. 2017, 91, 10-1128. [Google Scholar] [CrossRef]
- Rudmann, D.G. On-target and off-target-based toxicologic effects. Toxicol. Pathol. 2013, 41, 310–314. [Google Scholar] [CrossRef] [PubMed]
- Curty, G.; Iniguez, L.P.; Soares, M.A.; Nixon, D.F.; de Mulder Rougvie, M. Off-Target Effect of Activation of NF-kappaB by HIV Latency Reversal Agents on Transposable Elements Expression. Viruses 2022, 14, 1571. [Google Scholar] [CrossRef]
- Wang, H.M.; Liu, T.X.; Wang, T.Y.; Wang, G.; Liu, Y.G.; Liu, S.G.; Tang, Y.D.; Cai, X.H. Isobavachalcone inhibits post-entry stages of the porcine reproductive and respiratory syndrome virus life cycle. Arch. Virol. 2018, 163, 1263–1270. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Wang, X.; Ni, B.; Huan, C.C.; Wu, J.Q.; Wen, L.B.; Liao, Y.; Tong, G.Z.; Ding, C.; Fan, H.J.; et al. Syndecan-4, a PRRSV attachment factor, mediates PRRSV entry through its interaction with EGFR. Biochem. Biophys. Res. Commun. 2016, 475, 230–237. [Google Scholar] [CrossRef] [PubMed]
- Whitworth, K.M.; Rowland, R.R.; Ewen, C.L.; Trible, B.R.; Kerrigan, M.A.; Cino-Ozuna, A.G.; Samuel, M.S.; Lightner, J.E.; McLaren, D.G.; Mileham, A.J.; et al. Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus. Nat. Biotechnol. 2016, 34, 20–22. [Google Scholar] [CrossRef]
- Stoian, A.M.M.; Rowland, R.R.R.; Brandariz-Nunez, A. Identification of CD163 regions that are required for porcine reproductive and respiratory syndrome virus (PRRSV) infection but not for binding to viral envelope glycoproteins. Virology 2022, 574, 71–83. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Liu, Z.; Zheng, S.; Han, G.; He, F. CD163 Antibodies Inhibit PRRSV Infection via Receptor Blocking and Transcription Suppression. Vaccines 2020, 8, 592. [Google Scholar] [CrossRef] [PubMed]
- Dey, S.; Bruner, J.; Brown, M.; Roof, M.; Chowdhury, R. Identification and biophysical characterization of epitope atlas of Porcine Reproductive and Respiratory Syndrome Virus. Comput. Struct. Biotechnol. J. 2024, 23, 3348–3357. [Google Scholar] [CrossRef]
- Cui, W.; Yu, F.; Zhang, Y.; Han, X.; Zou, R.; Tang, Y.; Wang, L.; Eliphaz, N.; Wang, J.; Yuan, S.; et al. Discovery of traditional Chinese medicines against porcine reproductive and respiratory syndrome virus. Pharmacol. Res.-Mod. Chin. Med. 2021, 1, 100003. [Google Scholar] [CrossRef]
- Liu, X.; Bai, J.; Jiang, C.; Song, Z.; Zhao, Y.; Nauwynck, H.; Jiang, P. Therapeutic effect of Xanthohumol against highly pathogenic porcine reproductive and respiratory syndrome viruses. Vet. Microbiol. 2019, 238, 108431. [Google Scholar] [CrossRef] [PubMed]










| Primer/Probe Name | Primer Sequence (5′→3′) | Product Size/bp |
|---|---|---|
| PRRSV-F | TTGCTAGGCCGCAAGTAC | 183 |
| PRRSV-R | ACGCCGGACGACAAATGC | |
| β-actin-F | TCCTGTGGCATCCATGAAACTA | 284 |
| β-actin-R | GACTCGTCATACTCCTGCTTGCT | |
| FOS-F | GAGCCCTTTGATGACTTCCTGTT | 103 |
| FOS-R | CTGCATAGAAGGACCCAGATAGG | |
| NR4A1-F | CTGGAGGTCATCCGCAAGTG | 215 |
| NR4A1-R | CTGTCAATCCAGTCGCCGAA | |
| DUSP1-F | AATGCTGGAGGAAGGGTGTTT | 155 |
| DUSP1-R | CTGAAGTTGGGGGAGATGATG | |
| JUN-F | AGATGGAAACGACCTTCTAC | 110 |
| JUN-R | CAGGGTCATGCTCTGTTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, R.; Zhao, F.; Li, Q.; Hou, L.; Liu, G.; Sun, X.; Du, J.; Fang, B. Hesperetin Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by Downregulating the P38/JUN/FOS Pathway In Vitro. Microorganisms 2025, 13, 450. https://doi.org/10.3390/microorganisms13020450
Gu R, Zhao F, Li Q, Hou L, Liu G, Sun X, Du J, Fang B. Hesperetin Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by Downregulating the P38/JUN/FOS Pathway In Vitro. Microorganisms. 2025; 13(2):450. https://doi.org/10.3390/microorganisms13020450
Chicago/Turabian StyleGu, Ruiheng, Feike Zhao, Quanying Li, Limin Hou, Guochang Liu, Xueyan Sun, Junyuan Du, and Binghu Fang. 2025. "Hesperetin Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by Downregulating the P38/JUN/FOS Pathway In Vitro" Microorganisms 13, no. 2: 450. https://doi.org/10.3390/microorganisms13020450
APA StyleGu, R., Zhao, F., Li, Q., Hou, L., Liu, G., Sun, X., Du, J., & Fang, B. (2025). Hesperetin Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication by Downregulating the P38/JUN/FOS Pathway In Vitro. Microorganisms, 13(2), 450. https://doi.org/10.3390/microorganisms13020450
