Designing a Multiplex PCR-xMAP Assay for the Detection and Differentiation of African Horse Sickness Virus, Serotypes 1–9
Abstract
1. Introduction
2. Materials and Methods
2.1. Virus Panel
2.2. In Silico Screen of AHSV Primers and Probes
An assessment of the Weyer et al. [16] forward and reverse primers and probe for an AHSV-6 strain (GenBank reference KT030411.1) revealed one mismatch between the forward primer and annealing site, giving a v2 score of −1 to account for the mismatch; however, as the mismatch is not within 5 bp of the 3′ end, it was assigned a v1 score of 1; hence, the total score (v1 + v2) for the forward AHSV-6 primer would be 0. The reverse primer and the probe were both found to be exact matches to the target annealing sites, so both received a total score (v1 + v2) of 1. Therefore, the overall cumulative score for the Weyer et al. serotype 6 primers/probe against the AHSV strain KT030411.1 GenBank sequence would be 2 (i.e., 0 + 1 + 1).
2.3. Nucleic Acid Extraction
2.4. RT-qPCR
2.5. RT-qPCR Serotype Determination
2.6. Preparation of Microspheres
2.7. Multiplex PCR-xMAP Amplification and Labelling of Template RNA
2.8. xMAP Detection of Serotype Specific Amplicons
3. Results
3.1. In Silico Screening of Primers and Probes
3.2. Multiplex PCR-xMAP Optimisation
- Including the primers in the reaction well when denaturing the double-stranded template RNA at 95 °C prior to addition of mastermix and PCR;
- Utilising a touchdown PCR method to limit non-specific amplification;
- Switching from a single 9-plex assay to performing a two-reaction well (4-plex and 5-plex) assay for the detection of all AHSV serotypes;
- Employing an asymmetric concentration of PCR forward and reverse primers for detection of AHSV-1, -3, -5, -6, -8, and -9 (this biases the amplification towards an increased yield of biotinylated amplicon but did not improve detection of AHSV-2, -4, or -7);
- Removal of 1.5× TMAC following the hybridisation of microsphere and amplicon, prior to the addition of SAPE. This method, described in Angeloni et al., 2018, titled “direct DNA hybridisation washed protocol”, was found to perform better than the “direct DNA hybridisation: no wash protocol” from the same publication [30];
- Conducting the microsphere-amplicon hybridisation and the amplicon-SAPE labelling step at 50 °C, which performed better than other higher temperatures that were also tested.
3.3. Detection of AHSV Reference Strains Using the Multiplex PCR-xMAP Assay
3.4. Limit of Detection (LOD)
3.5. Diagnostic Sensitivity and Specificity of Multiplex PCR-xMAP Assay
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carpenter, S.; Mellor, P.S.; Fall, A.G.; Garros, C.; Venter, G.J. African Horse Sickness Virus: History, Transmission, and Current Status. Annu. Rev. Entomol. 2017, 62, 343–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grewar, J.D.; Weyer, C.T.; Guthrie, A.J.; Koen, P.; Davey, S.; Quan, M.; Visser, D.; Russouw, E.; Bührmann, G. The 2011 Outbreak of African Horse Sickness in the African Horse Sickness Controlled Area in South Africa. J. S. Afr. Vet. Assoc. 2013, 84, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Toh, X.; Wang, Y.; Rajapakse, M.P.; Lee, B.; Songkasupa, T.; Suwankitwat, N.; Kamlangdee, A.; Judith Fernandez, C.; Huangfu, T. Use of Nanopore Sequencing to Characterize African Horse Sickness Virus (AHSV) from the African Horse Sickness Outbreak in Thailand in 2020. Transbound. Emerg. Dis. 2022, 69, 1010–1019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baylis, M.; El Hasnaoui, H.; Bouayoune, H.; Touti, J.; Mellor, P.S. The Spatial and Seasonal Distribution of African Horse Sickness and Its Potential Culicoides Vectors in Morocco. Med. Vet. Entomol. 1997, 11, 203–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez, M.; Hooghuis, H.; Casta, M. African Horse Sickness in Spain. Vet. Microbiol. 1992, 33, 129–142. [Google Scholar] [CrossRef] [Scilit]
- King, S.; Rajko-Nenow, P.; Ashby, M.; Frost, L.; Carpenter, S.; Batten, C. Outbreak of African Horse Sickness in Thailand, 2020. Transbound. Emerg. Dis. 2020, 67, 1764–1767. [Google Scholar] [CrossRef] [Scilit]
- Kundlacz, C.; Sailleau, C.; Viarouge, C.; Postic, L.; Vitour, D.; Breard, E. Bluetongue Virus in France: An Illustration of the European and Mediterranean Context since the 2000s. Viruses 2019, 11, 672. [Google Scholar] [CrossRef] [Scilit]
- Voigt, A.; Kampen, H.; Heuser, E.; Zeiske, S.; Hoffmann, B.; Hoper, D.; Holster, M.; Sik, F.; Ziegler, S.; Wernike, K.; et al. Emergence of Bluetongue Virus Serotype 3 in Western Germany, October 2023, and Ad- Hoc Monitoring in Culicoides Biting Midges. BioRxiv, 2024; preprint.
- Portanti, O.; Breard, E.; Sailleu, C.; Ancora, M.; Sabatino, D.D.; Morelli, D.; Calistri, P.; Savini, G. Epizootic Hemorrhagic Disease Virus Serotype 8, Italy, 2022. Emerg. Infect. Dis. Infect. Dis. 2023, 29, 1063–1065. [Google Scholar]
- Baylis, M.; Caminade, C.; Turner, J.; Jones, A.E. The Role of Climate Change in a Developing Threat: The Case of Bluetongue in Europe. Rev. Sci. Tech. 2017, 36, 467–478. [Google Scholar] [CrossRef] [Scilit]
- Purse, B.V.; Brown, H.E.; Harrup, L.; Mertens, P.P.C.; Rogers, D.J. Invasion of Bluetongue and Other Orbivirus Infections into Europe: The Role of Biological and Climatic Processes. OIE Rev. Sci. Tech. 2008, 27, 427–442. [Google Scholar] [CrossRef] [Scilit]
- Manole, V.; Laurinmäki, P.; Van Wyngaardt, W.; Potgieter, C.A.; Wright, I.M.; Venter, G.J.; van Dijk, A.A.; Sewell, B.T.; Butcher, S.J. Structural Insight into African Horsesickness Virus Infection. J. Virol. 2012, 86, 7858–7866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dennis, S.J.; Meyers, A.E.; Hitzeroth, I.I.; Rybicki, E.P. African Horse Sickness: A Review of Current Understanding and Vaccine Development. Viruses 2019, 11, 844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- WOAH. African Horse Sickness (Infection with African Horse Sickness Virus). In Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Twelfth Edition 2023; WOAH: Paris, France, 2023; pp. 1–17. [Google Scholar]
- Bachanek-Bankowska, K.; Maan, S.; Castillo-Olivares, J.; Manning, N.M.; Maan, N.S.; Potgieter, A.C.; Di Nardo, A.; Sutton, G.; Batten, C.; Mertens, P.P.C. Real Time RT-PCR Assays for Detection and Typing of African Horse Sickness Virus. PLoS ONE 2014, 9, e0093758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weyer, C.T.; Joone, C.; Lourens, C.W.; Monyai, M.S.; Koekemoer, O.; Grewar, J.D.; van Schalkwyk, A.; Majiwa, P.O.A.; MacLachlan, N.J.; Guthrie, A.J. Development of Three Triplex Real-Time Reverse Transcription PCR Assays for the Qualitative Molecular Typing of the Nine Serotypes of African Horse Sickness Virus. J. Virol. Methods 2015, 223, 69–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maan, N.S.; Maan, S.; Nomikou, K.; Belaganahalli, M.N.; Bachanek-Bankowska, K.; Mertens, P.P.C. Serotype Specific Primers and Gel-Based Rt-Pcr Assays for “typing” African Horse Sickness Virus: Identification of Strains from Africa. PLoS ONE 2011, 6, e0025686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sailleau, C.; Hamblin, C.; Paweska, J.T.; Zientara, S. Identification and Differentiation of the Nine African Horse Sickness Virus Serotypes by RT-PCR Amplification of the Serotype-Specific Genome Segment 2. J. Gen. Virol. 2000, 81, 831–837. [Google Scholar] [CrossRef] [Scilit]
- van Schalkwyk, A.; Ferreira, M.L.; Romito, M. Using a New Serotype-Specific Polymerase Chain Reaction (PCR) and Sequencing to Differentiate between Field and Vaccine-Derived African Horse Sickness Viruses Submitted in 2016/2017. J. Virol. Methods 2019, 266, 89–94. [Google Scholar] [CrossRef] [Scilit]
- Villalba, R.; Tena-Tomas, C.; Jose Ruano, M.; Valero-Lorenzo, M.; Lopez-Herranz, A.; Cano-Gomez, C.; Aguero, M. Development and Validation of Three Triplex Real-Time RT-PCR Disease Control and Other Laboratory Applications. Viruses 2024, 16, 470. [Google Scholar] [CrossRef] [Scilit]
- Durán-Ferrer, M.; Villalba, R.; Fernández-Pacheco, P.; Tena-Tomás, C.; Jiménez-Clavero, M.Á.; Bouzada, J.A.; Ruano, M.J.; Fernández-Pinero, J.; Arias, M.; Castillo-Olivares, J.; et al. Clinical, Virological and Immunological Responses after Experimental Infection with African Horse Sickness Virus Serotype 9 in Immunologically Naïve and Vaccinated Horses. Viruses 2022, 14, 1545. [Google Scholar] [CrossRef] [Scilit]
- Ndiaye, M.D.B.; Ranaivomanana, P.; Rasoloharimanana, L.T.; Rasolofo, V.; Ratovoson, R.; Herindrainy, P.; Rakotonirina, J.; Schoenhals, M.; Hoffmann, J.; Rakotosamimanana, N. Plasma Host Protein Signatures Correlating with Mycobacterium Tuberculosis Activity Prior to and during Antituberculosis Treatment. Sci. Rep. 2022, 12, 20640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iriemenam, N.C.; Ige, F.A.; Greby, S.M.; Mpamugo, A.; Abubakar, A.G.; Dawurung, A.B.; Esiekpe, M.K.; Thomas, A.N.; Okoli, M.U.; Awala, S.S.; et al. Validation of XMAP SARS-CoV-2 Multi-Antigen IgG Assay in Nigeria. PLoS ONE 2022, 17, e0266184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caboré, R.N.; Piérard, D.; Huygen, K. A Belgian Serosurveillance/Seroprevalence Study of Diphtheria, Tetanus and Pertussis Using a Luminex XMAP Technology-Based Pentaplex. Vaccines 2016, 4, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landlinger, C.; Preuner, S.; Willinger, B.; Haberpursch, B.; Racil, Z.; Mayer, J.; Lion, T. Species-Specific Identification of a Wide Range of Clinically Relevant Fungal Pathogens by Use of Luminex Xmap Technology. J. Clin. Microbiol. 2009, 47, 1063–1073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glushakova, L.G.; Bradley, A.; Bradley, K.M.; Alto, B.W.; Hoshika, S.; Hutter, D.; Sharma, N.; Yang, Z.; Kim, M.J.; Benner, S.A. High-Throughput Multiplexed XMAP Luminex Array Panel for Detection of Twenty Two Medically Important Mosquito-Borne Arboviruses Based on Innovations in Synthetic Biology. J. Virol. Methods 2015, 214, 60–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanneste, K.; Garlant, L.; Broeders, S.; Van Gucht, S.; Roosens, N.H. Application of Whole Genome Data for in Silico Evaluation of Primers and Probes Routinely Employed for the Detection of Viral Species by RT-QPCR Using Dengue Virus as a Case Study. BMC Bioinform. 2018, 19, 312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vallone, P.M.; Butler, J.M. AutoDimer: A Screening Tool for Primer-Dimer and Hairpin Structures. Biotechniques 2004, 37, 226–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agüero, M.; Gómez-Tejedor, C.; Cubillo, M.Á.; Rubio, C.; Romero, E.; Jiménez-Clavero, M.A. Real-Time Fluorogenic Reverse Transcription Polymerase Chain Reaction Assay for Detection of African Horse Sickness Virus. J. Vet. Diagn. Investig. 2008, 20, 325–328. [Google Scholar] [CrossRef] [Scilit]
- Angeloni, S.; Das, S.; Dunbar, S.; Stone, V. XMAP Cookbook; Luminex: Austin, TX, USA, 2018. [Google Scholar]
- Nomikou, K.; Hughes, J.; Wash, R.; Kellam, P.; Breard, E.; Zientara, S.; Palmarini, M.; Biek, R.; Mertens, P. Widespread Reassortment Shapes the Evolution and Epidemiology of Bluetongue Virus Following European Invasion. PLoS Pathog. 2015, 11, e1005056. [Google Scholar] [CrossRef] [Scilit]
- Vijaykrishna, D.; Mukerji, R.; Smith, G.J.D. RNA Virus Reassortment: An Evolutionary Mechanism for Host Jumps and Immune Evasion. PLoS Pathog. 2015, 11, e1004902. [Google Scholar] [CrossRef] [Scilit]
- Ren, N.; Wang, X.; Liang, M.; Tian, S.; Ochieng, C.; Zhao, L.; Huang, D.; Xia, Q.; Yuan, Z.; Xia, H. Characterization of a Novel Reassortment Tibet Orbivirus Isolated from Culicoides Spp. In Yunnan, PR China. J. Gen. Virol. 2021, 102, 001645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashby, M.; Rajko-nenow, P.; Batten, C.; Flannery, J. Simultaneous Detection of Bluetongue Virus Serotypes Using Xmap Technology. Microorganisms 2020, 8, 1564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, L.; Wang, Y.; Kang, R.; Wu, X.; Lin, H.; Ye, Y.; Yu, J.; Ye, J.; Xie, J.; Cao, Y.; et al. Development and Application of a Novel Bio–Plex Suspension Array System for High–Throughput Multiplexed Nucleic Acid Detection of Seven Respiratory and Reproductive Pathogens in Swine. J. Virol. Methods 2018, 261, 104–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Kibiki, G.; Maro, V.; Maro, A.; Kumburu, H.; Swai, N.; Taniuchi, M.; Gratz, J.; Toney, D.; Kang, G.; et al. Multiplex Reverse Transcription PCR Luminex Assay for Detection and Quantitation of Viral Agents of Gastroenteritis. J. Clin. Virol. 2015, 61, 515–525. [Google Scholar] [CrossRef] [Scilit]
- Hindson, B.J.; Reid, S.M.; Baker, B.R.; Ebert, K.; Ferris, N.P.; Bentley Tammero, L.F.; Lenhoff, R.J.; Naraghi-Arani, P.; Vitalis, E.A.; Slezak, T.R.; et al. Diagnostic Evaluation of Multiplexed Reverse Transcription-PCR Microsphere Array Assay for Detection of Foot-and-Mouth and Look-Alike Disease Viruses. J. Clin. Microbiol. 2008, 46, 1081–1089. [Google Scholar] [CrossRef] [Scilit]


| AHSV Serotype | Primer | Primer Sequence (5′-3′) | Final Primer Concentration in Mastermix (µM) | Capture Probe Sequence (5′-3′) 1 | Source | |
|---|---|---|---|---|---|---|
| Multiplex reaction A | 1 | Forward | TGAACATAAACAAACRGTGAGTGA | 0.1 | CAGTTGAAAAAGAAACAAG | Weyer et al., 2015 [16] # |
| Reverse | Btn-GGTTAGAGGYGCTCGRTTCT | 0.4 | ||||
| 3 | Forward | TAGAAAGAATGATGAGCAGTG | 0.2 | CCGTTATTGAGAGCGTCATAAGATTC | Bachanek-Bankowska et al., 2014 [15] | |
| Reverse | Btn-TAATGGAATGTCGCCTGTCTT | 0.8 | ||||
| 5 | Forward | GAGACACATCAAGGTTAARGG | 0.4 | TTGAAGCAAGGRATCTATTRACTTT | Bachanek-Bankowska et al., 2014 [15] # | |
| Reverse | Btn-CAGGATCAAACTGTGTATACTT | 1.6 | ||||
| 7 | Forward | TGGATCGAGCATAAGAAGAAG | 0.2 | ACCAAAATCGTCCGATGCTAGTGC | Bachanek-Bankowska et al., 2014 [15] | |
| Reverse | Btn-CCAATCAACCCARTGTGTAAC | 0.2 | ||||
| Multiplex reaction B | 2 | Forward | Btn-AGTGGACTTCGATYATAGATG | 0.1 | TTCAACCGTCTCTCCGCCTCTC | Bachanek-Bankowska et al., 2014 [15] # |
| Reverse | CTGTCTGAGCGTTAACCTC | 0.1 | ||||
| 4 | Forward | CATATAAAGGAGGTAACCGARAAAYTG | 0.8 | AGAAAGCGCAAACCG | Weyer et al., 2015 [16] # | |
| Reverse | Btn-GGCATGGTTGTCCTCCATTT | 0.8 | ||||
| 6 | Forward | TTAATCCGAAYCACCARACG | 0.2 | TGATCARATGAATCGTGCGC | Weyer et al., 2015 [16] # | |
| Reverse | Btn-GAGGTTTATTAYTGTTGCCTTGC | 0.8 | ||||
| 8 | Forward | ACGGCGARAAYTGGAAAAAA | 0.2 | ATAAGGCGGAAGTCC | Weyer et al., 2015 [16] # | |
| Reverse | Btn-TGCGCTTCATTCAAACGTTYT | 0.8 | ||||
| 9 | Forward | Btn-TATCATATTGGTATCGAGTTCG | 0.8 | ACAYCCTCAATCGAYCTCCTCTC | Bachanek-Bankowska et al., 2014 [15] # | |
| Reverse | AAGTTGATGCGTGAATACCGA | 0.2 |
| Number of Cycles | Temperature (°C) | Time |
|---|---|---|
| 1 | 50 | 15 min |
| 95 | 20 s | |
| 10 | 95 | 3 s |
| 65–55 (reducing by one degree per cycle) | 30 s | |
| 72 | 30 s | |
| 35 | 95 | 3 s |
| 55 | 30 s | |
| 72 | 30 s |
| AHSV Serotype | Number of Strains Included in Screen | In Silico Score Weyer et al. [16] | In Silico Score Bachanek-Bankowska et al. [15] | In Silico Score Modified |
|---|---|---|---|---|
| 1 | 68 | 2.62 | 1.95 | 2.95 W |
| 2 | 16 | 2.12 | 2.81 | 3.00 B |
| 3 | 17 | 1.05 | 3.00 | N/A |
| 4 | 28 | −2.14 | 2.11 | 2.29 W |
| 5 | 15 | −3.25 | 0.66 | 3.00 B |
| 6 | 20 | 1.15 | 0.30 | 2.32 W |
| 7 | 17 | 0.71 | 2.76 | N/A |
| 8 | 23 | 1.74 | 2.59 | 2.88 w |
| 9 | 30 | −0.15 | 2.55 | 2.91 B |
| AHSV Multiplex A | AHSV Multiplex B | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| AHSV Serotype | Dilution | RT-qPCR CT | Copies/µL | PCR-xMAP MFI | AHSV Serotype | Dilution | RT-qPCR CT | Copies/µL | PCR-xMAP MFI |
| AHSV-1 | Neat | 24.52 | 1.81 × 104 | 5019 | AHSV-2 | Neat | 23.27 | 4.16 × 104 | 4312 |
| 10−1 | 28.29 | 1.56 × 103 | 1971 | 10−1 | 26.96 | 3.73 × 103 | 3043 | ||
| 10−2 | 31.88 | 2.77 × 102 | 399 | 10−2 | 31.18 | 3.58 × 102 | 1934 | ||
| 10−3 | 34.73 | 2.30 × 101 | ND | 10−3 | 33.49 | 5.00 × 101 | 796 | ||
| 10−4 | 38.26 | 2 | ND | 10−4 | 36.82 | 5 | ND | ||
| AHSV-3 | Neat | 22.76 | 5.73 × 104 | 3339 | AHSV-4 | Neat | 22.68 | 4.56 × 104 | 2216 |
| 10−1 | 26.63 | 4.53 × 103 | 3496 | 10−1 | 25.96 | 5.39 × 103 | 1310 | ||
| 10−2 | 29.92 | 5.25 × 102 | 2613 | 10−2 | 28.85 | 7.86 × 102 | 829 | ||
| 10−3 | 33.65 | 4.50 × 101 | 1292 | 10−3 | 32.43 | 7.90 × 101 | 331 | ||
| 10−4 | 38.25 | 3 | 483 | 10−4 | 36.88 | 5 | ND | ||
| AHSV-5 | Neat | 22.29 | 5.79 × 104 | 2349 | AHSV-6 | Neat | 22.20 | 6.11 × 104 | 6516 |
| 10−1 | 25.69 | 6.22 × 103 | 1936 | 10−1 | 26.39 | 3.94 × 103 | 5542 | ||
| 10−2 | 29.08 | 6.76 × 102 | 1913 | 10−2 | 29.90 | 4.03 × 102 | 4389 | ||
| 10−3 | 32.27 | 8.40 × 101 | 571 | 10−3 | 33.07 | 4.90 × 101 | 2174 | ||
| 10−4 | 37.50 | 4 | ND | 10−4 | 36.64 | 5 | 521 | ||
| AHSV-7 | Neat | 22.47 | 5.53 × 104 | 4358 | AHSV-8 | Neat | 24.26 | 1.70 × 104 | 1618 |
| 10−1 | 27.05 | 2.72 × 103 | 3195 | 10−1 | 28.3 | 1.18 × 103 | 1293 | ||
| 10−2 | 30.21 | 3.36 × 102 | 1549 | 10−2 | 31.5 | 1.38 × 102 | 878 | ||
| 10−3 | 33.95 | 2.90 × 101 | 540 | 10−3 | 34.9 | 1.50 × 101 | 220 | ||
| 10−4 | 38.39 | 3 | ND | 10−4 | 38.4 | 1 | ND | ||
| AHSV-9 | Neat | 24.23 | 1.74 × 104 | 4227 | |||||
| 10−1 | 27.43 | 1.61 × 103 | 4665 | ||||||
| 10−2 | 31.49 | 1.46 × 102 | 3626 | ||||||
| 10−3 | 35.37 | 1.10 × 101 | 1953 | ||||||
| 10−4 | 38.74 | 1 | 320 | ||||||
| Total tested | 87 | ||
| True positive 1 | 59 | False positive | 0 |
| False negative 1 | 8 | True negative | 20 |
| Positive samples correctly serotyped 2 | 59/59 | ||
| Serotypes identified | AHSV-1, -2, -4, -5, -6, and -9 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ashby, M.; Moore, R.; King, S.; Newbrook, K.; Flannery, J.; Batten, C. Designing a Multiplex PCR-xMAP Assay for the Detection and Differentiation of African Horse Sickness Virus, Serotypes 1–9. Microorganisms 2024, 12, 932. https://doi.org/10.3390/microorganisms12050932
Ashby M, Moore R, King S, Newbrook K, Flannery J, Batten C. Designing a Multiplex PCR-xMAP Assay for the Detection and Differentiation of African Horse Sickness Virus, Serotypes 1–9. Microorganisms. 2024; 12(5):932. https://doi.org/10.3390/microorganisms12050932
Chicago/Turabian StyleAshby, Martin, Rebecca Moore, Simon King, Kerry Newbrook, John Flannery, and Carrie Batten. 2024. "Designing a Multiplex PCR-xMAP Assay for the Detection and Differentiation of African Horse Sickness Virus, Serotypes 1–9" Microorganisms 12, no. 5: 932. https://doi.org/10.3390/microorganisms12050932
APA StyleAshby, M., Moore, R., King, S., Newbrook, K., Flannery, J., & Batten, C. (2024). Designing a Multiplex PCR-xMAP Assay for the Detection and Differentiation of African Horse Sickness Virus, Serotypes 1–9. Microorganisms, 12(5), 932. https://doi.org/10.3390/microorganisms12050932

