Next Article in Journal
A Critical Analysis of All-Cause Deaths during COVID-19 Vaccination in an Italian Province
Next Article in Special Issue
Proteus mirabilis from Captive Giant Pandas and Red Pandas Carries Diverse Antimicrobial Resistance Genes and Virulence Genes Associated with Mobile Genetic Elements
Previous Article in Journal
Effect of Probiotic Bacteria on the Gut Microbiome of Mice with Lipopolysaccharide-Induced Inflammation
Previous Article in Special Issue
Characterization of Extended-Spectrum β-Lactamase-Producing Escherichia coli in Animal Farms in Hunan Province, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan

by
Tumurbaatar Khishigtuya
1,
Hiroki Matsuyama
2,
Kazuhito Suzuki
3,
Toru Watanabe
2 and
Masateru Nishiyama
2,*
1
The United Graduate School of Agricultural Sciences, Iwate University, 18-8 Ueda 3-chome, Morioka 020-8550, Iwate, Japan
2
Faculty of Agriculture, Yamagata University, 1-23 Wakaba-machi, Tsuruoka 997-8555, Yamagata, Japan
3
Yamagata Prefecture Livestock Research Institute, 1076 Ipponmatsu, Torigoe, Shinjo 996-0041, Yamagata, Japan
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(7), 1342; https://doi.org/10.3390/microorganisms12071342
Submission received: 29 May 2024 / Revised: 24 June 2024 / Accepted: 29 June 2024 / Published: 30 June 2024
(This article belongs to the Special Issue Antimicrobial Resistance and the Use of Antibiotics in Animals)

Abstract

Antimicrobials are used on livestock farms to treat and prevent infectious animal diseases and to promote the growth of livestock. We monitored the prevalence of antibiotic-resistant Escherichia coli (AR-EC) isolates from beef cattle (BC) and dairy cows (DCs) on a livestock farm in Yamagata, Japan. Fecal samples from 5 male BC and 10 male DCs were collected monthly from October 2022 to November 2023. In total, 152 and 884 E. coli isolates were obtained from the BC and DC fecal samples, respectively. Notably, 26 (17.1%) and 29 (3.3%) E. coli isolates in the BC and DC groups, respectively, were resistant to at least one antibiotic. The resistance rates to tetracycline, ampicillin, gentamicin, and chloramphenicol of the isolates were significantly higher than those to the other antimicrobials. The tetracycline resistance genes tetA (70.6%) in DCs and tetB (28%) in BC were identified, along with the blaTEM gene in ampicillin-resistant isolates (BC: 84.2%, DCs: 42.8%). Despite significant variations in the monthly detection rates of AR-EC isolated from BC and DCs throughout the sampling period, the judicious use of antimicrobials reduced the occurrence of AR-EC in both BC and DCs, thereby minimizing their release into the environment.

1. Introduction

Since the last century, the use of antibiotics has significantly increased life expectancy. However, the overuse and misuse of these antimicrobials have led to the development of antibiotic-resistant bacteria (ARB). ARB are a growing concern for global public health and are recognized by the World Health Organization [1] as one of 21st century’s biggest threats. According to estimates, the annual death toll from ARB was 700,000 worldwide in 2014 and is projected to exceed 10 million by 2050 [2]. By 2050, the mortality rate due to ARB per 10,000 people in Africa and Asia is expected to be approximately twice as high as that in North America, Europe, and Australia [3]. Conditions such as tuberculosis and gonorrhea and bacteria such as Escherichia coli are becoming increasingly resistant to treatment [3].
Inappropriate antibiotic use, both in excessive and in limited quantities, in humans and livestock causes ARB. Globally, more than 60,000 tons of antibiotics are consumed annually by large-scale livestock operations, leading to the evolution of ARB that can be transmitted to humans [3]. Antibiotic use in livestock farming is higher than in humans, making livestock a hotspot for ARB emergence because of the frequent use of antimicrobial agents. The top five antimicrobial consumers in 2020 were China, Brazil, India, the United States of America, and Australia [4]. In Japan, the amount of antibiotics used for livestock, including feed additives, totaled 834.1 tons per year, exceeding the 626.8 tons per year used by humans [5]. Veterinary antimicrobials and feed additives constitute over half of the antimicrobials consumed in livestock production in Japan [5]. Therefore, future studies should consider the use of antibiotics as feed additives for livestock.
Livestock disease management and growth promotion are essential activities on livestock farms; however, they also contribute to the occurrence of ARB. Livestock farms are recognized as significant sources of ARB, which can be transmitted to humans via meat consumption [6]. The appropriate administration and management of antibacterial substances can help suppress the spread of ARB. Using antibiotics only when necessary and at the correct dose can significantly reduce the emergence and spread of ARB [7].
Moreover, ARB can be excreted and discharged into the environment, posing the hazard of AR spreading. Therefore, antibiotics must be used responsibly, and measures must be taken to prevent their spread into the environment [8]. The WHO and the Centers for Disease Control and Prevention (CDC) have published research highlighting the severity of ARB [9]. Antibiotics are critical for treating bacterial infections in humans and animals [10]. However, research on differences in AR prevalence between beef cattle (BC) and dairy cows (DCs) on a single farm throughout the year is lacking.
Therefore, this study aimed to analyze variations in antibiotic-resistant E. coli (AR-EC) in BC and DCs, specifically in the same individuals, continuously throughout the year, in response to different antimicrobial agents.

2. Materials and Methods

2.1. Sampling

Sampling was conducted at the Yamagata Prefecture Livestock Research Institute, located in Shinjo city in a mountain basin in the northeast of Yamagata prefecture in the southwest corner of Tōhoku region, Japan (Appendix A Figure A1). The barns of BC and DCs were separated on the farm, and the number of BC and DCs reared during the study period averaged 10 and 20 heads monthly. Fecal samples were collected monthly from five male BC (aged 8–9 months) and 10 DCs (aged 29–60 months) between October 2022 and November 2023 at the Research Center on Livestock, Yamagata Prefecture Government, Japan. At this farm, DCs are fed grass silage, corn silage, compound feed manufactured in Japan, and imported feed, such as dried grass, hay cubes, and beet pulp. They also receive vitamins and mineral compounds in a tie-stall barn with separate feeding. In contrast, BC are fed rice straw from Japan, compound feed manufactured in Japan, and corn silage. DCs receive feed-grade glycerine and bypass fat supplements, whereas BC do not. During the study period, nine DCs showed symptoms of mastitis, and some antimicrobials were injected for treatment. Information regarding the administration of the antimicrobials is presented in Table 1. None of the BC were treated with antimicrobials. Wild birds and raccoon dogs have been observed on farms; however, no unauthorized entry into cattle barns has been reported. However, there is a possibility of mice entering the barns. No new cattle were introduced to the farm.
Fecal samples (>10–50 g) were collected directly from the BC and DCs by rectal palpation and transported in a cooler box (4–8 °C) to the laboratory on the same day.

2.2. Bacterial Counting, Isolation, and Identification of E.coli

The number of E. coli in the fecal samples from both BC and DCs was determined using the plate dilution method. Specifically, 1 g of each fecal sample was diluted with 9 mL of sterile saline to achieve a 10−5 dilution. Subsequently, 0.1 mL of a 10−1–10−5 dilution was spread on an agar plate (Chromocult Coliform; Sigma Aldrich, Germany). For E. coli screening, the diluted samples were smeared on CHROMagarTM extended-spectrum β-lactamase (ESBL)-producing Enterobacterales, vancomycin-resistant Enterococcus (VRE), and carbapenem-resistant Enterobacterales (CRE) agar plates (Kanto Chemical, Tokyo, Japan). The plates were incubated at 37 °C for 24 h, and the positive colonies on the agar were counted. Colony counts were calculated as the average number of colony-forming units (CFUs) in triplicate. Up to 10 of the presumptively identified blue colonies of E. coli were picked from the Chromocult Coliform and streaked on Luria–Bertani agar (LB, DifcoTM LB Broth, Lennox, USA, agar powder, Fujifilm Wako Pure Chemicals Co., Ltd., Osaka, Japan). After incubation at 37 °C for 24 h, the colonies grown on LB agar were purified by streaking onto the same agar. Purified colonies were isolated in LB broth and stored at −80 °C until further analysis.
DNA of the suspected positive E. coli isolates was extracted using the InstaGene Matrix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer’s protocol. Presumptive E. coli isolates were identified by detecting a specific gene for E. coli (uidA) using a KAPATaq EXtra PCR kit (NIPPON Genetics Co., Ltd., Tokyo, Japan) [11]. The PCR conditions were as follows: three minutes at 95 °C for initial denaturation, 35 cycles of 30 s each at 95 °C for denaturation, 30 s at 58 °C, and one minute at 72 °C for elongation, followed by 10 min at 72 °C for final elongation using a Bio-Rad T100TM Cycler (USA) (Appendix A Table A1). The PCR products (2.5 μL) were mixed with 0.5 μL of 6 × GR Green Loading Buffer (Biocraft, Tokyo, Japan) and confirmed by 1.5% agarose gel electrophoresis using Tris–borate–EDTA buffer (Takara, Shiga, Japan). E. coli NBRC3301 was used as a positive control for PCR analysis.

2.3. Antibiotic Susceptibility Test

Single-well isolated colonies from Luria–Bertani agar were emulsified in 10 mL of sterile saline and adjusted to a McFarland standard 0.5 (bioMérieux SA Ltd., Marcy l’Etoile, France). A sterile cotton swab was dipped in a standardized bacterial suspension and evenly streaked over the entire surface of Mueller–Hinton agar. Impregnated paper discs with a constant concentration of antibiotics were placed on the surface of the agar and incubated at 37 °C for 16–18 h. Subsequently, E. coli isolates were tested for susceptibility to 18 antibiotics (cefotaxime [30 µg], ceftazidime [CAZ, 30 µg], cefpodoxime [10 µg], ampicillin [ABP, 10 µg], cefuroxime [CXM, 30 µg], cefoxitin [10 µg]; imipenem [10 µg], aztreonam [30 µg], amoxicillin and clavulanic acid [20:10 µg), tazobactam/piperacillin (T/P, 100 µg/10 µg], sulfamethoxazole/trimethoprim [ST, 23.75 µg/1.25 µg], gentamicin [GM, 10 µg], amikacin [AMK, 30 µg], ciprofloxacin [5 µg], tetracycline [TC, 30 µg], tigecycline [15 µg], fosfomycin [200 µg], and chloramphenicol [CP, 30 µg]) that were selected based on the Clinical and Laboratory Standards Institute (CLSI) guidelines, using the disc diffusion method of Kirby–Bauer, and their resistances were determined following the standards of the CLSI M100-ED33:2023 [12]. E. coli ATCC 25,922 was included in all antimicrobial susceptibility tests (ASTs) for quality control.
Resistance to ≥3 antibiotic classes was used to classify the bacterial isolates as multidrug-resistant (MDR).

2.4. Detection of Antibiotic Resistance Genes

To characterize the TC- and ABP-resistant E. coli isolates, the tet and bla genes corresponding to the TC and ABP resistance genes were identified using PCR. DNA was extracted from the isolates. The primers used for each targeted antibiotic resistance gene and the PCR amplification program are described in Appendix A Table A1 [13,14,15]. The enzyme KAPATaq Extra was used for PCR amplification of the ARGs. PCR amplification was confirmed by electrophoresis as described above.

2.5. Statistical Analysis

To examine statistical differences in the proportions of AR-EC isolates, we used the Z-test and the correlation coefficient in Excel. Additionally, one-way analysis of variance (ANOVA) and Tukey’s honestly significant difference analyses were performed using SPSS (version 22) statistical software.

3. Results and Discussion

3.1. E. coli Concentrations in Feces

Figure 1 shows the monthly E. coli concentrations in the fecal samples obtained from BC and DCs. According to the WHO, carbapenem- and β-lactam-resistant bacteria and vancomycin-resistant enterococci are classified as serious ARB. None of these three resistant strains (ESBL, CRE, and VRE) were detected on any of the media for AR bacteria, indicating that the farm effectively managed antibiotic usage.
No significant differences were observed in E. coli concentration between BC (3.33 × 103–2.7 × 106 CFU/g) and DCs (1.7 × 102–7.9 × 106 CFU/g). Furthermore, the E. coli concentrations in BC and DCs did not depend on seasonal changes. However, the E. coli concentrations were significantly higher in October and November 2022 and January and July 2023 than in May and August 2023 (Figure 1). This may be associated with lower concentrations of antimicrobial medications or lower quality sanitation facilities in May and August.

3.2. Antibiotic Susceptibility Test

A total of 152 and 884 E. coli isolates, identified by the presence of the uidA gene using PCR, were obtained from fecal samples of BC and DCs, respectively. All isolates harbored the uidA gene and were subsequently identified as E. coli.
All isolates underwent ASTs using 18 antimicrobial agents. Notably, 26 (17.1%) and 29 (3.3%) E. coli isolates from BC and DCs, respectively, exhibited resistance to at least one antibiotic. The highest resistance rates were observed for TC (BC, 16.5%; DCs, 11.2%), ABP (BC, 12.5%; DCs, 4.6%), GM (BC, 11.8%; DCs, 0%), and CP (BC, 9.9%; DCs, 0%), which are commonly used for disease treatment. The resistance rates of the isolates to other antimicrobials were generally low, as follows: AMK (BC, 0%; DCs, 3.3%), ST (BC, 0%; DCs, 2.6%), CIP (BC, 0%; DCs, 2.6%), T/P (BC, 0%; DCs, 1.3%), CXM (BC, 0%; DCs, 0.7%), and CAZ (BC, 0.7%; DCs, 0%). According to reports from other countries, the most frequently observed antimicrobial resistance in E. coli isolates is to tetracycline [16,17]. The resistance rates to TC were 6% lower than those reports, and that to ABP was similar to that reported in the Nippon Antimicrobial Resistance (AMR) One Health Report 2022 [5]. In 2018, Japan’s national drug resistance statistics reported a 26.5% tetracycline resistance rate in healthy cattle on livestock farms [10]. However, studies conducted in Asia, the U.K., and the U.S.A. have revealed much higher resistance rates in dairy cows, ranging from 33.3% to 93% [18,19,20]. These variations in resistance rates can be attributed to factors such as infectious diseases incidents, treatment protocols, and geography. The high rates of tetracycline resistance are linked to its extensive use in both human medicine and animal husbandry. Tetracycline is favored for its affordability and minimal side effects. The correlation coefficient was employed to assess the correlation between time and AR rate. However, no significant correlation was observed between time and AR rates in either animal type. The monthly detection rates of AR-EC isolated from the BC and DCs varied considerably throughout the sampling period (Table 2).
The antibiotic resistance rates of the E. coli isolates were not correlated with head or injection history (Table 1). The antimicrobials and injections used for the DCs were different, except for CXM. The prevalence of AR-EC can be attributed to many factors such as drug administration, feed additives, farm management, farm hygiene, and farm size. The emergence of AR involves the administration of antibiotics and other poorly understood factors [21]. One reason for the prevalence of AR-EC is that farm hygiene problems such as forage and haylage can lead to fecal matter contamination from wild animals [22]. Farm size is crucial for the prevalence of AR-EC. Increasing the number of cattle increases the incidence of AR-EC. Furthermore, farms that buy more cattle have a higher likelihood of detecting ESBL-producing E. coli [23]. The prevalence of antimicrobial resistance among isolates collected from calves is thought to be greater than that among those collected from cows, as calves receive antimicrobial treatment more frequently than lactating dairy cows [24].

3.3. Profiling of AR-EC Multidrug Resistance

Based on their AR patterns, 152 and 884 E. coli isolates from BC and DCs belonged to five and seven different phenotypes, respectively. These ranged from resistance to a single antimicrobial to a combination of four phenotypes (Table 3). The most frequently observed phenotype was ABP-GM-TC, with a prevalence of 11.8% (18 isolates), followed by ABP-GM-TC-CP (9.2%; 14 isolates), TC (3.9%; 6 isolates), ABP-TC-CP (1.3%; 2 isolates), and CAZ (0.7%; 1 isolate) in BC. In 2020, antimicrobial resistance rates exceeding 50% were observed for ABP, streptomycin, and TC in deceased cattle [5]. The most frequently observed phenotype in DCs was TC, with a prevalence of 1.5%, followed by ABP-ST-TC, CIP, and AMK at 0.5% each, and ABP-T/P-AMK, ABP, and T/P at 0.1% each. In general, multidrug AR-EC in BC was higher than that in DCs. This may be because antibiotics are mainly used to treat mastitis on dairy farms; however, ARB in mastitis-causing pathogens are relatively infrequent [25]. The TC resistance rates were almost four times lower than those in the U.S.A. (25%) and five or more times lower than those in other countries (Canada, 31%; Germany 36%; France 52%; Italy 79%), according to data from the National Action Plan on AMR (2023–2027) [26]. Furthermore, MDR strains with resistance to as many as four antibiotics in this study were fewer than those reported in a Japanese report [27], with more than six antibiotics, and in other countries. The U.S.A. reported MDR to more than six antibiotics [28], Canada to five [29], and Korea to six [30]. MDR strains are more frequently found in calves than in growing or mature cattle in various research studies [24,31]. These findings suggest that calves are an optimal source of ARB. This notion is further supported by the negative correlation between the prevalence of resistant E. coli and the age of the source animal [32]. Furthermore, Gow et al. indicated that ARB in calves could be transmitted among cattle, given the similarity in AMR patterns between cows and calves [31]. The low prevalence of MDR strains in the studied farm may be associated with well-managed drug administration.

3.4. Detection of Antibiotic-Resistant Genes

Based on the AST results, 42 isolates were resistant to TC (BC: 16.5%, DCs: 11.2%), and 26 isolates were resistant to ABP (BC: 12.5%, DCs: 4.6%). These numbers were higher than those for the other tested antibiotics. Nine TC resistance-related genes and five ABP resistance-related genes were identified.
Notably, tetC, tetD, tetE, tetG, tetJ, tetM, and tetW were not detected in any of the monthly samples from BC or DCs. However, tetA and tetB, associated with efflux pumps, were detected in 11.7% and 3.4% of the isolates, respectively. Furthermore, tetA (BC: 0% [0/25], DCs: 70.6% [12/17]) was detected in all TC-resistant strains, with a significant difference between the two groups (Table 4). The tetB gene (BC: 28% [7/25], DCs: 0% [0/17]) was detected in all TC-resistant strains, and the result was not statistically different between the two types of animals. The prevalence rates of tetA and tetB reported by Shin et al. were 24.1% lower and 17.1% higher, respectively, in BC compared to those in this study [33]. Furthermore, tetA and tetB were detected in BC in Japanese studies [27]. The high prevalence of TC resistance in E. coli is probably due to the horizontal transfer of tet determinants from E. coli isolates carrying tet genes that survive the selective pressure exerted by TC derivatives [33]. Therefore, understanding the origin and transmission route of E. coli in cattle is crucial to mitigate its prevalence.
Notably, the blaCTX-M-1, blaCTX-M-2, blaCTX-M-8, and blaCTX-M-9 genes were not detected in the monthly samples (Table 5). However, the antibiotic-resistant gene blaTEM was detected in 16.3% of the livestock. Furthermore, blaTEM (BC: 84.2% [16/19], DCs: 42.8% [3/7]) was detected in all ABP-resistant strains, and the result was not significantly different between the two groups. The extended-spectrum β-lactamase (ESBL) genes blaTEM and blaSHV were initially identified in the 1980s and were the most prevalent genes until 2000 [33]. Currently, ESBL production, particularly associated with blaTEM, is considered one of the most significant ARB mechanisms from both clinical and epidemiological perspectives [33]. Previous studies indicated that blaTEM was detected in 78.9% of the isolates from dairy cattle farms in the Nile Delta, Egypt, whereas blaSHV and blaOXA were only detected in 0.87% of the isolates [34]. Notably, bla TEM was detected in dairy cows [35] and remains the most common ARG in China and other countries, regardless of whether the isolates are from dairy cows or BC [36].

4. Conclusions

Our study indicated that the prevalence of AR-EC isolated from BC and DCs at the Yamagata Prefecture Livestock Research Institute was low or similar to that reported in Japan and other countries. This is probably because the surveyed farms were well managed by the prefectural government. Generally, the antimicrobial resistance rates in BC are higher than those in DCs. This difference was attributed to the higher prevalence of antimicrobial resistance among isolates obtained from calves, as calves tend to receive antimicrobial treatments more frequently than lactating dairy cows. The prudent use of antimicrobials contributes to reducing the occurrence of AR-EC in BC and DCs and, consequently, their release into the environment. This study provides fundamental information about ARB and contributes to improving food safety and to promoting the careful use of antimicrobial agents.

Author Contributions

Conceptualization, M.N. and T.W.; methodology, T.K., M.N. and T.W.; software, T.K.; validation, M.N., H.M. and T.W.; formal analysis, T.K. and M.N.; investigation; H.M., K.S. and M.N.; resources, M.N. and T.W.; data curation, T.K. and M.N.; writing—original draft preparation, T.K.; writing—review and editing, M.N.; visualization, T.K.; supervision, M.N.; project administration, M.N. and T.W.; funding acquisition, M.N. and T.W. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Yamagata University Center of Excellence-Multidisciplinary Research (M-R3-3).

Data Availability Statement

The original data presented in the study are included in the article. If you need any further information, you can contact the corresponding author.

Acknowledgments

The authors gratefully acknowledge the cooperation of the study participants and their contributions to various aspects of this work.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Figure A1. Location of the farm.
Figure A1. Location of the farm.
Microorganisms 12 01342 g0a1
Table A1. Primers and amplification programs for the detection of blaCTX-M-1, 2, 8, 9, blaTEM, and tetA, B, C, D, E, G, J, M, and W.
Table A1. Primers and amplification programs for the detection of blaCTX-M-1, 2, 8, 9, blaTEM, and tetA, B, C, D, E, G, J, M, and W.
GenePrimer SequenceProduct Size (bp)ReferenceAmplification Program
uidAFTGGTAATTACCGACGAAAACGGC162[10]Initial denaturation: 95 °C, 3 min
Denaturation: 95 °C, 30 s
Annealing: 58 °C, 30 s
Elongation: 72 °C, 1 min
35 cycles
Final extension: 74 °C, 10 min
RACGCGTGGTTACAGTCTTGCG
blaCTX-M-1FTTAGGAARTGTGCCGCTGYA688[13]Initial denaturation: 94 °C, 10 min
Denaturation: 94 °C, 40 s
Annealing: 60 °C, 40 s
Elongation: 72 °C, 1 min
30 cycles
Final extension: 72 °C, 1 min
RCGATATCGTTGGTGGTRCCAT
blaCTX-M-2FCGTTAACGGCACGATGAC404
RCGATATCGTTGGTGGTRCCAT
blaCTX-M-8FAACRCRCAGACGCTCTAC326
RTCGAGCCGGAASGTGTYAT
blaCTX-M-9FTCAAGCCTGCCGATCTGGT561
RTGATTCTCGCCGCTGAAG
blaTEMFCATTTCCGTGTCGCCCTTATTC800
RCGTTCATCCATAGTTGCCTGAC
tetAFTTGGCATTCTGCATTCACTC494[14]Initial denaturation: 95 °C, 2 min
Denaturation: 96 °C, 30 s
Annealing: 60 °C, 30 s
Elongation: 72 °C, 30 s
30 cycles
Final extension: 72 °C, 10 min
RGTATAGCTTGCCGGAAGTCG
tetBFCAGTGCTGTTGTTGTCATTAA571
RGCTTGGAATACTGAGTGTAA
tetDFGCAAACCATTACGGCATTCT546
RGATAAGCTGCGCGGTAAAAA
tetEFTATTAACGGGCTGGCATTTC544
RAGCTGTCAGGTGGGTCAAAC
tetMFACACGCCAGGACATATGGAT536
RATTTCCGCAAAGTTCAGACG
tetWFGGGAAATTGTTCGGACAGAC549
RAACGGATACCATCCCTGACA
tetCFGCGGGATATCGTCCATTCCG207[15]Initial denaturation: 94 °C, 5 min
Denaturation: 94 °C, 5 s
Annealing: 68 °C, 10 s
25 cycles
Final extension: 68 °C, 7 min
RGCGTAGAGGATCCACAGGACG
tetGFGCAGAGCAGGTCGCTGG134
RCCYGCAAGAGAAGCCAGAAG
tetJFCGAAAACAGACTCGCCAATC184
RTCCATAATGAGGTGGGGC

References

  1. World Health Organization (WHO). Antimicrobial Resistance. 2023. Available online: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance (accessed on 1 May 2024).
  2. O’Neill, J.I.M. Antimicrobial resistance: Tackling a crisis for the health and wealth of nations. Rev. Antimicrob. Resist. 2014. Available online: https://amr-review.org/sites/default/files/AMR%20Review%20Paper%20-%20Tackling%20a%20crisis%20for%20the%20health%20and%20wealth%20of%20 (accessed on 1 May 2024).
  3. Bishop, M. Global disruption of antibiotic-resistant bacteria. Public health post, 2017. Available online: https://www.publichealthpost.org/databyte/antibiotic-resistant-bacteria/ (accessed on 1 May 2024).
  4. Mulchandani, R.; Wang, Y.; Gilbert, M.; Van Boeckel, T.P. Global trends in antimicrobial use in food-producing animals: 2020 to 2030. PLOS Glob. Public Health 2023, 3, e0001305. [Google Scholar] [CrossRef] [PubMed]
  5. Nippon AMR one health report (NAOR 2022) JVARM. 2022. Available online: https://amr-onehealth.ncgm.go.jp/en/ (accessed on 1 May 2024).
  6. Asai, T. Antimicrobial resistance monitoring program in food-producing animals in Japan. J. Vet. Epidemiol. 2008, 12, 93–98. [Google Scholar] [CrossRef]
  7. Fujimoto, K.; Kawasaki, M.; Abe, R.; Yokoyama, T.; Haga, T.; Sugiura, K. Establishing defined daily doses (DDDs) for antimicrobial agents used in pigs, cattle, and poultry in Japan and comparing them with European DDD values. PLoS ONE 2021, 16, e0245105. [Google Scholar] [CrossRef] [PubMed]
  8. Sawant, A.A.; Hegde, N.V.; Straley, B.A.; Donaldson, S.C.; Love, B.C.; Knabel, S.J.; Jayarao, B.M. Antimicrobial-resistant enteric bacteria from dairy cattle. Appl. Environ. Microbiol. 2007, 73, 156–163. [Google Scholar] [CrossRef] [PubMed]
  9. Centers for Disease Control and Prevention (CDC). Antibiotic Resistance Threats in the United States, 2019; U.S. Department of Health and Human Services, CDC: Atlanta, GA, USA, 2019. [Google Scholar]
  10. Suzuki, Y.; Hiroki, H.; Xie, H.; Nishiyama, M.; Sakamoto, S.H.; Uemura, R.; Nukazawa, K.; Ogura, Y.; Watanabe, T.; Kobayashi, I. Antibiotic-resistant Escherichia coli isolated from dairy cows and their surrounding environment on a livestock farm practicing prudent antimicrobial use. Int. J. Hyg. Environ. Health 2022, 240, 113930. [Google Scholar] [CrossRef] [PubMed]
  11. Bej, A.K.; Steffan, R.J.; DiCesare, J.; Haff, L.; Atlas, R.M. Detection of coliform bacteria in water by polymerase chain reaction and gene probes. Appl. Environ. Microbiol. 1990, 56, 307–314. [Google Scholar] [CrossRef] [PubMed]
  12. Clinical Laboratory Standard Institute. Performance Standards for Antimicrobial Susceptibility Testing. 2023, Volume 2023. Available online: http://em100.edaptivedocs.net/ (accessed on 1 May 2024).
  13. Dallenne, C.; Da Costa, A.D.; Decré, D.; Favier, C.; Arlet, G. Development a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed]
  14. Call, D.R.; Bakko, M.K.; Krug, M.J.; Roberts, M.C. Identifying antimicrobial resistance genes with DNA microarrays. Antimicrob. Agents Chemother. 2003, 47, 3290–3295. [Google Scholar] [CrossRef]
  15. Aminov, R.I.; Chee-Sanford, J.C.; Garrigues, N.; Teferedegne, B.; Krapac, I.J.; White, B.A.; Mackie, R.I. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of Gram-negative bacteria. Appl. Environ. Microbiol. 2002, 68, 1786–1793. [Google Scholar] [CrossRef]
  16. Bogaard, A.E.; Stobberingh, E.E. Epidemiology of resistance to antibiotics. Links between animals and humans. Int. J. Antimicrob. Agents 2000, 14, 327–335. [Google Scholar] [CrossRef]
  17. Sayah, R.S.; Kaneene, J.B.; Johnson, Y.; Miller, R. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtaind from domestic- and wild-animal fecal samples, human septage, and surface water. Appl. Environ. Microbiol. 2005, 71, 1394–1404. [Google Scholar] [CrossRef] [PubMed]
  18. Sobur, M.A.; Sabuj, A.A.M.; Sarker, R.; Rahman, A.M.M.T.; Kabir, S.M.L.; Rahman, M.T. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet. World 2019, 12, 984–993. [Google Scholar] [CrossRef] [PubMed]
  19. Cheney, T.E.; Smith, R.P.; Hutchinson, J.P.; Brunton, L.A.; Pritchard, G.; Teale, C.J. Cross-sectional survey of antibiotic resistance in Escherichia coli isolated from diseased farm livestock in England and Wales. Epidemiol. Infect. 2015, 143, 2653–2659. [Google Scholar] [CrossRef] [PubMed]
  20. Hennessey, M.; Whatford, L.; Payne-Gifford, S.; Johnson, K.F.; Van Winden, S.; Barling, D.; Häsler, B. Antimicrobial & antiparasitic use and resistance in British sheep and cattle: A systematic review. Prev. Vet. Med. 2020, 185, 105174. [Google Scholar]
  21. Morris, C.; Wickramasingha, D.; Abdelfattah, E.M.; Pereira, R.V.; Okello, E.; Maier, G. Prevalence of antimicrobial resistance in fecal Escherichia coli and Enterococcus spp. isolates from beef cow-calf operations in northern California and associations with farm practices. Front. Microbiol. 2023, 14, 1086203. [Google Scholar] [CrossRef] [PubMed]
  22. Surette, M.D.; Wright, G.D. Lessons from the environmental antibiotic resistome. Annu. Rev. Microbiol. 2017, 71, 309–329. [Google Scholar] [CrossRef] [PubMed]
  23. Schmid, A.; Hörmansdorfer, S.; Messelhäusser, U.; Käsbohrer, A.; Sauter-Louis, C.; Mansfeld, R. Prevalence of Extended-spectrum-βlactamase-producing Escherichia coli on Bavarian dairy and beef cattle farms. Appl. Environ. Microbiol. 2013, 79, 3027–3032. [Google Scholar] [CrossRef] [PubMed]
  24. Wilson, J.B.; McEwen, S.A.; Clarke, R.C.; Leslie, K.E.; Wilson, R.A.; Waltner-Toews, D.; Gyles, C.L. Distribution and characteristics of verocytotoxigenic Escherichia coli isolated from Ontario dairy cattle. Epidemiol. Infect. 1992, 108, 423–439. [Google Scholar] [CrossRef]
  25. Call, D.R.; Davis, M.A.; Sawant, A.A. Antimicrobial resistance in beef and dairy cattle production. Anim. Health Res. Rev. 2008, 9, 159–167. [Google Scholar] [CrossRef]
  26. National Action Plan on Antimicrobial Resistance (AMR), 2023–2027. 2023. Available online: https://www.mhlw.go.jp/content/10900000/001096228.pdf (accessed on 1 May 2024).
  27. Yamamoto, S.; Iwabuchi, E.; Hasegawa, M.; Esaki, H.; Muramatsu, M.; Hirayama, N.; Hirai, K. Prevalence and molecular epidemiological characterization of antimicrobial-resistant Escherichia coli isolates from Japanese black beef cattle. J. Food Prot. 2013, 76, 394–404. [Google Scholar] [CrossRef]
  28. Wagner, B.A.; Dargatz, D.A.; Salman, M.D.; Morley, P.S.; Wittum, T.E.; Keefe, T.J. Comparison of sampling techniques for measuring the antimicrobial susceptibility of enteric Escherichia coli recovered from feedlot cattle. Am. J. Vet. Res. 2002, 63, 1662–1670. [Google Scholar] [CrossRef] [PubMed]
  29. Carson, C.A.; Reid-Smith, R.; Irwin, R.J.; Martin, W.S.; McEwen, S.A. Antimicrobial resistance in generic fecal Escherichia coli from 29 beef farms in Ontario. Can. J. Vet. Res. 2008, 72, 119–128. [Google Scholar] [PubMed]
  30. Lim, S.K.; Lee, H.S.; Nam, H.M.; Cho, Y.S.; Kim, J.M.; Song, S.W.; Park, Y.H.; Jung, S.C. Antimicrobial resistance observed in Escherichia coli strains isolated from fecal samples of cattle and pigs in Korea during 2003–2004. Int. J. Food Microbiol. 2007, 116, 283–286. [Google Scholar] [CrossRef] [PubMed]
  31. Gow, S.P.; Waldner, C.L.; Rajić, A.; McFall, M.E.; Reid-Smith, R. Prevalence of antimicrobial resistance in fecal generic Escherichia coli isolated in western Canadian beef herds. Part II. Cows and cow-calf pairs. Can. J. Vet. Res. 2008, 72, 91–100. [Google Scholar] [PubMed]
  32. Khachatryan, A.R.; Hancock, D.D.; Besser, T.E.; Call, D.R. Role of calf-adapted Escherichia coli in maintenance of antimicrobial drug resistance in dairy calves. Appl. Environ. Microbiol. 2004, 70, 752–757. [Google Scholar] [CrossRef]
  33. Poirel, L.; Madec, J.Y.; Lupo, A.; Schink, A.K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial resistance in Escherichia coli. Microbiol. Spec. 2018, 6, ARBA-0026. [Google Scholar] [CrossRef]
  34. Braun, S.D.; Ahmed, M.F.E.; El-Adawy, H.; Hotzel, H.; Engelmann, I.; Weiß, D.; Monecke, S.; Ehricht, R. Surveillance of extended-spectrum beta-lactamase producing Escherichia coli in dairy cattle farms in the Nile Delta, Egypt. Front. Microbiol. 2016, 7, 1020. [Google Scholar] [CrossRef]
  35. Ohnishi, M.; Sawada, T.; Harada, K.; Esaki, H.; Shimura, K.; Marumo, K.; Takahashi, T. Occurrence of bovine mastitis caused by CTX-M-2 β-lactamase producing Klebsiella pneumoniae. J. Vet. Epidemol 2012, 16, 142–147. [Google Scholar] [CrossRef]
  36. Yue, S.; Zhang, Z.; Liu, Y.; Zhou, Y.; Wu, C.; Huang, W.; Chen, N.; Zhu, Z. Phenotypic and molecular characterizations of multidrug-resistant diarrheagenic, E. coli of calf origin. Anim. Dis. 2021, 1, 14. [Google Scholar] [CrossRef]
Figure 1. Monthly Escherichia coli concentrations in the feces of (a) dairy cows (DCs) and (b) beef cattle (BC).
Figure 1. Monthly Escherichia coli concentrations in the feces of (a) dairy cows (DCs) and (b) beef cattle (BC).
Microorganisms 12 01342 g001
Table 1. Antibiotic resistance rates (%) of E. coli isolates in individual BC and DC heads.
Table 1. Antibiotic resistance rates (%) of E. coli isolates in individual BC and DC heads.
NameCTXCAZCPXABPCXMCFXIPMAZTACVT/PSTGMAMKCIPTCTGCFOMCPInjection History
B1 (n = 40)00015.0000000015.00025.0007.5-
B2 (n = 21)000000000000000000-
B3 (n = 40)00015.0000000012.50020.00012.5-
B4 (n = 36)000000000000000000-
B5 (n = 15)6.70046.7000000046.70046.70046.7-
D1 (n = 102)0000000000000011.8000C
D2 (n = 94)000000000000000000SE, P
D3 (n = 87)0001.100000000000000SE, PK, P, CXM, C
D4 (n = 101)0000000000001.000000SE, P, CXM
D5 (n = 60)000000000000000000P, C, PK
D6 (n = 86)00000000000002.30000SE, SL, P
D7 (n = 110)000000000000000000SE, P
D8 (n = 78)0006.4000001.35.15.1006.4000-
D9 (n = 106)00000000000001.90000SE, PK, C
D10 (n = 60)0000000001.700000000SE, C
DCs (n = 884)0004.60.700001.32.603.32.611.2000
BC (n = 152)00.7012.50.000000011.80016.5009.9
Abbreviations: CTX, cefotaxime; CAZ, ceftazidime; CPX, cefpodoxime; ABP, ampicillin; CXM, cefuroxime; CFX, cefoxitin; IPM, imipenem; AZT, aztreonam; ACV, amoxicillin and clavulanic acid; T/P, tazobactam/piperacillin; ST, sulfamethoxazole/trimethoprim; GM, gentamicin; AMK, amikacin; CIP, ciprofloxacin; TC, tetracycline; TGC, tigecycline; FOM, fosfomycin; CP, chloramphenicol; SE: cefazolin; PK: kanamycin; P: pirlimycin hydrochloride hydrate; C: cephalonia.
Table 2. Antibiotic-resistance rates (%) of E. coli isolates to the tested antimicrobials.
Table 2. Antibiotic-resistance rates (%) of E. coli isolates to the tested antimicrobials.
NameBCDCs
Oct-22Nov-22Dec-22Jan-23Oct-22Nov-22Dec-22Jan-23Apr-23May-23Jun-23Jul-23Aug-23Sep-23Nov-23
n = 36n = 46n = 40n = 30n = 100n = 100n = 90n = 97n = 81n = 52n = 80n = 80n = 64n = 74n = 66
CTX000000000000000
CAZ02.20000000000000
CPX000000000000000
ABP22.223.900111.100000006.1
CXM000001000000000
CFX000000000000000
IPM000000000000000
AZT000000000000000
ACV000000000000000
T/P0000001.1001.900000
ST000000000000006.1
GM19.423.90000000000000
AMK00001.003.3000001.600
CIP00002.001.1000000.000
TC27.832.60030001.215.4001.606.1
TGC000000000000000
FOM000000000000000
CP8.323.90000000000000
Table 3. Patterns of antimicrobial resistance phenotypes for E. coli strains isolated from BC and DCs in the study, with pattern codes.
Table 3. Patterns of antimicrobial resistance phenotypes for E. coli strains isolated from BC and DCs in the study, with pattern codes.
Antibiogram PatternsNumber of IsolatesPercentage of Resistance (%)
BCTC63.9
(n = 152)CAZ10.7
ABP + GM + TC1811.8
ABP + TC + CP21.3
ABP + GM + TC + CP149.2
DCsTC131.5
(n = 884)CIP40.5
AMK40.5
ABP10.1
T/P10.1
ABP + ST + TC40.5
ABP + T/P + AMK10.1
Table 4. Detection of antibiotic resistance genes by head.
Table 4. Detection of antibiotic resistance genes by head.
NameBCDCs
B1 (n = 6)B3 (n = 6)B5 (n = 7)Total (n = 19)D1 (n = 0)D3 (n = 2)D8 (n = 5)Total (n = 7)
blaCTX-M-100000000
blaCTX-M-200000000
blaCTX-M-800000000
blaCTX-M-900000000
blaTEM5 (83.3%)6 (100%)5 (71.4%)16 (84.2%)003 (60%)3(42.8)
n = 10n = 8n = 7n = 25n = 12n = 0n = 5n = 17
tetA00008 (66.7%)04 (80%)12 (70.6%)
tetB5 (50%)2 (25%) 7 (28%)0000
tetC00000000
tetD00000000
tetE00000000
tetG00000000
tetJ00000000
tetM00000000
tetW00000000
Table 5. Detection of antibiotic resistance genes monthly.
Table 5. Detection of antibiotic resistance genes monthly.
NameBCDCs
Oct-22Nov-22Dec-22Jan-23Oct-22Nov-22Dec-22Jan-23Apr-23May-23Jun-23Jul-23Aug-23Sep-23Nov-23
n = 8n = 11n = 0n = 0n = 1n = 1n = 1n = 0n = 0n = 0n = 0n = 0n = 0n = 0n = 4
blaCTX-M-1000000000000000
blaCTX-M-2000000000000000
blaCTX-M-8000000000000000
blaCTX-M-9000000000000000
blaTEM7 (87.5%)9 (81.8%)0000000000003 (75%)
n = 10n = 15n = 0n = 0n = 3n = 0n = 0n = 0n = 1n = 8n = 0n = 0n = 1n = 0n = 4
tetA0000000008 (100%)00003 (75%)
tetB3 (30%)4 (26.7%)0000000000000
tetC000000000000000
tetD000000000000000
tetE000000000000000
tetG000000000000000
tetJ000000000000000
tetM000000000000000
tetW000000000000000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Khishigtuya, T.; Matsuyama, H.; Suzuki, K.; Watanabe, T.; Nishiyama, M. Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan. Microorganisms 2024, 12, 1342. https://doi.org/10.3390/microorganisms12071342

AMA Style

Khishigtuya T, Matsuyama H, Suzuki K, Watanabe T, Nishiyama M. Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan. Microorganisms. 2024; 12(7):1342. https://doi.org/10.3390/microorganisms12071342

Chicago/Turabian Style

Khishigtuya, Tumurbaatar, Hiroki Matsuyama, Kazuhito Suzuki, Toru Watanabe, and Masateru Nishiyama. 2024. "Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan" Microorganisms 12, no. 7: 1342. https://doi.org/10.3390/microorganisms12071342

APA Style

Khishigtuya, T., Matsuyama, H., Suzuki, K., Watanabe, T., & Nishiyama, M. (2024). Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan. Microorganisms, 12(7), 1342. https://doi.org/10.3390/microorganisms12071342

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop