Next Article in Journal
An ICU Outbreak Due to Two Populations of Carbapenem-Resistant Klebsiella pneumoniae Isolates Belonging to ST11 and ST39 Types, Harbouring Double Carbapenemase Genes
Next Article in Special Issue
From Basics to Breakthroughs: A Review on the Evolution of Campylobacter spp. Culture Media
Previous Article in Journal
Chromatin Remodeler TaSWI3D Controls Wheat Susceptibility to Pathogenic Fungus Blumeria graminis forma specialis tritici
Previous Article in Special Issue
Exploring the Potential of Haematococcus pluvialis as a Source of Bioactives for Food Applications: A Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

LuxR-Type Regulator RRP6 Positively Regulates the Biosynthesis of Plantaricin EF and Improves Its Production in Lactiplantibacillus plantarum 163

School of Life Science, Huaibei Normal University, Huaibei 235000, China
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(12), 2780; https://doi.org/10.3390/microorganisms13122780
Submission received: 6 November 2025 / Revised: 28 November 2025 / Accepted: 4 December 2025 / Published: 6 December 2025
(This article belongs to the Special Issue Advances in Food Microbial Biotechnology)

Abstract

The two-component system HPK6/RRP6 related to the pln locus of plantaricin biosynthesis was screened out. The overexpression of LuxR-type regulator RRP6 promoted the transcription of ABC transporter-related genes, thereby increasing plantaricin EF yield. Its yield in 163(rrp6) reached 16.01 mg/L, which was 1.20-fold that of the original strain. The regulatory mechanism indicated that RRP6 could bind to two sites of the plnG1 promoter, promoting its transcription and translation, accelerating the secretion of plantaricin and auto-inducing peptide, and enhancing the extracellular plantaricin yield. Amino acids Q73, R144, T171, and Y175 play a crucial role in the binding of RRP6. Furthermore, potential regulatory compensation within the Lactiplantibacillus plantarum 163 genome may compensate for the negative effects after the deletion of rrp6. These results provide a novel strategy for increasing plantaricin EF yield, which facilitates its large-scale application as a natural and safe food preservative in agriculture and the food industry.

Graphical Abstract

1. Introduction

Lactic Acid Bacteria (LAB) are widely recognized for their beneficial roles in human health, particularly in modulating immune function and the gut microbiome [1,2,3,4]. Among various metabolites produced by LAB, bacteriocins have become an effective bio-preservative and a potential alternative to traditional antibiotics and chemical additives in agriculture and the food industry [5,6,7].
Plantaricin, an important type of bacteriocin produced by LAB, exhibits significant diversity and exists in multiple classifications of LAB bacteriocins. An increasing number of studies indicate that plantaricin can effectively inactivate foodborne pathogenic microorganisms to mitigate contamination in meat, seafood, milk, vegetables, and fruits [8,9]. Plantaricin not only extends shelf life but also serves as a potential alternative to chemical preservatives, highlighting its considerable application value in food preservation [10,11,12]. However, the limited production of plantaricin in wild bacterial strains poses challenges for large-scale production and application in the field of food safety [13].
It has been reported that plantaricin biosynthesis is regulated by both the quorum-sensing system (QSS) and the two-component system (TCS) [14]. The biosynthesis of bacteriocins in LAB is regulated by the relevant QSS in the gene cluster where the bacteriocin synthesis gene is located, and the auto-inducing peptide (AIP) mediated quorum sensing plays a key role in the biosynthesis of plantaricin in general [15,16]. Meanwhile, the biosynthesis of bacteriocins is also regulated by the TCS, such as sakacin A, whose biosynthesis is regulated by the TCS SapK/SapR in Lactobacillus sakei Lb70 strain [17]. The biosynthesis of carnobactin is regulated by the TCS CbnK/CbnR in Carnobacterium piscicola LV17A strain [18].
Typically, a TCS consists of a membrane-associated sensor histidine kinase (HK) and a cytoplasmic response regulator (RR). Upon perceiving specific environmental signals, the HK autophosphorylates and then transfers the phosphate group to its cognate RR. The phosphorylated RR subsequently undergoes a conformational change, enabling it to bind target sequences and modulate the transcription of downstream genes, thereby allowing the bacterium to adapt to changing conditions [19].
Plantaricin EF, a class of IIb bacteriocin produced by Lactiplantibacillus plantarum 163 (L. plantarum 163), was identified in our previous studies, which exhibits broad-spectrum and high-efficiency antimicrobial activity, but its yield is relatively low and its regulatory mechanism is rather complex [20]. In order to study its regulatory mechanism and improve the yield of plantaricin, the genome, transcriptome and proteome of L. plantarum 163 were determined in the previous stage of this study [20]. Through multi-omics analysis, it was determined that there is a certain correlation between the TCS HPK6/RRP6 and the pln locus that regulates the biosynthesis of plantaricin. Furthermore, the overexpression of regulatory factor RRP6 was found to improve the yield of plantaricin EF. Nevertheless, the regulatory mechanism by which the HPK6/RRP6 regulates the biosynthesis of plantaricin remains unclear, including the pathway through which RRP6 regulates plantaricin biosynthesis, the gene sequences bound by RRP6, and its binding mode. In this study, the regulatory mechanism of HPK6/RRP6 on plantaricin biosynthesis was investigated in L. plantarum 163. The plantaricin EF yield and expression levels of related genes were determined when the gene rrp6 was overexpressed and knocked out, respectively. The nucleic acid sequences that are specifically bound by RRP6 protein were identified. In addition, the binding sites, affinity, and mode of interaction with the binding sequence for RRP6 protein were investigated. By combining the previous omics data and the current research results, the molecular mechanism by which RRP6 regulates its biosynthesis was elucidated, facilitating the construction of high-yield plantaricin strains, increasing the yield of plantaricin, and promoting the industrial production and application of plantaricin.

2. Materials and Methods

2.1. Strains and Culture Medium

L. plantarum 163 was isolated from traditionally fermented cabbage in Guizhou, China, and preserved in the China General Microbial Culture Collection Center (No. 8224). E. coli DH5α and BL21(DE3) were preserved in our laboratory. L. plantarum 163 was cultured in de Man, Rogosa, and Sharpe (MRS) medium at 37 °C, while E. coli DH5α and BL21(DE3) were cultured in Luria–Bertani (LB) medium. The plasmids pET30a and pMG36e served as vectors for the target genes. E. coli DH5α and BL21(DE3) were used as hosts for plasmid replication and expression, respectively. Kanamycin or erythromycin (Solarbio, Beijing, China) was added to the medium based on the resistance gene present on the plasmid. The relevant plasmids and strains used in this study are shown in Table S1.

2.2. Construction of Overexpression and Heteroexpression Strains

Plasmids pMG36e and pET30a were used as overexpression and heterologous expression vectors for the rrp6 gene, respectively. Primers e-F/e-R and e-rrp6F/e-rrp6R were employed to generate linearized forms of plasmids pMG36e and the rrp6 gene, respectively. The circular plasmid pMG36e-rrp6 was constructed using a recombinant enzyme provided by ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China), and transferred into L. plantarum 163 via electroporation [21]. Meanwhile, the strain L. plantarum 163 containing the empty plasmid pMG36e was used as the control group. Similarly, primers a-F/a-R and a-rrp6F/a-rrp6R were used to linearize the plasmid pET30a along with the rrp6 gene. These fragments were assembled using recombinant enzymes to form a circular plasmid pET30a-rrp6 which was then introduced into E. coli BL21(DE3) through chemical transformation [22]. The strain E. coli BL21(DE3) containing the empty plasmid pET30a was used as the control group. The sequences of all recombinant plasmids were verified through nucleotide sequencing analysis. The relevant primers used in this study are shown in Table S2.

2.3. Screening the Regulatory Factors Related to the pln Locus of Plantaricin Biosynthesis

The whole genome, transcriptome and proteome of L. plantarum 163 were sequenced at the Beijing Genomic Institute (BGI, Shenzhen, China). Then, the whole genome, transcriptome and proteome data were analyzed using the BGI Interactive Cloud Platform (https://report.bgi.com/ps/login/login.html, accessed on 24 April 2025). Based on the whole genome analysis of L. plantarum 163, the pln locus of plantaricin biosynthesis was screened out. Through the joint analysis of the transcriptome and proteome of L. plantarum 163, genes with significant differences (fold change > 2 and Q-value ≤ 0.001 for transcriptional levels, and fold change > 1.5 and p-value < 0.05 for protein levels) at both the transcriptional and protein levels were screened out. Subsequently, in order to find the proteins related to the plantaricin biosynthesis pln locus, the protein–protein interaction analysis was performed on the BGI Interactive Cloud Platform. Meanwhile, the STRING database (https://string-db.org/, accessed on 7 May 2025) was adopted to further analyze the protein–protein interaction results. Additionally, the whole genome and transcriptome data were submitted to the Sequence Read Archive database of the National Center of Biotechnology Information (accession no. SRR12825168 and SRR12831476). The proteome data were uploaded to the National Protein Science Center (Beijing), China (accession no. PXD022981).

2.4. Effects of rrp6 Gene Overexpression on Plantaricin EF Production

The activated seeds of L. plantarum 163 and L. plantarum 163(rrp6) were cultured in MRS medium respectively at 37 °C for 52 h. Samples were collected every 4 h to assess the cell density, which was measured as the OD600 of the fermentation broth. Additionally, the culture medium at intervals of 12, 24, 36, and 48 h was taken out to harvest the cell-free supernatant (CFS) by centrifugation. The CFS was filtered with a 0.22 μm filter membrane. The plantaricin EF production in CFS was quantified utilizing reversed-phase high-performance liquid chromatography (RP-HPLC, UltiMate 3000, Thermo Scientific, Waltham, MA, USA) following the method previously described in our research [23]. The wild-type strain L. plantarum 163 was used as the control. Samples from both strains were prepared in triplicate, and the experiment was independently conducted with three parallel tests.

2.5. Effects of rrp6 Gene Overexpression on the Transcriptional Levels of Related Genes in the pln Locus

The Trizol method was employed to extract total RNA from the cell pellet collected by centrifugation as described in Section 2.4. The cDNA was synthesized using the HiScript 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The qPCR system consisted of a total volume of 20 μL, 1.0 μL cDNA, 8.2 μL sterile ultrapure water, 10.0 μL Hieff qPCR SYBR Green Master Mix (Yeasen, Shanghai, China), 0.4 μL reverse primer, and 0.4 μL forward primer. Sterile ultrapure water served as a negative control in place of cDNA samples. The gene encoding 16S rRNA was utilized as a reference gene throughout this study. Wild-type strain L. plantarum 163 was used as the control. The transcription levels of target genes were analyzed using a StepOnePlus Real-Time PCR system (Veriti, Applied Biosystems, Waltham, MA, USA). Relative transcriptional levels of target genes were calculated using the 2(−ΔΔCt) method [24,25]. All reactions were performed in sextuplicate to ensure result reliability and the experiment was independently conducted with three parallel tests. The qPCR primers used in this experiment are shown in Table S3.

2.6. Heterologous Expression and Purification of RRP6 Protein

E. coli BL21(DE3) containing pET30a-rrp6 was used to prepare the seed solution. It was cultured at 37 °C and 180 rpm for 12 h in a shake flask with LB medium (100 mL). Subsequently, 1% of this inoculum was transferred to a shake flask containing fresh LB medium supplemented with kanamycin and cultured under the same conditions of 37 °C and 180 rpm. When the optical density at 600 nm wavelength reached 0.6–0.8, Isopropyl-β-D-Thiogalactopyranoside (IPTG; Macklin, Shanghai, China) was added to the culture at a final concentration of 100 μg/mL. The culture was then incubated at 16 °C and 180 rpm for an additional 20 h. After centrifugation at 8000 rpm for 5 min, the cell pellet was resuspended in a buffer (50 mM Tris-HCl, pH 7.1, 300 mM NaCl, 8% glycerol, Beyotime Biotech, Shanghai, China), and subjected to ultrasonication treatment at 0 °C for 15 min. Following another round of centrifugation (10,000 rpm, 10 min, 4 °C), the supernatant was added to a Ni-NTA column to facilitate the binding of RRP6 protein with Ni-NTA resin (Beyotime Biotech, Shanghai, China). Then, weakly bound proteins were removed with elution buffer (50 mM Tris-HCl, pH 7.1, 300 mM NaCl, 8% glycerol, 25 mM imidazole, Beyotime Biotech, Shanghai, China). Subsequently, RRP6 protein labeled with His-tag was eluted from the column using elution buffers containing imidazole at concentrations of 50, 100, and 200 mM. Then, the imidazole was removed from the RRP6 protein solution using a Millipore protein ultrafiltration tube (10 kDa; Millipore, Burlington, MA, USA). The eluent underwent further analysis via SDS-PAGE. E. coli BL21(DE3) carrying pET30a served as a control. The experiment was independently conducted in three parallel tests.

2.7. In Vitro Binding of RRP6 Protein to Sequence of plnG1 Promoter

For Electrophoretic Mobility Shift Assay (EMSA), slight modifications were made based on the method of Ueharu et al. [26]. Briefly, RRP6 protein was incubated with 50 ng of a FAM-labeled probe (Sangon Biotech, Shanghai, China) in a binding buffer (10 mM HEPES, pH 7.9, 0.1 mM spermidine, 0.4 mM MgCl2, 50 mM NaCl, 0.1 mM ZnCl2, 0.4 mM DTT, 8% glycerol; Beyotime Biotech, Shanghai, China) at 37 °C for 30 min. For the specific binding reaction, the FAM-labeled probes were replaced with 5 μg of unlabeled probes in the reaction mixture, which was further incubated at 37 °C for 30 min. Subsequently, the FAM-labeled probes (50 ng) were added to the reaction mixture and incubated at 37 °C for another 30 min. Following these steps, a polyacrylamide gel with a concentration of 4% was employed to conduct electrophoresis for 2 h at a voltage setting of 80 V. Finally, the fluorescence imaging instrument (Typhoon 9410, GE Healthcare, Chicago, IL, USA) was used to analyze the changes in electrophoretic mobility.
DNase I footprinting was performed following the method described by Chang et al. with minor modifications [27]. Varying concentrations (40 μL) of RRP6 protein and the probes (350 ng) were mixed and incubated at 25 °C for 30 min. Next, a 10 μL solution containing freshly prepared CaCl2 (100 nM, Kemiou Chemical Reagent Co., Ltd., Tianjin, China) and DNase I (0.015 U, Beyotime Biotech, Shanghai, China) was added to the mixture, followed by incubation in a metal bath at 37 °C for 1 min. Subsequently, 140 μL of DNase I termination solution was added to terminate the above reaction. Then, the samples were extracted with phenol/chloroform and subsequently precipitated with ethanol. Finally, the pellet was dissolved in ultrapure water (30 μL), and GeneScan-LIZ600 size standards (Applied Biosystems, Waltham, MA, USA) were used to analyze the results.

2.8. Molecular Docking

The interaction between RRP6 protein and the plnG1 promoter sequence was considered through computational simulation. The structural models of RRP6 protein and binding sequences were obtained through homology modeling and Discover Studio 4.5 software, respectively. Molecular docking analysis was performed via ZDOCK 3.0.3 software, which employs fast Fourier transform technology for spatial searching, allowing for rapid identification of potential binding modes between two molecules in three-dimensional space [28]. Furthermore, ZDOCK utilizes scoring functions, dynamically adjusts the orientation of the input protein, and incorporates experimental binding data along with bioinformatics approaches, demonstrating high efficiency and accuracy throughout the molecular docking process [29,30]. For this study, the highest-scoring conformation was selected from a total of 100 successful docking results.

2.9. Site-Directed Mutagenesis of Key Amino Acids

According to the results of molecular docking, mutations were introduced at the two binding sites. Amino acids Q73, R144, T171, and Y175 were successively mutated into alanine. Site-specific mutant strains were constructed via PCR. The PCR products were combined with the linearized plasmid pET30a to construct circular plasmids pET30a-rrp6-∆Q73, pET30a-rrp6-∆R144, pET30a-rrp6-∆T171, and pET30a-rrp6-∆Y175, which were further transformed into E. coli BL21(DE3) respectively by the chemical transformation method [22]. Subsequently, single colonies were selected and inoculated into LB liquid medium. These single colonies were further sequenced by Sangon Bioengineering Co., Ltd. (Shanghai, China) to confirm the mutation sequence.

2.10. EMSA of Mutated Protein and Binding Sites

Four mutant proteins (RRP6-∆Q73, RRP6-∆R144, RRP6-∆T171, and RRP6-∆Y175) were expressed and purified in E. coli BL21(DE3). Methods of heterologous expression and purification were described in Section 2.6 above. The EMSA method employed was as described in Section 2.7 above. FAM-labeled probes and four mutant proteins were mixed in a binding buffer respectively, followed by incubation at 37 °C. Then, the samples were analyzed by EMSA, and the changes in mobility were observed through fluorescence imaging.

2.11. Gene Knockout of rrp6

L. plantarum 163(∆rrp6) was constructed based on the method described by Fuhren et al. with slight modifications [31]. Firstly, the sequences of the upstream and downstream homologous arms of the rrp6 gene and the chloramphenicol resistance gene cat were obtained through PCR amplification in vitro. These three sequences were sequentially connected into a single fragment using an overlapping extension PCR method, wherein the resistance gene was positioned centrally, flanked by the upstream and downstream homologous arms of rrp6 at both ends. The resulting fragment was subsequently inserted into plasmid pNZ5319 via one-step cloning to construct the knockout plasmid pNZ5319-rrp6, which was further electroporated into competent cells of L. plantarum 163. Then, 900 μL of liquid MRS medium was rapidly added to the electroporation cuvette and gently mixed. 1 mL of this mixture was transferred to 1.5 mL centrifuge tubes and incubated at 37 °C for 3 h. Subsequently, 100 μL of bacterial suspension was spread onto solid MRS medium plates containing 10 μg/mL chloramphenicol and cultured at 37 °C for 48 h. Single colonies were selected using toothpicks and inoculated into new centrifuge tubes containing 1 mL liquid MRS medium for subculturing.
After several generations, the bacterial cultures were diluted and plated onto solid MRS medium containing chloramphenicol. Single colonies were selected for further analysis. PCR was performed with primers flanking the rrp6 homologous arm to verify the successful integration of the chloramphenicol resistance gene into the genome of L. plantarum 163. Meanwhile, specific primers at both ends of the rrp6 gene were employed to confirm the loss of plasmid pNZ5319. The correct amplification of PCR products with primers surrounding both homologous arms of the rrp6 gene, coupled with the failure to detect the rrp6 gene itself, indicated that free plasmid pNZ5319 had been successfully eliminated. Furthermore, it was confirmed that the chloramphenicol resistance gene cat had replaced the rrp6 gene in the genome of L. plantarum 163, thereby completing the construction of a rrp6 knockout strain.

2.12. Effects of rrp6 Gene Knockout on the Growth Curve of L. plantarum 163 and the Plantaricin Yield

The activated wild-type L. plantarum 163 and knockout strains L. plantarum 163(∆rrp6) were introduced into MRS medium respectively and cultured at 37 °C for 48 h. The optical density of fermentation broth at 600 nm was measured to assess bacterial growth. For the yield determination of plantaricin EF, the method was slightly modified according to that of Zhao et al. [20]. The activated seeds of L. plantarum 163 and L. plantarum 163(∆rrp6) were inoculated into fresh MRS medium respectively and incubated at 37 °C. At time points of 12, 24, 36, and 48 h, the medium was centrifuged to collect the CFS and the plantaricin EF yield in the CFS was determined using RP-HPLC. All experiments were independently conducted three times, and three parallel tests were set up for each experiment.

2.13. Effects of rrp6 Gene Knockout on the Transcription Level of Relevant Genes

The methods used in this section were the same as those described in Section 2.5. Following the completion of RNA extraction, cDNA synthesis and qPCR detection were performed. The qPCR reaction was conducted in a 20 μL system, comprising 10 μL of SYBR Green Master Mix, 0.4 μL each of upstream and downstream primers, 1 μL of cDNA template, and 8.2 μL of sterile ultrapure water. The gene encoding 16S rRNA was utilized as a reference gene. Wild-type strain L. plantarum 163 was used as the control. The transcription levels of target genes were analyzed using a StepOnePlus Real-Time PCR system (Veriti, Applied Biosystems, Waltham, MA, USA). Relative quantification values for target genes were calculated employing the 2−ΔΔCt method [24,25]. All reactions were performed in sextuplicate to ensure result reliability and the experiment was independently conducted with three parallel tests.

2.14. Statistical Analysis

Each experiment in this study was independently conducted with three parallel tests. The data presented in figures and tables were analyzed using SPSS software (version 27.0, IBM, Armonk, NY, USA), with results expressed as mean ± standard deviation (Mean ± SD). The significance of differences between groups was assessed using Duncan’s multiple range test. Statistically significant differences were marked as p < 0.05. The different lowercase letters indicate a significant difference in the same group.

3. Results

3.1. TCS HPK6/RRP6 Associated with the pln Locus of Plantaricin Biosynthesis

Through multi-omics joint analysis, a plantaricin biosynthesis gene cluster pln locus was found. The pln locus contains six operons, namely plnorf3orf5orfZ3, plnKLR, plnABD, plnEFI, plnG1G2HSTUVW, and plnXY. The functions of the related genes in these operons were shown in Table 1. As can be seen from Table 1, these genes are primarily involved in biosynthesis (plnorf3, plnK, plnE, plnF), immunity (plnorf5, plnL, plnI), regulation (plnA, plnB, plnD), and secretion (plnG1, plnG2, plnH, plnS, plnT, plnU, plnV, plnW) of plantaricin. Through protein–protein interaction analysis, HPK6/RRP6 was found to be correlated with the pln locus (Figures S1 and S2).

3.2. Effects of rrp6 Overexpression on the Growth of L. plantarum 163 and Plantaricin EF Production

The growth characteristics and Gram staining properties of both the wild-type strain and the rrp6 overexpression strain were found to be consistent (Figure 1a,b). The colonies produced by each strain were round with raised surfaces (Figure 1a). The results of Gram staining revealed a blue-purple coloration, and all cells exhibited a rod-shaped morphology (Figure 1b). As can be seen from Figure 1c and Figure S3, the growth curves of the L. plantarum 163 strain and L. plantarum 163(rrp6) strain were largely comparable. This observation indicates that the overexpression of the rrp6 gene did not significantly impact the fundamental cellular metabolism or cell cycle of L. plantarum 163. Figure 1d and Figure S4 demonstrated that the production of plantaricin EF in the L. plantarum 163(rrp6) strain exhibited an increasing trend between 12 and 36 h, stabilizing from 36 to 48 h. By 48 h, the production in L. plantarum 163(rrp6) was 16.01 ± 0.55 mg/L, which was approximately 1.20-fold compared to the control group (p < 0.05). These results suggested that RRP6 specifically enhanced plantaricin EF biosynthesis without compromising cellular growth.

3.3. Effects of rrp6 Overexpression on Transcription Levels of pln Locus Associated Genes

As illustrated in Figure 2, the overexpression of rrp6 in L. plantarum 163 resulted in a transcriptional pattern for the plnG1, plnG2, plnH, plnST, plnU, plnV, and plnW genes that initially increased and subsequently decreased. The transcription levels of these genes peaked between 12 h and 24 h, followed by a decline to levels comparable to those of the control by 36 h. At 24 h, the transcription levels of these genes within the overexpression were approximately 4.25-, 3.64-, 3.30-, 2.35-, 2.69-, 2.42- and 2.07-fold higher than those of the control group, respectively (p < 0.05). This indicated that the overexpression of the rrp6 gene could significantly enhance the transcription levels of related regulatory genes.

3.4. Identification of plnG1 Promoter Binding Sequence to RRP6 Protein

The RRP6 protein with a molecular weight of 22.9 kDa was expressed in E. coli BL21(DE3) and purified by Ni-NTA column (Figures S5 and S6). The results of EMSA indicated that the RRP6 protein could bind to the plnG1 promoter sequence (266 bp probe) (Figure 3a). As the concentration of RRP6 protein increased, there was a gradual decrease in band migration distance until it ultimately disappeared. At a protein concentration of 5 μg (lane 4), no band migration was observed, with all probes remaining within the well. This demonstrates that RRP6 protein can bind to the promoter sequence of plnG1. Meanwhile, the band migration distance in Lane 5 was almost the same as that in Lane 1, indicating that when sufficient unlabeled probes were added, RRP6 protein could bind to the unlabeled probes. Subsequently, when FAM-labeled probes were added, RRP6 protein no longer bound to the FAM-labeled probes. This result indicated that RRP6 protein binds specifically to the promoter sequence of plnG1. In addition, the DNase I footprinting assays showed similar results (Figure 3b,c). RRP6 protein could specifically bind to the promoter sequence of plnG1, and there were two specific binding sequences, which were Site I (ACGTTAATAGATAGTTGGC, 5′-3′, 19 bp) and Site II (TAATTGGTGAGGGGAGTACAAG, 5′-3′, 22 bp), respectively (Figure 3c).

3.5. Binding of RRP6 Protein to Two Sequences

The structural model of HPK6 and RRP6 proteins and their Ramachandran plots are shown in Figures S7 and S8, respectively. The Ramachandran plot showed that 100% of residues fell within the allowed regions, exceeding the 95% threshold considered acceptable for a high-quality model. This demonstrated that the structural model was appropriate for molecular docking and molecular dynamics simulations. The static potential energy diagrams of HPK6 and RRP6 proteins are shown in Figure S9. After 100 successful docking simulations were conducted, the optimal model was selected from the conformational results (Figure 4a,c and Figure S10). It was observed that a groove was present on the surface of the RRP6 protein, allowing DNA sequences (site I and II) to interact with these grooves. Additionally, it was noted that RRP6 protein could bind to the major groove of site I and the minor groove of site II. These results indicated that the groove on the surface of RRP6 protein played a crucial role in the binding process between RRP6 protein and DNA.
For site I, RRP6 protein interacted with a significant region of DNA within an AT-rich area, surrounded by base pairs T9, A8, A9, G10, and G14 (Figure 4b). For site II, RRP6 protein bound to the DNA region rich in AT bases, and the bases G9, A10, G12, T3, T5 and T13 played a key role in the binding (Figure 4d). Similarly, different amino acids in the RRP6 protein bound to two different sites. The amino acids playing the key role in the binding were S72, Q73, R144, S168, T171, R173, and Y175 for site I; M1, Q73, K77, R144, G170, T171, and Y175 for site II. Analysis of amino acids interacting with DNA sequence at the two binding sites revealed that Q73, R144, T171 and Y175 were present in both models. These amino acids not only possessed functional side chain groups but also were located in critical regions of the grooves of RRP6 protein. These results suggested that amino acids Q73, R144, T171 and Y175 played a leading role in facilitating the binding process between RRP6 protein and DNA sequence.

3.6. Mutated Protein and Nucleic Acid Interaction Detection

Amino acids located near the binding pocket of the RRP6 protein for DNA binding were analyzed, revealing that Q73, R144, T171, and Y175 were important amino acids (Figure 4b,d). Alanine-scanning mutagenesis was separately performed on these four amino acids. The results indicated that mutation to alanine significantly reduced the binding capability and stability of the protein. After mutating Q73, R144, T171 and Y175 into alanine, the energy values (∆G) of the proteins of RRP6-∆Q73, RRP6-∆R144, RRP6-∆T171, and RRP6-∆Y175 decreased to −0.87102177, −0.64210328, −0.68420012, and −1.6993903 respectively. These results further demonstrated that these amino acids played essential roles in the in vitro binding process of RRP6 protein.
Based on Figure 5a, the binding model resembled a clip structure, with ΔQ73 located at the bottom playing a crucial supporting role. The four mutant proteins were successfully purified and their band sizes closely resembled those of the RRP6 protein (Figure S11). EMSA analysis revealed that during the binding process of the four mutant protein samples to sites I and II, the band migration distances were all larger than those of the RRP6 sample, and the ΔQ73 sample had the largest migration distance (Figure 5b,c). This indicated that after Q73 was mutated to alanine, the binding interaction between the protein and the nucleic acid (sites I and II) was significantly weakened, with some unbound probes remaining. In addition, compared with the control group, the band migration distances of samples ΔR144, ΔT171, and ΔY175 gradually decreased and were even smaller than those of the ΔQ73 sample (Figure 5b). These results suggested that while these amino acids could still bind to sites I and II after mutating to alanine respectively, their binding abilities were all weakened. Moreover, the ΔQ73 sample had the weakest binding ability to sites I and II, indicating that these four amino acids play important roles in the binding process of the RRP6 protein to sites I and II, and Q73 plays a key role in this binding process.

3.7. Effects of rrp6 Gene Knockout on the Growth of L. plantarum 163 and the Production of Plantaricin EF

Based on Figure S12, electrophoresis analysis indicated that no amplification bands were detected in the reaction system when PCR amplification of the target strain was conducted using specific primers for the rrp6 gene. In stark contrast, the wild-type strain exhibited a distinct and single band under identical primer and amplification conditions, with a fragment size of 606 bp. This finding suggested that the rrp6 gene in the target strain was successfully knocked out. The deletion of rrp6 did not alter the basic cellular morphology or growth of L. plantarum 163. The knockout strain exhibited a cellular morphology similar to that of the wild-type (Figure 6a,b), as well as a growth curve indistinguishable from the wild-type (Figure 6c and Figure S13). In combination with Figure 1, neither the overexpression nor the knockout of the rrp6 gene resulted in any changes in the basic cellular morphology or growth. Surprisingly, the deletion of rrp6 also did not affect plantaricin EF biosynthesis. The production profile over time and final yield of plantaricin EF in the L. plantarum 163(Δrrp6) were not significantly different from those of the wild-type strain at any time point measured (p > 0.05) (Figure 6d and Figure S14).
These results indicated that the knockout of the rrp6 gene neither had an adverse effect on the growth of L. plantarum 163, nor inhibited the biosynthesis of plantaricin EF.

3.8. Effects of rrp6 Gene Knockout on the Transcription Levels of pln Locus Associated Genes in L. plantarum 163

As shown in Figure 7, at 12 h, the relative transcription levels of the plnG1, plnG2, plnH, plnST, plnU, plnV and plnW genes in both the control and the knockout groups remained stable without significant fluctuations. Furthermore, the relative transcriptional levels between the two groups were similar. At 24 h, however, the relative transcriptional levels of the plnG1, plnG2, and plnH genes in the knockout group significantly decreased compared to those in the control group, by approximately 31%, 37%, and 23% respectively (p < 0.05). No significant differences were noted in the relative transcriptional levels of other genes between the two groups. At 36 h, the relative transcriptional levels of the three aforementioned genes in the knockout group increased and were nearly equivalent to those of the control group. The decline in transcriptional levels of these three genes within the knockout group suggested that there was an association between the HPK6/RRP6 and these specific genes located in the gene cluster pln locus. This implied that RRP6 could enhance the transcription and expression of these genes, thereby playing a crucial role in promoting plantaricin EF biosynthesis.

4. Discussion

The genomic data suggested that HPK6/RRP6 might be associated with the plantaricin biosynthesis in L. plantarum 163 (Figures S1 and S2). The overexpression of regulatory factor RRP6 resulted in an elevated transcription level of related genes (Figure 2). Meanwhile, it significantly enhanced the production of plantaricin EF (Figure 1). These results demonstrated that HPK6/RRP6 was not only implicated in the biosynthesis of plantaricin EF but also played a crucial role in promoting its production. It has been reported that the biosynthesis of bacteriocin is not only regulated by its own QSS but also by the TCS [20]. For instance, the biosynthesis of plantarcin Q7 can be indirectly regulated by the TCS AgrA/AgrC in Lactiplantibacillus plantarum Q7 [32]. In Streptococcus gordonii, the upregulation of the CiaRH TCS inhibited the Com pathway, thereby suppressing the biosynthesis of bactericin [33,34,35]. Therefore, investigating the regulatory mechanism of the HPK6/RRP6 on the biosynthesis of plantaricin EF can contribute to increasing its yield.
In the TCS HPK6/RRP6, HPK6 is a histidine protein kinase, and RRP6 serves as its homologous regulatory factor, which is a member of the LuxR family (Figure S15). The structure of this type of regulatory factor exhibits distinct characteristics. The N-terminal region serves as the signal-sensing domain, while the C-terminal region comprises the DNA-binding domain that contains the helical-turn-helical (HTH) motif. Moreover, the N-terminus often includes either an autoinducer binding domain or a response regulatory domain [36,37,38]. Research has demonstrated that LuxR-type HTH regulators play a crucial role in various biological processes and are involved in mediating diverse biological functions [39,40,41]. In our study, the RRP6 regulatory factor from the LuxR family could significantly enhance the transcriptional levels of related genes in the pln locus, thereby promoting the biosynthesis of plantaricin EF. Sequence analysis revealed that RRP6 protein was highly similar to the LuxR-type regulatory factors reported in L. plantarum WP 071542686.1 and L. plantarum WP 085439356.1. Moreover, such regulatory factors are widely distributed in L. plantarum (Figures S16–S18).
Many studies have reported on the regulatory factors associated with the LuxR family, and most members of this family play a positive regulatory role. For instance, as a transcriptional activator belonging to the LuxR family, MalT is capable of binding both ATP and maltotriose. By recognizing the MalT box sequence on DNA, it plays a positive regulatory role in the transcription of genes associated with maltose transport and metabolism in Escherichia coli [42]. Furthermore, in Bacillus species, GerE functions as an autonomic effector within the LuxR family; it binds to DNA through its HTH motif, positively regulates the expression of coat protein genes in spores, enhances spore maturation, and imparts resistance characteristics to them [36].
In this study, the overexpression of LuxR-type regulator (RRP6) could significantly enhance the transcriptional levels of related genes encoding the ABC transporter system (plnG1, plnG2, plnH) while not affecting the strain growth. Meanwhile, it could promote the biosynthesis of plantaricin EF in L. plantarum (Figure 1 and Figure 2). The regulatory mechanism indicated that RRP6 protein could bind to the two specific binding sites (Site I: ACGTTAATAGATAGTTGGC, 5′-3′, 19 bp; Site II: TAATTGGTGAGGGGAGTACAAG, 5′-3′, 22 bp) of the plnG1 promoter sequence (Figure 3). Moreover, RRP6 protein bound to the major groove at site I and the minor groove at site II, with Q73 playing the key role in its binding process. The regulatory mode of RRP6 is similar to that of the regulatory factor Lp_2642. The Lp_2642 protein can bind to the major groove of the promoter sequence of the AIP gene plnA, thereby promoting its transcription and further enhancing the yield of plantaricin [20]. In addition, the knockout of the rrp6 gene did not affect cell growth. Moreover, the production of plantaricin EF showed no significant difference compared with that of the wild-type strain (Figure 6). However, at 24 h, the transcriptional levels of plnG1, plnG2, and plnH genes in the knockout strain exhibited a significant decrease, by about 31%, 37%, and 23% respectively. These results may indicate potential regulatory compensation in the genome of L. plantarum 163, which compensates for the loss following the deletion of rrp6. This potential regulatory compensation mechanism will be the target of our next research.
It is well known that bacteria use the TCS to sense changes in the environment and adjust metabolic behavior [43]. The system consists of protein kinase (PK) and response regulator (RR). Extracellular environmental signaling factors can phosphorylate PK on the cell membrane [44,45]. The phosphorylated PK then activates its homologous RR within the cell, and the activated RR further exerts its regulatory functions [46,47]. In this study, the auto-inducer of the histidine protein kinase (HPK) HPK6 in the TCS remains unclear. This is because the activation of HPK6 may be influenced by various factors in the environment, including salt ions and small-molecule metabolites. For example, it was reported that acetate ions could also activate the PlnB (HPK) in the TCS, thereby promoting the biosynthesis of plantaricin [48]. Therefore, the auto-inducers of the HPK6/RRP6 will be further investigated in the future.
During the growth of L. plantarum 163, the regulatory program is activated when the concentration of the extracellular AIP (PlnA) reaches a specific threshold. Upon binding to the PlnB (HPK) located on the cell membrane, PlnA can stimulate its HPK activity, leading to ATP hydrolysis and subsequently transferring a phosphate group to the regulatory factor PlnD. The phosphorylated PlnD then binds to the promoter regions of both PlnA and plantaricin synthesis genes, thereby initiating the biosynthesis of precursors of PlnA and plantaricin. As these precursors are transported from within the cell to the external environment, their signal peptides are cleaved by a specialized ABC transport system. Ultimately, mature forms of PlnA and plantaricin are secreted into the extracellular space via this ABC transport system, where they exert their biological functions [15,49]. During this process, the expression of the regulatory factor RRP6 enhances both the transcription and translation of genes associated with the ABC transport system. Consequently, it accelerates the secretion of PlnA and plantaricin EF, resulting in reduced intracellular and increased extracellular concentrations of them. The extracellular PlnA will continue to activate the PlnB, promoting the transcription and translation of intracellular PlnA and plantaricin EF, and forming a positive feedback loop.

5. Conclusions

In summary, through previous multi-omics joint analysis, the TCS HPK6/RRP6 related to the pln locus gene cluster of the plantaricin synthesis gene was screened out. Overexpression of the regulatory factor RRP6 increased the transcriptional levels of genes related to plantaricin and AIP transport and secretion in the pln locus. This further increased the extracellular concentrations of plantaricin and AIP. The potential regulatory mechanisms have shown that the RRP6 protein can specifically bind to the promoter sequence of the transporter-encoding gene plnG1, enhance its transcription and translation, and accelerate the transport and secretion of plantaricin and AIP, and thereby increase the yield of plantaricin EF. These results offer a novel strategy for achieving high-level production of plantaricin EF and contribute significantly to its large-scale application as a natural and safe food preservative in agriculture and the food industry.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13122780/s1, Figure S1: The genome, transcriptome and proteome data were analyzed using the BGI Cloud platform to identify the proteins that interact with the pln locus; Figure S2: String network of protein–protein interaction to identify the proteins that interact with the pln locus; Figure S3: Effects of rrp6 overexpression on the growth of L. plantarum 163; Figure S4: RP-HPLC analysis of plantaricin E and F by 163(rrp6); Figure S5: SDS-PAGE results of RRP6 protein; Figure S6: SDS-PAGE after RRP6 purification; Figure S7: Homologous modeling of HPK6 and RRP6; Figure S8: Ramchndran plot prediction of HPK6 and RRP6; Figure S9: The static potential energy diagram of HPK6 and RRP6; Figure S10: Molecular modeling of protein RRP6 interaction with two binding sites; Figure S11: SDS-PAGE after mutant protein purification; Figure S12: PCR verification of gene rrp6 knockout strains; Figure S13: Effects of rrp6 knockout on the growth of L. plantarum 163; Figure S14: RP-HPLC analysis of plantaricin E and F by 163(Δrrp6); Figure S15: The domain of the two-component systems HPK6/RRP6; Figure S16: Multiple sequence alignment of RRP6 homolog proteins; Figure S17: Conservation analysis of RRP6 homolog proteins; Figure S18: Phylogenetic tree of the amino acid sequence for the RRP6 protein; Table S1: Strains and plasmids presented in this study; Table S2: Primers used in this study; Table S3: qPCR primers used in this study.

Author Contributions

Conceptualization, D.Z. and G.W.; methodology, Y.L. and D.Z.; software, Y.L.; validation, Y.L., S.L. and C.H.; formal analysis, X.Z. and B.X.; investigation, G.W.; writing—original draft preparation, Y.L.; writing—review and editing, Y.L. and D.Z.; visualization, Z.L.; funding acquisition, D.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Key Program of Natural Science Research in Colleges and Universities in Anhui Province (No. 2022AH050380).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials, and further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
AIPAuto-inducing peptide
LABLactic acid bacteria
QSSQuorum-sensing system
TCSTwo-component system
CFSCell-free supernatant
EMSAElectrophoretic mobility shift assay
PKProtein kinase
RRResponse regulator
HPKHistidine protein kinase

References

  1. Zapasnik, A.; Sokolowska, B.; Bryla, M. Role of Lactic Acid Bacteria in food preservation and safety. Foods 2022, 11, 1283. [Google Scholar] [CrossRef]
  2. Agriopoulou, S.; Stamatelopoulou, E.; Sachadyn-Król, M.; Varzakas, T. Lactic Acid Bacteria as antibacterial agents to extend the shelf life of fresh and minimally processed fruits and vegetables: Quality and safety aspects. Microorganisms 2020, 8, 952. [Google Scholar] [CrossRef] [PubMed]
  3. He, X.A.; Cui, Y.; Jia, Q.Y.; Zhuang, Y.L.; Gu, Y.; Fan, X.J.; Ding, Y.Y. Response mechanisms of lactic acid bacteria under environmental stress and their application in the food industry. Food Biosci. 2025, 64, 105938. [Google Scholar] [CrossRef]
  4. Kang, A.N.; Mun, D.; Ryu, S.; Jae Lee, J.; Oh, S.; Kyu Kim, M.; Song, M.; Oh, S.; Kim, Y. Culturomic-, metagenomic-, and transcriptomic-based characterization of commensal lactic acid bacteria isolated from domestic dogs using Caenorhabditis elegans as a model for aging. J. Anim. Sci. 2022, 100, skac323. [Google Scholar] [CrossRef] [PubMed]
  5. Shahrir, S.Z.; Kee, P.E.; Ng, H.S.; Tan, J.S.; Lan, J.C.W. Evaluation of antimicrobial effect of bacteriocin produced by Lactobacillus acidophilus utilizing molasses and corn steep liquor. Biochem. Eng. J. 2024, 205, 109266. [Google Scholar] [CrossRef]
  6. Villarreal, L.A.; Ladero, V.; Sarquis, A.; Martinez, B.; del Rio, B.; Alvarez, M.A. Bacteriocins against biogenic amine-accumulating lactic acid bacteria in cheese: Nisin A shows the broadest antimicrobial spectrum and prevents the formation of biofilms. J. Dairy Sci. 2024, 107, 4277–4287. [Google Scholar] [CrossRef]
  7. Xu, C.; Fu, Y.Y.; Liu, F.; Liu, Z.J.; Ma, J.G.; Jiang, R.; Song, C.N.; Jiang, Z.M.; Hou, J.C. Purification and antimicrobial mechanism of a novel bacteriocin produced by Lactobacillus rhamnosus 1.0320. LWT-Food Sci. Technol. 2021, 137, 110338. [Google Scholar] [CrossRef]
  8. Gor, M.C.; Golneshin, A.; Van, T.T.H.; Moore, R.J.; Smith, A.T. Cloning and functional expression of a food-grade circular bacteriocin, plantacyclin B21AG, in probiotic Lactobacillus plantarum WCFS1. PLoS ONE 2020, 15, e0232806. [Google Scholar] [CrossRef]
  9. Hassan, M.U.; Nayab, H.; Rehman, T.U.; Williamson, M.P.; Haq, K.U.; Shafi, N.; Shafique, F. Characterisation of bacteriocins produced by Lactobacillus spp. Isolated from the traditional Pakistani yoghurt and their antimicrobial activity against common foodborne pathogens. BioMed Res. Int. 2020, 2020, 8281623. [Google Scholar] [CrossRef]
  10. Bu, Y.S.; Yang, H.; Li, J.X.; Liu, Y.X.; Liu, T.J.; Gong, P.M.; Zhang, L.W.; Wang, S.M.; Yi, H.X. Comparative metabolomics analyses of plantaricin Q7 production by Lactobacillus plantarum Q7. J. Agric. Food Chem. 2021, 69, 10741–10748. [Google Scholar] [CrossRef]
  11. Du, H.C.; Chi, H.B.; Yao, H.L.; Lu, Z.X.; Bie, X.M.; Zhang, C.; Zhao, H.Z.; Lu, F.X.; Chen, M.R. The antibacterial activity of plantaricin GZ1-27 against MRSA and its bio-preservative effect on chilled pork in combination with chitosan. Int. J. Food Microbiol. 2022, 365, 109539. [Google Scholar] [CrossRef]
  12. Pei, J.J.; Jin, W.G.; Abd El-Aty, A.M.; Baranenko, D.A.; Gou, X.X.; Zhang, H.X.; Geng, J.Z.; Jiang, L.; Chen, D.J.; Yue, T.L. Isolation, purification, and structural identification of a new bacteriocin made by Lactobacillus plantarum found in conventional kombucha. Food Control 2020, 110, 106923. [Google Scholar] [CrossRef]
  13. Wei, Z.Q.; Fan, P.R.; Li, B.; Madjirebaye, P.; Peng, Z.; Xiong, T. Optimization of culture medium ingredients and culture conditions for bacteriocin production in Lactococcus lactis NCU036019. Biotechnol. Appl. Biochem. 2025, 72, 985–998. [Google Scholar] [CrossRef]
  14. Wang, S.C.; Song, X.D.; Zheng, X.; Cheng, C.Y.; Jin, J.H.; Xie, Y.H.; Zhang, H.X. FliA regulates the antibacterial activity of plantaricin BM-1 against Escherichia coli K-12 through the LuxS/AI-2 quorum-sensing-mediated biofilm formation. Front. Microbiol. 2025, 16, 1606567. [Google Scholar] [CrossRef]
  15. Diep, D.B.; Straume, D.; Kjos, M.; Torres, C.; Nes, I.F. An overview of the mosaic bacteriocin pln loci from Lactobacillus plantarum. Peptides 2009, 30, 1562–1574. [Google Scholar] [CrossRef]
  16. Blanchard, A.E.; Liao, C.; Lu, T. An ecological understanding of quorum sensing-controlled bacteriocin synthesis. Cell. Mol. Bioeng. 2016, 9, 443–454. [Google Scholar] [CrossRef]
  17. Axelsson, L.; Holck, A. The genes involved in production of and immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706. J. Bacteriol. 1995, 177, 2125–2137. [Google Scholar] [CrossRef] [PubMed]
  18. Quadri, L.E.N. Regulation of antimicrobial peptide production by autoinducer-mediated quorum sensing in lactic acid bacteria. Antonie Van Leeuwenhoek 2002, 82, 133–145. [Google Scholar] [CrossRef]
  19. Yan, Y.S.; Zou, L.S.; Wei, H.G.; Yang, M.Y.; Yang, Y.Q.; Li, X.F.; Xia, H.Y. An atypical two-component system, AtcR/AtcK, simultaneously regulates the biosynthesis of multiple secondary metabolites in Streptomyces bingchenggensis. Appl. Environ. Microbiol. 2024, 90, e0130023. [Google Scholar] [CrossRef] [PubMed]
  20. Zhao, D.Y.; Wang, Q.; Meng, F.Q.; Lu, F.X.; Bie, X.M.; Lu, Z.X.; Lu, Y.J. TetR-type regulator Lp_2642 positively regulates plantaricin EF production based on genome-wide transcriptome sequencing of Lactiplantibacillus plantarum 163. J. Agric. Food Chem. 2022, 70, 4362–4372. [Google Scholar] [CrossRef]
  21. Wang, K.P.; Liu, P.P.; Xia, Y.H.; Gao, D.S.; Chang, H.T.; Wang, X.W.; Li, Y.T.; Zhao, J.; Chen, L.; Wang, C.Q.; et al. Construction of recombinant Lactobacillus casei expressing Gallibacterium anatis flfA and evaluation of oral immune effect. Chin. J. Agric. Biotechnol. 2020, 28, 1652–1661. [Google Scholar]
  22. Yang, Y.Q.; Yu, Q.L.; Wang, M.; Zhao, R.; Liu, H.W.; Xun, L.Y.; Xia, Y.Z. Escherichia coli BW25113 competent cells prepared using a simple chemical method have unmatched transformation and cloning efficiencies. Front. Microbiol. 2022, 13, 838698. [Google Scholar] [CrossRef] [PubMed]
  23. Zhao, D.Y.; Meng, F.Q.; Zhou, L.B.; Lu, F.X.; Bie, X.M.; Sun, J.; Lu, Z.X.; Lu, Y.J. Maltose effective improving production and regulatory biosynthesis of plantaricin EF in Lactobacillus plantarum 163. Appl. Microbiol. Biotechnol. 2021, 105, 2713–2723. [Google Scholar] [CrossRef] [PubMed]
  24. Bian, S.L.; Shao, D.K.; Zhao, Q.S.; Li, Q.H.; Ren, Y.J. Transcriptome-based screening of candidate low-temperature-associated genes and analysis of the BocARR-B transcription factor gene family in kohlrabi (Brassica oleracea L. var. caulorapa L.). Int. J. Mol. Sci. 2024, 25, 9261. [Google Scholar] [CrossRef] [PubMed]
  25. Zhao, D.Y.; Wang, Q.; Lu, F.X.; Bie, X.M.; Zhao, H.Z.; Lu, Z.X.; Lu, Y.J. A novel plantaricin 827 effectively inhibits Staphylococcus aureus and extends shelf life of skim milk. LWT-Food Sci. Technol. 2022, 154, 112849. [Google Scholar] [CrossRef]
  26. Ueharu, H.; Higuchi, M.; Nishimura, N.; Yoshida, S.; Shibuya, S.; Sensui, K.; Kato, T.; Kato, Y. Expression of Kruppel-like Factor 6, KLF6, in rat pituitary stem/progenitor Cells and its regulation of the PRRX2 gene. J. Reprod. Dev. 2014, 60, 304–311. [Google Scholar] [CrossRef]
  27. Chang, S.C.; Lee, C.Y. Quorum-sensing regulator OpaR directly represses seven protease genes in Vibrio parahaemolyticus. Front. Microbiol. 2020, 11, 534692. [Google Scholar] [CrossRef]
  28. Hacisuleyman, A.; Erman, B. Fine tuning rigid body docking results using the dreiding force field: A computational study of 36 known nanobody-protein complexes. Proteins 2023, 91, 1417–1426. [Google Scholar] [CrossRef]
  29. Polonsky, K.; Pupko, T.; Freund, N.T. Evaluation of the ability of AlphaFold to predict the three-dimensional structures of antibodies and epitopes. J. Immunol. 2023, 211, 1578–1588. [Google Scholar] [CrossRef]
  30. Launay, G.; Ohue, M.; Santero, J.P.; Matsuzaki, Y.; Hilpert, C.; Uchikoga, N.; Hayashi, T.; Martin, J. Evaluation of CONSRANK-like scoring functions for rescoring ensembles of protein-protein docking poses. Front. Mol. Biosci. 2020, 7, 559005. [Google Scholar] [CrossRef]
  31. Fuhren, J.; Schwalbe, M.; Peralta-Marzal, L.; Rösch, C.; Schols, H.A.; Kleerebezem, M. Phenotypic and genetic characterization of differential galacto-oligosaccharide utilization in Lactobacillus plantarum. Sci. Rep. 2020, 10, 21657. [Google Scholar] [CrossRef]
  32. Bu, Y.S.; Liu, Y.X.; Li, J.X.; Liu, T.J.; Gong, P.M.; Zhang, L.W.; Wang, Y.; Yi, H.X. Analyses of plantaricin Q7 synthesis by Lactobacillus plantarum Q7 based on comparative transcriptomics. Food Control 2021, 124, 107909. [Google Scholar] [CrossRef]
  33. Davey, L.; Halperin, S.A.; Lee, S.F. Mutation of the thiol-disulfide oxidoreductase SdbA activates the CiaRH two-component system, leading to bacteriocin expression shutdown in Streptococcus gordonii. J. Bacteriol. 2016, 198, 321–331. [Google Scholar] [CrossRef] [PubMed]
  34. Schnorpfeil, A.; Kranz, M.; Kovács, M.; Kirsch, C.; Gartmann, J.; Brunner, I.; Bittmann, S.; Brückner, R. Target evaluation of the non-coding csRNAs reveals a link of the two-component regulatory system CiaRH to competence control in Streptococcus pneumoniae R6. Mol. Microbiol. 2013, 89, 334–349. [Google Scholar] [CrossRef] [PubMed]
  35. Heng, N.C.K.; Tagg, J.R.; Tompkins, G.R. Competence-dependent bacteriocin production by Streptococcus gordonii DL1 (challis). J. Bacteriol. 2007, 189, 1468–1472. [Google Scholar] [CrossRef]
  36. Ducros, V.M.A.; Lewis, R.J.; Verma, C.S.; Dodson, E.J.; Leonard, G.; Turkenburg, J.P.; Murshudov, G.N.; Wilkinson, A.J.; Brannigan, J.A. Crystal structure of GerE, the ultimate transcriptional regulator of spore formation in Bacillus subtilis. J. Mol. Biol. 2001, 306, 759–771. [Google Scholar] [CrossRef]
  37. Pristovsek, P.; Sengupta, K.; Löhr, F.; Schafer, B.; von Trebra, M.W.; Rüterjans, H.; Bernhard, F. Structural analysis of the DNA-binding domain of the Erwinia amylovora RcsB protein and its interaction with the RcsAB box. J. Biol. Chem. 2003, 278, 17752–17759. [Google Scholar] [CrossRef]
  38. Zhang, R.G.; Pappas, K.M.; Brace, J.L.; Miller, P.C.; Oulmassov, T.; Molyneaux, J.M.; Anderson, J.C.; Bashkin, J.K.; Winans, S.C.; Joachimiak, A. Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA. Nature 2002, 417, 971–974. [Google Scholar] [CrossRef]
  39. Wang, T.L.; Yang, Y.W.; Zhao, T.C. The LuxR-like regulator LuxR-2460 controls virulence and biofilm formation in Acidovorax citrulli. Acta Phytopathol. Sin. 2016, 46, 328–337. [Google Scholar]
  40. Maris, A.E.; Sawaya, M.R.; Kaczor-Grzeskowiak, M.; Jarvis, M.R.; Bearson, S.M.D.; Kopka, M.L.; Schröder, I.; Gunsalus, R.P.; Dickerson, R.E. Dimerization allows DNA target site recognition by the NarL response regulator. Nat. Struct. Biol. 2002, 9, 771–778. [Google Scholar] [CrossRef]
  41. Liu, W.; Li, Y.; Bai, X.; Wu, H.G.; Bian, L.X.; Hu, X.K. LuxR-type regulator AclR1 of Azorhizobium caulinodans regulates Cyclic di-GMP and numerous phenotypes in free-living and symbiotic states. Mol. Plant Microbe Interact. 2020, 33, 528–538. [Google Scholar] [CrossRef]
  42. Boos, W.; Shuman, H. Maltose/maltodextrin system of Escherichia coli: Transport, metabolism, and regulation. Microbiol. Mol. Biol. Rev. 1998, 62, 204–229. [Google Scholar] [CrossRef] [PubMed]
  43. Suzuki, Y.; Kawada-Matsuo, M.; Le, M.-T.; Eng, S.; Hisatsune, J.; Sugai, M.; Sakaguchi, T.; Komatsuzawa, H. The two-component regulatory systems GraRS and SrrAB mediate Staphylococcus aureus susceptibility to Pep5 produced by clinical isolate of Staphylococcus epidermidis. Appl. Environ. Microbiol. 2024, 90, e0030024. [Google Scholar] [CrossRef] [PubMed]
  44. Nguyen, T.V.A.; Hong, S.H. Whole genome-based phylogenetic analysis of bacterial two-component systems. Biotechnol. Bioprocess Eng. 2008, 13, 288–292. [Google Scholar] [CrossRef]
  45. Chang, C.; Stewart, R.C. The two-component system—Regulation of diverse signaling pathways in prokaryotes and eukaryotes. Plant Physiol. 1998, 117, 723–731. [Google Scholar] [CrossRef]
  46. Itou, H.; Tanaka, I. The OmpR-family of proteins: Insight into the tertiary structure and functions of two-component regulator proteins. Microbes Infect. 2001, 129, 343–350. [Google Scholar] [CrossRef]
  47. Szurmant, H.; Ordal, G.W. Diversity in chemotaxis mechanisms among the bacteria and archaea. Microbiol. Mol. Biol. Rev. 2004, 68, 301–319. [Google Scholar] [CrossRef]
  48. Meng, F.Q.; Lu, F.X.; Du, H.C.; Nie, T.; Zhu, X.Y.; Connerton, I.F.; Zhao, H.Z.; Bie, X.M.; Zhang, C.; Lu, Z.X.; et al. Acetate and auto-inducing peptide are independent triggers of quorum sensing in Lactobacillus plantarum. Mol. Microbiol. 2021, 116, 298–310. [Google Scholar] [CrossRef]
  49. Havarstein, L.S.; Diep, D.B.; Nes, I.F. A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol. Microbiol. 1995, 16, 229–240. [Google Scholar] [CrossRef]
Figure 1. Effects of rrp6 overexpression on the growth of L. plantarum 163 and plantaricin EF production. (a): Growth status; (b): Gram staining; (c): Growth curves; (d): Plantaricin EF production. 163: L. plantarum 163; 163(rrp6): rrp6 gene overexpression in L. plantarum 163. The different lowercase letters indicate significant differences in the same group (p < 0.05). Mean ± SD, n = 3, technical replicates.
Figure 1. Effects of rrp6 overexpression on the growth of L. plantarum 163 and plantaricin EF production. (a): Growth status; (b): Gram staining; (c): Growth curves; (d): Plantaricin EF production. 163: L. plantarum 163; 163(rrp6): rrp6 gene overexpression in L. plantarum 163. The different lowercase letters indicate significant differences in the same group (p < 0.05). Mean ± SD, n = 3, technical replicates.
Microorganisms 13 02780 g001
Figure 2. Effects of rrp6 gene overexpression on the related genes of the pln locus. (a) Transcription levels at 6 h; (b) Transcription levels at 12 h; (c) Transcription levels at 24 h; (d) Transcription levels at 36 h. 163: L. plantarum 163; 163(rrp6): rrp6 gene overexpression in L. plantarum 163. The different lowercase letters indicate significant difference in the same group (p < 0.05). Mean ± SD, n = 6, technical replicates.
Figure 2. Effects of rrp6 gene overexpression on the related genes of the pln locus. (a) Transcription levels at 6 h; (b) Transcription levels at 12 h; (c) Transcription levels at 24 h; (d) Transcription levels at 36 h. 163: L. plantarum 163; 163(rrp6): rrp6 gene overexpression in L. plantarum 163. The different lowercase letters indicate significant difference in the same group (p < 0.05). Mean ± SD, n = 6, technical replicates.
Microorganisms 13 02780 g002
Figure 3. Analysis of EMSA and DNase I Footprinting assays of protein RRP6 and plnG1 promoter. (a): Analysis of EMSA; (b,c): Analysis of DNase I footprinting.
Figure 3. Analysis of EMSA and DNase I Footprinting assays of protein RRP6 and plnG1 promoter. (a): Analysis of EMSA; (b,c): Analysis of DNase I footprinting.
Microorganisms 13 02780 g003
Figure 4. Molecular models of RRP6 protein interaction with site I (a,b) and site II (c,d).
Figure 4. Molecular models of RRP6 protein interaction with site I (a,b) and site II (c,d).
Microorganisms 13 02780 g004
Figure 5. Site-specific mutation of key amino acids and the EMSA of mutant proteins with sites I and II. (a): Selection of mutation sites; (b,c): EMSA of mutant proteins with sites I and II; CK1 and CK2 represent the nucleic acids at site I and site II, respectively.
Figure 5. Site-specific mutation of key amino acids and the EMSA of mutant proteins with sites I and II. (a): Selection of mutation sites; (b,c): EMSA of mutant proteins with sites I and II; CK1 and CK2 represent the nucleic acids at site I and site II, respectively.
Microorganisms 13 02780 g005
Figure 6. Effects of rrp6 gene knockout in L. plantarum 163 on growth and plantaricin EF production. (a): Growth status; (b): Gram staining; (c): Growth curves; (d): Plantaricin EF production. 163: L. plantarum 163; 163(Δrrp6): rrp6 gene knockout in L. plantarum 163. The same lowercase letters indicate that there is no statistically significant difference within the same group (p > 0.05). Mean ± SD, n = 3, technical replicates.
Figure 6. Effects of rrp6 gene knockout in L. plantarum 163 on growth and plantaricin EF production. (a): Growth status; (b): Gram staining; (c): Growth curves; (d): Plantaricin EF production. 163: L. plantarum 163; 163(Δrrp6): rrp6 gene knockout in L. plantarum 163. The same lowercase letters indicate that there is no statistically significant difference within the same group (p > 0.05). Mean ± SD, n = 3, technical replicates.
Microorganisms 13 02780 g006
Figure 7. Effects of rrp6 gene knockout on the related genes of the pln locus. (a) Transcription levels at 6 h; (b) Transcription levels at 12 h; (c) Transcription levels at 24 h; (d) Transcription levels at 36 h. 163: L. plantarum 163; 163(Δrrp6): rrp6 gene knockout in L. plantarum 163. The different lowercase letters indicate significant difference in the same group (p < 0.05). Mean ± SD, n = 6, technical replicates.
Figure 7. Effects of rrp6 gene knockout on the related genes of the pln locus. (a) Transcription levels at 6 h; (b) Transcription levels at 12 h; (c) Transcription levels at 24 h; (d) Transcription levels at 36 h. 163: L. plantarum 163; 163(Δrrp6): rrp6 gene knockout in L. plantarum 163. The different lowercase letters indicate significant difference in the same group (p < 0.05). Mean ± SD, n = 6, technical replicates.
Microorganisms 13 02780 g007
Table 1. Gene function of pln locus in L. plantarum 163 genome.
Table 1. Gene function of pln locus in L. plantarum 163 genome.
Gene NameFunctionGene NameFunction
plnorf3BacteriocinplnEBacteriocin
plnorf5ImmunoproteinplnG1ABC transporter protein
plnorfZ3Unknown functionplnG2ABC transporter protein
plnRUnknown functionplnHABC transporter, accessory factor
plnLImmunoproteinplnSTIntegral membrane protein
plnKBacteriocinplnUIntegral membrane protein
plnASelf-induced peptideplnVIntegral membrane protein
plnBHistidine protein kinaseplnWIntegral membrane protein
plnDResponse regulatorplnXType II toxin-antitoxin system RelE/ParE family toxin
plnIImmunoproteinplnYHigA family addiction module antitoxin
plnFBacteriocin
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Y.; Liu, S.; Li, Z.; Huo, C.; Wang, G.; Zeng, X.; Xin, B.; Zhao, D. LuxR-Type Regulator RRP6 Positively Regulates the Biosynthesis of Plantaricin EF and Improves Its Production in Lactiplantibacillus plantarum 163. Microorganisms 2025, 13, 2780. https://doi.org/10.3390/microorganisms13122780

AMA Style

Liu Y, Liu S, Li Z, Huo C, Wang G, Zeng X, Xin B, Zhao D. LuxR-Type Regulator RRP6 Positively Regulates the Biosynthesis of Plantaricin EF and Improves Its Production in Lactiplantibacillus plantarum 163. Microorganisms. 2025; 13(12):2780. https://doi.org/10.3390/microorganisms13122780

Chicago/Turabian Style

Liu, Yaxuan, Siqi Liu, Zixian Li, Chuangen Huo, Guangli Wang, Xin Zeng, Bingyue Xin, and Deyin Zhao. 2025. "LuxR-Type Regulator RRP6 Positively Regulates the Biosynthesis of Plantaricin EF and Improves Its Production in Lactiplantibacillus plantarum 163" Microorganisms 13, no. 12: 2780. https://doi.org/10.3390/microorganisms13122780

APA Style

Liu, Y., Liu, S., Li, Z., Huo, C., Wang, G., Zeng, X., Xin, B., & Zhao, D. (2025). LuxR-Type Regulator RRP6 Positively Regulates the Biosynthesis of Plantaricin EF and Improves Its Production in Lactiplantibacillus plantarum 163. Microorganisms, 13(12), 2780. https://doi.org/10.3390/microorganisms13122780

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop