Biodegradation of Phenol at High Initial Concentration by Rhodococcus opacus 3D Strain: Biochemical and Genetic Aspects
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Bacterial Strains Used in the Study
2.3. Investigation on the Ability of the Strain R. opacus 3D to Utilize Different Organic Substrates
2.4. Growth of R. opacus 3D Strain in a Liquid Mineral Medium Containing Phenol
2.5. Assay of the Degradation of Phenol by Immobilized R. opacus 3D Cells
2.6. Degradation of Phenol by Immobilized R. opacus 3D Cells After Storage
2.7. Determination of Phenol in the Culture Medium
2.8. Determination of the Specific Activity of Enzymes
2.9. PCR Analysis of Target Genes
2.10. Microscopy
2.10.1. Light Microscopy
2.10.2. Scanning Electron Microscopy
2.11. Statistical Data Processing
3. Results and Discussion
3.1. The Degradation Potential of R. opacus 3D
3.2. Degradation of Phenol by Strain R. opacus 3D
3.3. Degradation of Phenol by Immobilized R. opacus 3D Cells
3.4. Degradation of Phenol by R. opacus 3D Strain After Storage of Immobilized Cells
3.5. Enzymatic Activity in the Bacterial Culture R. opacus 3D Grown in the Presence of Phenol
3.6. PCR Analysis of Rhodococcus opacus 3D Genome
3.7. Morphology of R. opacus 3D Free-Living Cells
3.8. Morphology of Immobilized R. opacus 3D Cells
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sun, J.; Mu, Q.; Kimura, H.; Murugadoss, V.; He, M.; Du, W.; Hou, C. Oxidative degradation of phenols and substituted phenols in the water and atmosphere: A review. Adv. Compos. Hybrid Mater. 2022, 5, 627–640. [Google Scholar] [CrossRef] [Scilit]
- Mohamad Said, K.A.; Ismail, A.F.; Abdul Karim, Z.; Abdullah, M.S.; Hafeez, A. A review of technologies for the phenolic compounds recovery and phenol removal from wastewater. Process Saf. Environ. Prot. 2021, 151, 257–289. [Google Scholar] [CrossRef] [Scilit]
- Saputera, W.H.; Putrie, A.S.; Esmailpour, A.A.; Sasongko, D.; Suendo, V.; Mukti, R.R. Technology Advances in Phenol Removals: Current Progress and Future Perspectives. Catalysts 2021, 11, 998. [Google Scholar] [CrossRef] [Scilit]
- Mohd, A. Presence of phenol in wastewater effluent and its removal: An overview. Int. J. Environ. Anal. Chem. 2022, 102, 1362–1384. [Google Scholar] [CrossRef] [Scilit]
- Villegas, L.G.C.; Mashhadi, N.; Chen, M.; Mukherjee, D.; Taylor, K.E.; Biswas, N. A Short Review of Techniques for Phenol Removal from Wastewater. Curr. Pollut. Rep. 2016, 2, 157–167. [Google Scholar] [CrossRef] [Scilit]
- Mohammadi, S.; Kargari, A.; Sanaeepur, H.; Abbassian, K.; Najafi, A.; Mofarrah, E. Phenol removal from industrial wastewaters: A short review. Desalination Water Treat. 2015, 53, 2215–2234. [Google Scholar] [CrossRef] [Scilit]
- Radha Thirumalaiarasu, S.; Mahalakshmi, G.K. Development of various strategies for the removal of phenol pollutant. In Organic Pollutants. Emerging Contaminants and Associated Treatment Technologies; Vasanthy, M., Sivasankar, V., Sunitha, T.G., Eds.; Springer: Cham, Switzerland, 2022; pp. 177–197. ISBN 978-3-030-72441-2. [Google Scholar]
- Nakhli, S.A.A.; Ahmadizadeh, K.; Fereshtehnejad, M.; Rostami, M.H.; Safari, M.; Borghei, S.M. Biological removal of phenol from saline wastewater using a moving bed biofilm reactor containing acclimated mixed consortia. SpringerPlus 2014, 3, 112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Irankhah, S.; Abdi Ali, A.; Reza Soudi, M.; Gharavi, S.; Ayati, B. Highly efficient phenol degradation in a batch moving bed biofilm reactor: Benefiting from biofilm-enhancing bacteria. World J. Microbiol. Biotechnol. 2018, 34, 164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veeresh, G.S.; Kumar, P.; Mehrotra, I. Treatment of phenol and cresols in upflow anaerobic sludge blanket (UASB) process: A review. Water Res. 2005, 39, 154–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nešvera, J.; Rucká, L.; Pátek, M. Catabolism of phenol and its derivatives in bacteria: Genes, their regulation, and use in the biodegradation of toxic pollutants. Adv. Appl. Microbiol. 2015, 93, 107–160. [Google Scholar] [CrossRef] [Scilit]
- Mulla, S.I.; Bharagava, R.N.; Belhaj, D.; Saratale, G.D.; Kumar, A.; Rajasekar, A.; Tallur, P.N.; Edalli, V.A.; Hu, A.; Yu, C.-P. Microbial degradation of phenolic compounds. In Microbes and Enzymes in Soil Health and Bioremediation. Microorganisms for Sustainability; Kumar, A., Sharma, S., Eds.; Springer: Singapore, 2019; pp. 305–320. [Google Scholar]
- Wang, L.; Li, Y.; Yu, P.; Xie, Z.; Luo, Y.; Lin, Y. Biodegradation of phenol at high concentration by a novel fungal strain Paecilomyces variotii JH6. J. Hazard. Mater. 2010, 183, 366–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y.; Wen, J.; Lan, L.; Hu, Z. Biodegradation of phenol and 4-chlorophenol by the yeast Candida tropicalis. Biodegradation 2007, 18, 719–729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, A.; Sartaj, K.; Arora, N.; Pruthi, V.; Pruthi, P.A. Biodegradation of phenol via meta cleavage pathway triggers de novo TAG biosynthesis pathway in oleaginous yeast. J. Hazard. Mater. 2017, 340, 47–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Acikgoz, E.; Ozcan, B. Phenol biodegradation by halophilic archaea. Int. Biodeterior. Biodegrad. 2016, 107, 140–146. [Google Scholar] [CrossRef] [Scilit]
- Christen, P.; Davidson, S.; Combet-Blanc, Y.; Auria, R. Phenol biodegradation by the thermoacidophilic archaeon Sulfolobus solfataricus 98/2 in a fed-batch bioreactor. Biodegradation 2011, 22, 475–484. [Google Scholar] [CrossRef] [Scilit]
- Zhao, T.; Gao, Y.; Yu, T.; Zhang, Y.; Zhang, Z.; Zhang, L.; Zhang, L. Biodegradation of phenol by a highly tolerant strain Rhodococcus ruber C1: Biochemical characterization and comparative genome analysis. Ecotoxicol. Environ. Saf. 2021, 208, 111709. [Google Scholar] [CrossRef] [Scilit]
- Fernández, M.; Morales, G.M.; Agostini, E.; González, P.S. An approach to study ultrastructural changes and adaptive strategies displayed by Acinetobacter guillouiae SFC 500-1A under simultaneous Cr(VI) and phenol treatment. Environ. Sci. Pollut. Res. 2017, 24, 20390–20400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krastanov, A.; Alexieva, Z.; Yemendzhiev, H. Microbial degradation of phenol and phenolic derivatives. Eng. Life Sci. 2013, 13, 76–87. [Google Scholar] [CrossRef] [Scilit]
- Lee, G.L.Y.; Ahmad, S.A.; Yasid, N.A.; Zulkharnain, A.; Convey, P.; Wan Johari, W.L.; Alias, S.A.; Gonzalez-Rocha, G.; Shukor, M.Y. Biodegradation of phenol by cold-adapted bacteria from Antarctic soils. Polar Biol. 2018, 41, 553–562. [Google Scholar] [CrossRef] [Scilit]
- Zhai, Z.; Wang, H.; Yan, S.; Yao, J. Biodegradation of phenol at high concentration by a novel bacterium: Gulosibacter sp. YZ4. J. Chem. Technol. Biotechnol. 2012, 87, 105–111. [Google Scholar] [CrossRef] [Scilit]
- Fernandez, M.; Paulucci, N.S.; Reynoso, E.; Morales, G.M.; Agostini, E.; González, P.S. Morphological and structural response of Bacillus sp. SFC 500-1E after Cr(VI) and phenol treatment. J. Basic Microbiol. 2020, 60, 679–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohanty, S.S.; Jena, H.M. Biodegradation of phenol by free and immobilized cells of a novel Pseudomonas sp. NBM11. Braz. J. Chem. Eng. 2017, 34, 75–84. [Google Scholar] [CrossRef] [Scilit]
- Harwood, C.S.; Parales, R.E. The β-ketoadipate pathway and the biology of self-identity. Annu. Rev. Microbiol. 1996, 50, 553–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khomenkov, V.G.; Shevelev, A.B.; Zhukov, V.G.; Zagustina, N.A.; Bezborodov, A.M.; Popov, V.O. Organization of metabolic pathways and molecular-genetic mechanisms of xenobiotic degradation in microorganisms: A review. Appl. Biochem. Microbiol. 2008, 44, 117–135. [Google Scholar] [CrossRef] [Scilit]
- Fuchs, G.; Boll, M.; Heider, J. Microbial degradation of aromatic compounds—From one strategy to four. Nat. Rev. Microbiol. 2011, 9, 803–816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J. Stress responses of Acinetobacter strain Y during phenol degradation. Arch. Microbiol. 2017, 199, 365–375. [Google Scholar] [CrossRef] [Scilit]
- Nogina, T.; Fomina, M.; Dumanskaya, T.; Zelena, L.; Khomenko, L.; Mikhalovsky, S.; Podgorskyi, V.; Gadd, G.M. A new Rhodococcus aetherivorans strain isolated from lubricant-contaminated soil as a prospective phenol-biodegrading agent. Appl. Microbiol. Biotechnol. 2020, 104, 3611–3625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paisio, C.E.; Talano, M.A.; González, P.S.; Busto, V.D.; Talou, J.R.; Agostini, E. Isolation and characterization of a Rhodococcus strain with phenol-degrading ability and its potential use for tannery effluent biotreatment. Environ. Sci. Pollut. Res. 2012, 19, 3430–3439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ke, Q.; Zhang, Y.; Wu, X.; Su, X.; Wang, Y.; Lin, H.; Mei, R.; Zhang, Y.; Hashmi, M.Z.; Chen, C.; et al. Sustainable biodegradation of phenol by immobilized Bacillus sp. SAS19 with porous carbonaceous gels as carriers. J. Environ. Manag. 2018, 222, 185–189. [Google Scholar] [CrossRef] [Scilit]
- Asimakoula, S.; Marinakos, O.; Tsagogiannis, E.; Koukkou, A.-I. Phenol degradation by Pseudarthrobacter phenanthrenivorans Sphe3. Microorganisms 2023, 11, 524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basile, L.A.; Erijman, L. Maintenance of phenol hydroxylase genotypes at high diversity in bioreactors exposed to step increases in phenol loading. FEMS Microbiol. Ecol. 2010, 73, 336–348. [Google Scholar] [CrossRef] [Scilit]
- Saleem, H.; Rehman, K.; Arslan, M.; Afzal, M. Enhanced degradation of phenol in floating treatment wetlands by plant-bacterial synergism. Int. J. Phytoremediation 2018, 20, 692–698. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-González, M.; Álvarez-Uribe, H.; Rivera-Solís, R.; González-Burgos, A.; Escalante-Réndiz, D.; Rojas-Herrera, R. Analysis of a phenol-adapted microbial community: Degradation capacity, taxonomy and metabolic description. J. Appl. Microbiol. 2019, 126, 771–779. [Google Scholar] [CrossRef] [Scilit]
- Solyanikova, I.P.; Suzina, N.E.; Emelyanova, E.V.; Polivtseva, V.N.; Pshenichnikova, A.B.; Lobanok, A.G.; Golovleva, L.A. Morphological, physiological, and biochemical characteristics of a benzoate-degrading strain Rhodococcus opacus 1CP under stress conditions. Microbiology 2017, 86, 202–212. [Google Scholar] [CrossRef] [Scilit]
- Krivoruchko, A.; Kuyukina, M.; Ivshina, I. Advanced Rhodococcus Biocatalysts for Environmental Biotechnologies. Catalysts 2019, 9, 236. [Google Scholar] [CrossRef] [Scilit]
- Ivshina, I.B.; Kuyukina, M.S.; Krivoruchko, A.V.; Tyumina, E.A. Responses to ecopollutants and pathogenization risks of saprotrophic Rhodococcus Species. Pathogens 2021, 10, 974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínková, L.; Uhnáková, B.; Pátek, M.; Nešvera, J.; Křen, V. Biodegradation potential of the genus Rhodococcus. Environ. Int. 2009, 35, 162–177. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Choi, K.Y.; Yoo, M.; Zylstra, G.J.; Kim, E. Biotechnological potential of Rhodococcus biodegradative pathways. J. Microbiol. Biotechnol. 2018, 28, 1037–1051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLeod, M.P.; Warren, R.L.; Hsiao, W.W.L.; Araki, N.; Myhre, M.; Fernandes, C.; Miyazawa, D.; Wong, W.; Lillquist, A.L.; Wang, D.; et al. The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse. Proc. Natl. Acad. Sci. USA 2006, 103, 15582–15587. [Google Scholar] [CrossRef] [Scilit]
- Anokhina, T.O.; Esikova, T.Z.; Gafarov, A.B.; Polivtseva, V.N.; Baskunov, B.P.; Solyanikova, I.P. Alternative naphthalene metabolic pathway includes formation of ortho-phthalic acid and cinnamic acid derivatives in the Rhodococcus opacus strain 3D. Biochemistry 2020, 85, 355–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989; p. 1626. [Google Scholar]
- Hegeman, G.D. Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida I. Synthesis of enzymes by the wild type. J. Bacteriol. 1966, 91, 1140–1154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuhm, A.E.; Schlömann, M.; Knackmuss, H.J.; Pieper, D.H. Purification and characterization of dichloromuconate cycloisomerase from Alcaligenes eutrophus JMP 134. Biochem. J. 1990, 266, 877–883. [Google Scholar] [PubMed]
- Fujisawa, H.; Hayaishi, O. Protocatechuate 3,4-Dioxygenase: I. crystallization and characterization. J. Biol. Chem. 1968, 243, 2673–2681. [Google Scholar] [CrossRef] [Scilit]
- Bradford, M. A Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Kulakov, L.A.; Delcroix, V.A.; Larkin, M.J.; Ksenzenko, V.N.; Kulakova, A.N. Cloning of new Rhodococcus extradiol dioxygenase genes and study of their distribution in different Rhodococcus strains. Microbiology 1998, 144, 955–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solyanikova, I.P.; Borzova, O.V.; Emelyanova, E.V.; Shumkova, E.S.; Prisyazhnaya, N.V.; Plotnikova, E.G.; Golovleva, L.A. Dioxygenases of chlorobiphenyl-degrading species Rhodococcus wratislaviensis G10 and chlorophenol-degrading species Rhodococcus opacus 1CP induced in benzoate-grown cells and genes potentially involved in these processes. Biochemistry 2016, 81, 986–998. [Google Scholar] [CrossRef] [Scilit]
- Solyanikova, I.P.; Mulyukin, A.L.; Suzina, N.E.; El-Registan, G.I.; Golovleva, L.A. Improved xenobiotic-degrading activity of Rhodococcus opacus strain 1cp after dormancy. J. Environ. Sci. Health Part B 2011, 46, 638–647. [Google Scholar] [CrossRef] [Scilit]
- Lobakova, E.S.; Vasilieva, S.G.; Dolnikova, G.A.; Kascheeva, P.B.; Dedov, A.G. Study of immobilization of oil-degrading bacteria on polymeric materials of different chemical composition. Mosc. Univ. Biol. Sci. Bull. 2014, 69, 173–179. [Google Scholar] [CrossRef] [Scilit]
- Żur, J.; Wojcieszyńska, D.; Guzik, U. Metabolic responses of bacterial cells to immobilization. Molecules 2016, 21, 958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nandy, S.; Arora, U.; Tarar, P.; Viggor, S.; Jõesaar, M.; Kivisaar, M.; Kapley, A. Monitoring the growth, survival and phenol utilization of the fluorescent-tagged Pseudomonas oleovorans immobilized and free cells. Bioresour. Technol. 2021, 338, 125568. [Google Scholar] [CrossRef] [Scilit]
- Andryushina, V.; Balabanova, T.; Beklemishev, A.; Varfolomeev, S.; Vodyakova, M.; Demakov, V.; Ditchenko, T.; Dzhavahiya, V.; Drozdova, M.; Efremenko, E.; et al. Immobilized Cells: Biocatalysts and Processes; Publishing Center RIOR: Moscow, Russia, 2018; ISBN 978-5-369-02004-3. [Google Scholar]
- Banerjee, A.; Ghoshal, A.K. Phenol degradation performance by isolated Bacillus cereus immobilized in alginate. Int. Biodeterior. Biodegrad. 2011, 65, 1052–1060. [Google Scholar] [CrossRef] [Scilit]
- Hupert-Kocurek, K.; Guzik, U.; Wojcieszyńska, D. Characterization of catechol 2,3-dioxygenase from Planococcus sp. strain S5 induced by high phenol concentration. Acta Biochim. Pol. 2012, 59, 345–351. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.H.; Cho, K.; Yun, S.; Kim, J.Y.; Kwon, K.; Yoo, J.S.; Kim, S. Il Analysis of aromatic catabolic pathways in Pseudomonas putida KT2440 using a combined proteomic approach: 2-DE/MS and cleavable isotope-coded affinity tag analysis. Proteomics 2006, 6, 1301–1318. [Google Scholar] [CrossRef] [Scilit]
- Park, S.-H.; Kim, J.-W.; Yun, S.-H.; Leem, S.H.; Kahng, H.-Y.; Kim, S. Il Characterization of beta-ketoadipate pathway from multi-drug resistance bacterium, Acinetobacter baumannii DU202 by proteomic approach. J. Microbiol. 2006, 44, 632–640. [Google Scholar]
- Patrauchan, M.A.; Florizone, C.; Dosanjh, M.; Mohn, W.W.; Davies, J.; Eltis, L.D. Catabolism of benzoate and phthalate in Rhodococcus sp. strain RHA1: Redundancies and convergence. J. Bacteriol. 2005, 187, 4050–4063. [Google Scholar] [CrossRef] [Scilit]
- Polivtseva, V.N.; Anokhina, T.O.; Iminova, L.R.; Borzova, O.V.; Esikova, T.Z.; Solyanikova, I.P. Evaluation of the biotechnological potential of new bacterial strains capable of phenol degradation. Appl. Biochem. Microbiol. 2020, 56, 298–305. [Google Scholar] [CrossRef] [Scilit]
- Rann, D.L.; Cain, R.B. The regulation of the enzymes of aromatic-ring fission in an actinomycete. Biochem. J. 1969, 114, 77P. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Li, L.; Awasthi, M.K.; Tian, Y.; Lu, M.; Megharaj, M.; Pan, Y.; He, W. Time-course transcriptome analysis reveals the mechanisms of Burkholderia sp. adaptation to high phenol concentrations. Appl. Microbiol. Biotechnol 2020, 104, 5873–5887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ivshina, I.B.; Krivoruchko, A.V.; Kuyukina, M.S.; Peshkur, T.A.; Cunningham, C.J. Adhesion of Rhodococcus bacteria to solid hydrocarbons and enhanced biodegradation of these compounds. Sci. Rep. 2022, 12, 21559. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Putative Gene Function (Gene) | Primer | Primer Sequence (5’–3’) | Annealing Temp (°C) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|---|
| Catechol 2,3-dioxygenase (edoB) | LK33 LK38 | CGCATCGAGGCCACCGAC CGACGGGTCCTCGAACGTGA | 61 | 306 | [48] |
| Catechol 2,3-dioxygenase (edoC) | VD11 VD14 | GGTTACATGGGCTTCGAG CTCCGCCGACTTCTCCAG | 58 | 1096 | -//- |
| Protocatechuate 3,4-dioxygenasde (pcaH) | pcaH_260f pcaH_749r | CAACGCCGACATCGCCAA GAATCCGACGGCCCAGTTGT | 54 | 489 | [49] |
| Catechol 1,2-dioxygenase (catA2, GenBank FM877593.1) | cat4f cat4r | AAATTCAAGGGCGCAAG GAGTTCGGGTTTCGTTG | 52 | 720 | -//- |
| Catechol 1,2-dioxygenase (catA, GenBank X99622.2) | cat6f cat6r | CGACAAGTTCAAGGCCGAG CACGAAGTTGTAGGTGACGTAG | 52 | 780 | -//- |
| Substrate | Growth * |
|---|---|
| Alkanes (nonane, decane, undecane, dodecane, hexadecane) Phenol, benzene, toluene, ethylbenzene Naphthalene, 2-hydroxycinnamic acid, coumarin Phthalate, gentisate | Good growth |
| Alkanes (hexane, heptane, octane) Benzoate, protocatechuate 2-carboxycinnamic acid | Weak growth |
| PAHs (phenanthrene, 2-methylnaphthalene, fluorene, acenaphthene, anthracene) Salicylate Ortho-, meta-, para-xylene Chlorophenols (2-, 3-chlorophenol, 2,3-, 2,4-, 2,5-, 2,6-, dichlorophenol) Chlorobenzoates (2-, 3-, 4-chlorobenzoate, 3,5-dichlorobenzoate) | No growth |
| Enzymes | Substrate | Specific Activity, U/mg of Protein, After Growth with | |
|---|---|---|---|
| Phenol | Succinate 1 | ||
| Cat 1,2-DO | Catechol | 0.115 ± 0.006 | 0.006 ± 0.003 |
| 4-Chlorocatechol | 0.009 ± 0.002 | n.d. | |
| Cat 2,3-DO | Catechol | 0.001 ± 0.000 | 0.002 ± 0.000 |
| MCI | cis,cis-muconate | 0.025 ± 0.007 | < 0.001 |
| PC 3,4-DO | Protocatechuate | 0.385 ± 0.061 | 0.021 ± 0.003 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anokhina, T.O.; Esikova, T.Z.; Polivtseva, V.N.; Suzina, N.E.; Solyanikova, I.P. Biodegradation of Phenol at High Initial Concentration by Rhodococcus opacus 3D Strain: Biochemical and Genetic Aspects. Microorganisms 2025, 13, 205. https://doi.org/10.3390/microorganisms13010205
Anokhina TO, Esikova TZ, Polivtseva VN, Suzina NE, Solyanikova IP. Biodegradation of Phenol at High Initial Concentration by Rhodococcus opacus 3D Strain: Biochemical and Genetic Aspects. Microorganisms. 2025; 13(1):205. https://doi.org/10.3390/microorganisms13010205
Chicago/Turabian StyleAnokhina, Tatiana O., Tatiana Z. Esikova, Valentina N. Polivtseva, Nataliya E. Suzina, and Inna P. Solyanikova. 2025. "Biodegradation of Phenol at High Initial Concentration by Rhodococcus opacus 3D Strain: Biochemical and Genetic Aspects" Microorganisms 13, no. 1: 205. https://doi.org/10.3390/microorganisms13010205
APA StyleAnokhina, T. O., Esikova, T. Z., Polivtseva, V. N., Suzina, N. E., & Solyanikova, I. P. (2025). Biodegradation of Phenol at High Initial Concentration by Rhodococcus opacus 3D Strain: Biochemical and Genetic Aspects. Microorganisms, 13(1), 205. https://doi.org/10.3390/microorganisms13010205

