A One-Pot Convenient RPA-CRISPR-Based Assay for Salmonella enterica Serovar Indiana Detection
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Instruments
2.2. Sample Preparation
2.3. The Principle and Workflow of the RPA-CRISPR/Cas12b Detection System for S. Indiana
2.4. The Design and Selection of RPA Primers for the S. Indiana RPA-CRISPR/Cas12b Assay
2.5. RPA Primer and sgRNA
2.6. RPA-CRISPR Cas12b Detection System
2.7. Sensitivity and Specificity Analysis
2.8. Real Sample Testing
3. Results
3.1. The Design and Selection of sgRNA for the S. Indiana RPA-CRISPR/Cas12b Assay
3.2. Identification of the Optimal Concentrations of Cas12b and sgRNA for the S. Indiana RPA-CRISPR/Cas12b Assay
3.3. Identification of the Optimal Temperature for the S. Indiana RPA-CRISPR/Cas12b Assay
3.4. Identification of the Optimal ssDNA Reporter for the S. Indiana RPA-CRISPR/Cas12b Assay
3.5. Specificity and Sensitivity of the S. Indiana RPA-CRISPR/Cas12b Assay
3.6. Application of the S. Indiana One-Step RPA-CRISPR/Cas12b Assay to Real Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fong, W.Y.; Canals, R.; Predeus, A.V.; Perez-Sepulveda, B.; Wenner, N.; Lacharme-Lora, L.; Feasey, N.; Wigley, P.; Hinton, J.C.D. Genome-wide fitness analysis identifies genes required for in vitro growth and macrophage infection by African and global epidemic pathovariants of Salmonella enterica Enteritidis. Microb. Genom. 2023, 9, mgen001017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Wang, T.; Guo, M.; Zhang, C.; Bo, Z.; Wu, Y.; Chao, G. The large plasmid carried class 1 integrons mediated multidrug resistance of foodborne Salmonella Indiana. Front. Microbiol. 2022, 13, 991326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiang, X.; Shang, Y.; Ye, Q.; Li, F.; Zhang, J.; Zhou, B.; Suo, H.; Chen, M.; Gu, Q.; Ding, Y. A Salmonella serogroup rapid identification system for food safety based on high throughput microfluidic chip combined with recombinase aided amplification. Sens. Actuators B Chem. 2022, 357, 131402. [Google Scholar] [CrossRef] [Scilit]
- Price, J., Jr.; Carter, H.R., Jr. An outbreak of gastroenteritis caused by Salmonella indiana. Public Health Rep. (1896) 1967, 82, 551–554. [Google Scholar]
- Gong, J.; Kelly, P.; Wang, C. Prevalence and Antimicrobial Resistance of Salmonella enterica Serovar Indiana in China (1984–2016). Zoonoses Public Health 2017, 64, 239–251. [Google Scholar] [CrossRef] [Scilit]
- Bai, L.; Lan, R.; Zhang, X.; Cui, S.; Xu, J.; Guo, Y.; Li, F.; Zhang, D. Prevalence of Salmonella Isolates from Chicken and Pig Slaughterhouses and Emergence of Ciprofloxacin and Cefotaxime Co-Resistant S. enterica Serovar Indiana in Henan, China. PLoS ONE 2015, 10, e0144532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chao, G.; Wang, C.; Wu, T.; Zhang, X.; Chen, J.; Qi, X.; Cao, Y.; Wu, Y.; Jiao, X. Molecular epidemiology and antibiotic resistance phenotypes and genotypes of salmonellae from food supply chains in China. Food Control 2017, 77, 32–40. [Google Scholar] [CrossRef] [Scilit]
- Mei, C.Y.; Jiang, Y.; Ma, Q.C.; Lu, M.J.; Wu, H.; Wang, Z.Y.; Jiao, X.; Wang, J. Chromosomally and Plasmid-Located mcr in Salmonella from Animals and Food Products in China. Microbiol. Spectr. 2022, 10, e0277322. [Google Scholar] [CrossRef] [Scilit]
- Du, P.; Liu, X.; Liu, Y.; Li, R.; Lu, X.; Cui, S.; Wu, Y.; Fanning, S.; Bai, L. Dynamics of Antimicrobial Resistance and Genomic Epidemiology of Multidrug-Resistant Salmonella enterica Serovar Indiana ST17 from 2006 to 2017 in China. mSystems 2022, 7, e0025322. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.X.; Zhang, A.Y.; Yang, Y.Q.; Lei, C.W.; Cheng, G.Y.; Zou, W.C.; Zeng, J.X.; Chen, Y.P.; Wang, H.N. Sensitive and rapid detection of Salmonella enterica serovar Indiana by cross-priming amplification. J. Microbiol. Methods 2018, 153, 24–30. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Zhuang, L.; Zhang, D.; Xu, J.; Dou, X.; Wang, C.; Gong, J. Serovar-Specific Polymerase Chain Reaction for Detection of Salmonella enterica Serovar Indiana. Foodborne Pathog. Dis. 2018, 15, 776–781. [Google Scholar] [CrossRef] [Scilit]
- Chan, S.H.; Liau, S.H.; Low, Y.J.; Chng, K.R.; Wu, Y.; Chan, J.S.H.; Tan, L.K. A Real-Time PCR Approach for Rapid Detection of Viable Salmonella Enteritidis in Shell Eggs. Microorganisms 2023, 11, 844. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Zhao, H.; Sun, J.; Liu, Y.; Zhou, X.; Beier, R.C.; Wu, G.; Hou, X. Characterization of multidrug-resistant Salmonella enterica serovars Indiana and Enteritidis from chickens in Eastern China. PLoS ONE 2014, 9, e96050. [Google Scholar] [CrossRef] [Scilit]
- Ge, B.; Domesle, K.J.; Yang, Q.; Hammack, T.S.; Wang, S.S.; Deng, X.; Hu, L.; Zhang, G.; Hu, Y.; Lai, X.; et al. Multi-Laboratory Validation of a Loop-Mediated Isothermal Amplification Method for Screening Salmonella in Animal Food. Front. Microbiol. 2019, 10, 562. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Hu, Y.; Lu, X. Polyethersulfone-Based Microfluidic Device Integrated with DNA Extraction on Paper and Recombinase Polymerase Amplification for the Detection of Salmonella enterica. ACS Sens. 2023, 8, 2331–2339. [Google Scholar] [CrossRef] [Scilit]
- Zhuang, L.; Gong, J.; Li, Q.; Zhu, C.; Yu, Y.; Dou, X.; Liu, X.; Xu, B.; Wang, C. Detection of Salmonella spp. by a loop-mediated isothermal amplification (LAMP) method targeting bcfD gene. Lett. Appl. Microbiol. 2014, 59, 658–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.Y.; Cheng, Q.X.; Liu, J.K.; Nie, X.Q.; Zhao, G.P.; Wang, J. CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell Res. 2018, 28, 491–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gootenberg, J.S.; Abudayyeh, O.O.; Lee, J.W.; Essletzbichler, P.; Dy, A.J.; Joung, J.; Verdine, V.; Donghia, N.; Daringer, N.M.; Freije, C.A.; et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 2017, 356, 438–442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.Y.; Cheng, Q.X.; Wang, J.M.; Li, X.Y.; Zhang, Z.L.; Gao, S.; Cao, R.B.; Zhao, G.P.; Wang, J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Huang, J.; Ren, L.; Jiang, W.; Wang, M.; Zhuang, L.; Zheng, Q.; Yang, R.; Zeng, Y.; Luu, L.D.W.; et al. A one-step, one-pot CRISPR nucleic acid detection platform (CRISPR-top): Application for the diagnosis of COVID-19. Talanta 2021, 233, 122591. [Google Scholar] [CrossRef] [Scilit]
- Gong, J.; Zeng, X.; Zhang, P.; Zhang, D.; Wang, C.; Lin, J. Characterization of the emerging multidrug-resistant Salmonella enterica serovar Indiana strains in China. Emerg. Microbes Infect. 2019, 8, 29–39. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Zhang, P.; Zhuang, L.; Zhang, D.; Qi, K.; Dou, X.; Wang, C.; Gong, J. Multiplex polymerase chain reaction to detect Salmonella serovars Indiana, Enteritidis, and Typhimurium in raw meat. J. Food Saf. 2019, 39, e12674. [Google Scholar] [CrossRef] [Scilit]
- Fatima, S.; Ishaq, Z.; Irfan, M.; AlAsmari, A.F.; Achakzai, J.K.; Zaheer, T.; Ali, A.; Akbar, A. Whole-genome sequencing of multidrug resistance Salmonella Typhi clinical strains isolated from Balochistan, Pakistan. Front. Public Health 2023, 11, 1151805. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Bai, X.; Bhunia, A.K. Current State of Development of Biosensors and Their Application in Foodborne Pathogen Detection. J. Food Prot. 2021, 84, 1213–1227. [Google Scholar] [CrossRef] [Scilit]
- Bailey, M.; Taylor, R.; Brar, J.; Corkran, S.; Velásquez, C.; Novoa-Rama, E.; Oliver, H.F.; Singh, M. Prevalence and Antimicrobial Resistance of Salmonella from Antibiotic-Free Broilers During Organic and Conventional Processing. J. Food Prot. 2020, 83, 491–496. [Google Scholar] [CrossRef] [Scilit]
- Kim, T.Y.; Zhu, X.; Kim, S.M.; Lim, J.A.; Woo, M.A.; Lim, M.C.; Luo, K. A review of nucleic acid-based detection methods for foodborne viruses: Sample pretreatment and detection techniques. Food Res. Int. 2023, 174, 113502. [Google Scholar] [CrossRef] [Scilit]
- Ndraha, N.; Lin, H.Y.; Wang, C.Y.; Hsiao, H.I.; Lin, H.J. Rapid detection methods for foodborne pathogens based on nucleic acid amplification: Recent advances, remaining challenges, and possible opportunities. Food Chem. 2023, 7, 100183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, J.; Shin, J.; Kang, S.; Shin, S.; Chung, Y.J. Rapid and sensitive detection of Salmonella species targeting the hilA gene using a loop-mediated isothermal amplification assay. Genom. Inform. 2021, 19, e30. [Google Scholar] [CrossRef] [Scilit]
- Gong, J.; Xu, J.; Fu, L.; Dong, Y.; Xu, B.; Zhang, D.; Dou, X. Establishment of a Loop-mediated Isothermal Amplification Method for Rapid Detection of Salmonella Indiana. Acta Vet. Zootech. Sin. 2021, 52, 560–564. [Google Scholar]
- Xiang, X.; Shang, Y.; Li, F.; Chen, M.; Zhang, J.; Wan, Q.; Ye, Q.; Ding, Y.; Wu, Q. A microfluidic genoserotyping strategy for fast and objective identification of common Salmonella serotypes isolated from retail food samples in China. Anal. Chim. Acta 2022, 1201, 339657. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, P.; Prasad, D. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech 2023, 13, 200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Analyt. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.; Wang, J.; Wang, Z.; Xiong, P.; Cheng, J.; Xu, T. An Integrated Microfluidic Biosensing System Based on a Versatile Valve and Recombinase Polymerase Amplification for Rapid and Sensitive Detection of Salmonella typhimurium. Biosensors 2023, 13, 790. [Google Scholar] [CrossRef] [Scilit]
- Jirawannaporn, S.; Limothai, U.; Tachaboon, S.; Dinhuzen, J.; Kiatamornrak, P.; Chaisuriyong, W.; Srisawat, N. The combination of RPA-CRISPR/Cas12a and Leptospira IgM RDT enhances the early detection of leptospirosis. PLoS Negl. Trop. Dis. 2023, 17, e0011596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, J.J.; Liu, D.; Cai, M.Z.; Zhou, Y.; Yin, W.X.; Luo, C.X. One-Pot Assay for Rapid Detection of Benzimidazole Resistance in Venturia carpophila by Combining RPA and CRISPR/Cas12a. J. Agric. Food Chem. 2023, 71, 1381–1390. [Google Scholar] [CrossRef] [Scilit]
- Yang, H.; Gao, P.; Rajashankar, K.R.; Patel, D.J. PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease. Cell 2016, 167, 1814–1828.e1812. [Google Scholar] [CrossRef] [Scilit]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [Scilit]
- Teng, F.; Guo, L.; Cui, T.; Wang, X.G.; Xu, K.; Gao, Q.; Zhou, Q.; Li, W. CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity. Genome Biol. 2019, 20, 132. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Li, S.; Wu, N.; Wu, J.; Wang, G.; Zhao, G.; Wang, J. HOLMESv2: A CRISPR-Cas12b-Assisted Platform for Nucleic Acid Detection and DNA Methylation Quantitation. ACS Synth. Biol. 2019, 8, 2228–2237. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Xiao, J.; Yang, H.; Yao, Y.; Li, J.; Zheng, H.; Guo, Q.; Wang, X.; Chen, Y.; Guo, Y.; et al. Development of a Rapid and Efficient RPA-CRISPR/Cas12a Assay for Mycoplasma pneumoniae Detection. Front. Microbiol. 2022, 13, 858806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, X.; Wang, X.; Li, S.; Luo, W.; Zhang, X.; Wang, C.; Chen, Q.; Yu, S.; Tai, J.; Wang, Y. Rapid, Ultrasensitive, and Highly Specific Diagnosis of COVID-19 by CRISPR-Based Detection. ACS Sens. 2021, 6, 881–888. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, B.; Zhang, H.; Su, X.; Guo, Y.; Wu, T.; Ge, Y.; Zhu, F.; Cui, L. Rapid and Sensitive Detection of Salmonella spp. Using CRISPR-Cas13a Combined with Recombinase Polymerase Amplification. Front. Microbiol. 2021, 12, 732426. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Species | Strain No. | |
|---|---|---|
| Salmonella strains | ||
| 1 | Salmonella Pullorum | ATCC10398 |
| 2 | Salmonella Gallinarum | ATCC9184 |
| 3 | Salmonella Blockley | CICC21489 |
| 4 | Salmonella Choleraesuis | CICC21493 |
| 5 | Salmonella Agona | CICC21586 |
| 6 | Salmonella Thompson | CICC21481 |
| 7 | Salmonella Potsdam | CICC21500 |
| 8 | Salmonella Kentucky | CICC21488 |
| 9 | Salmonella Heidelberg | CICC21487 |
| 10 | Salmonella Dublin | CMCC50042 |
| 11 | Salmonella Saintpaul | CICC21486 |
| 12 | Salmonella Reading | CMCC50103 |
| 13 | Salmonella Indiana | S1105 |
| 14 | Salmonella diarizonae | ATCC12325 |
| 15 | Salmonella arizonae | ATCC13314 |
| 16 | Salmonella bongori | ATCC43975 |
| 17 | Salmonella Indiana | ATCC51959 |
| 18 | Salmonella Enteritidis | ATCC13076 |
| 19 | Salmonella Typhimurium | ATCC14028 |
| 20 | Salmonella Indiana | S1467 |
| 21 | Salmonella Derby | CMCC50112 |
| 22 | Salmonella Indiana | S1515 |
| Non-Salmonella strains | ||
| 1 | Proteus vulgaris | CMCC49027 |
| 2 | Escherichia coli | ATCC25922 |
| 3 | Klebsiella pneumoniae | CMCC46117 |
| 4 | Shigella sonnei | CMCC51592 |
| 5 | Enterococcus faecium | ATCC35667 |
| 6 | Staphylococcus aureus | ATCC25923 |
| 7 | Bacillus cereus | CMCC63303 |
| 8 | Campylobacter jejuni | NCTC11168 |
| Primer | Sequence (5′-3′) | |
|---|---|---|
| SI-1 | F1 | CAGTAGCGACACAATGGAAAATAAATGGAG |
| R1 | GATTCAGAGTCATATCCCTTACCAGAATCTCC | |
| SI-2 | F2 | GATATGCAGGGAGATTCTGGTAAGGGATATG |
| R2 | GTCAAAAACCCTCCAAACATAAACAGTAAACC | |
| SI-3 | F3 | CAGGGAGATTCTGGTAAGGGATATGACTCTG |
| R3 | CAGCAAAAAGAGTTGTCAAAAACCCTCCAAAC | |
| SI-4 | F4 | GGATGTTCTATCTACCACTCGAAAAGAATACG |
| R4 | CTCCATTTATTTTCCATTGTGTCGCTACTG | |
| SI-5 | F5 | CGAAAACTCGAAACTACCATGTTTGAATGG |
| R5 | CCCTTACCAGAATCTCCCTGCATATCATATTC | |
| SI-6 | F6 | CTGGTAAGGGATATGACTCTGAATCTCAATG |
| R6 | GAGTTGTCAAAAACCCTCCAAACATAAACAG | |
| SI-7 | F7 | TTCAATCCTTGCCCGTCGCGGGGCTGTTATCG |
| R7 | TCATTGCTGTTAAGAACGGAAAGTGTCATTGC | |
| sgRNA | Sequence (5′-3′) |
|---|---|
| sg-1 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACAGUAGCGACACAAUGGAAAA |
| sg-2 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUUUUCCAUUGUGUCGCUACU |
| sg-3 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACAUUUAUUUUCCAUUGUGUCG |
| sg-4 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACCAUUUAUUUUCCAUUGUGUC |
| sg-5 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACCUCCAUUUAUUUUCCAUUGU |
| sg-6 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUUUACUCCAUUUAUUUUCCA |
| sg-7 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACCAAGAGCUAUUUACUCCAUU |
| sg-8 | GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUGUCGCUACUGAAAAUUCAU |
| Samples | Num | Positive Sample | Positive Rate | Consistency | |
|---|---|---|---|---|---|
| Traditional Culture | RPA-CRISPR/Cas12b | ||||
| Post-shedding | 43 | 9 | 9 | 20.93% | 100% |
| Post-evisceration | 35 | 5 | 5 | 14.29% | 100% |
| Post-chilling | 31 | 3 | 3 | 9.68% | 100% |
| Total | 109 | 17 | 17 | 15.60% | 100% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gong, J.; Zhang, D.; Fu, L.; Dong, Y.; Wu, K.; Dou, X.; Wang, C. A One-Pot Convenient RPA-CRISPR-Based Assay for Salmonella enterica Serovar Indiana Detection. Microorganisms 2024, 12, 519. https://doi.org/10.3390/microorganisms12030519
Gong J, Zhang D, Fu L, Dong Y, Wu K, Dou X, Wang C. A One-Pot Convenient RPA-CRISPR-Based Assay for Salmonella enterica Serovar Indiana Detection. Microorganisms. 2024; 12(3):519. https://doi.org/10.3390/microorganisms12030519
Chicago/Turabian StyleGong, Jiansen, Di Zhang, Lixia Fu, Yongyi Dong, Kun Wu, Xinhong Dou, and Chengming Wang. 2024. "A One-Pot Convenient RPA-CRISPR-Based Assay for Salmonella enterica Serovar Indiana Detection" Microorganisms 12, no. 3: 519. https://doi.org/10.3390/microorganisms12030519
APA StyleGong, J., Zhang, D., Fu, L., Dong, Y., Wu, K., Dou, X., & Wang, C. (2024). A One-Pot Convenient RPA-CRISPR-Based Assay for Salmonella enterica Serovar Indiana Detection. Microorganisms, 12(3), 519. https://doi.org/10.3390/microorganisms12030519

