Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Antibiotic Susceptibility
2.3. Identification of Antibiotic Resistance Gene
2.4. Hemolysis
2.5. Determination of Salt Tolerance, Enzyme Activities, and Acid Production
2.6. Strain Deposit
3. Results
3.1. Antibiotic Resistance Profiles in Leuconostoc citreum Strains Were Analyzed
3.2. Absence of Acquired Antibiotic Resistance Genes in Leuconostoc citreum Strains
3.3. Hemolysis of Leuconostoc citreum Strains
3.4. Technological Property of Leuconostoc citreum Strains; Salt Tolerance, Protease, Lipase, and Amylase Activities, and Acid Production
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Björkroth, J.; Holzapfel, W. Genera Leuconostoc, Oenococcus and Weissella. Prokaryotes 2006, 4, 267–319. [Google Scholar] [CrossRef]
- Lee, S.H.; Chang, H.C. Isolation of antifungal activity of Leuconostoc mesenteroides TA from kimchi and characterization of its antifungal compounds. Food Sci. Biotechnol. 2016, 25, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Farrow, J.M.; Facklam, R.R.; Collins, M.D. Nucleic Acid Homologies of Some Vancomycin-Resistant Leuconostocs and Description of Leuconostoc citreum sp. nov. and Leuconostoc pseudomesenteroides sp. nov. Int. J. Syst. Bacteriol. 1989, 39, 279–283. [Google Scholar] [CrossRef]
- Schillinger, U.; Holzapfel, W.; Kandler, O. Nucleic Acid Hybridization Studies on Leuconostoc and Heterofermentative Lactobacilli and Description of Leuconostoc amelihiosum sp. nov. Syst. Appl. Microbiol. 1989, 12, 48–55. [Google Scholar] [CrossRef]
- Takahashi, M.; Okada, S.; Uchimura, T.; Kozaki, M. Leuconostoc amelibiosum Schillinger, Holzapfel, and Kandler 1989 Is a Later Subjective Synonym of Leuconostoc citreum Farrow, Facklam, and Collins 1989. Int. J. Syst. Bacteriol. 1992, 42, 649–651. [Google Scholar] [CrossRef][Green Version]
- Domingos-Lopes, M.; Lamosa, P.; Stanton, C.; Ross, R.; Silva, C. Isolation and characterization of an exopolysaccharide-producing Leuconostoc citreum strain from artisanal cheese. Lett. Appl. Microbiol. 2018, 67, 570–578. [Google Scholar] [CrossRef]
- Roșca, M.F.; Păucean, A.; Man, S.M.; Chiș, M.S.; Pop, C.R.; Pop, A.; Fărcaș, A.C. Leuconostoc citreum: A Promising Sourdough Fermenting Starter for Low-Sugar-Content Baked Goods. Foods 2024, 13, 96. [Google Scholar] [CrossRef]
- Kwon, M.; Shin, M.; Lim, S.K.; Lee, J.; Park, H.K.; Kim, N.; Yun, M.; Jo, H.E.; Oh, Y.J.; Choi, H. Leuconostoc citreum isolated from kimchi suppresses the development of collagen-induced arthritis in DBA/1 mice. J. Funct. Foods 2019, 63, 103579. [Google Scholar] [CrossRef]
- Choi, H.; Kim, Y.W.; Hwang, I.; Kim, J.; Yoon, S. Evaluation of Leuconostoc citreum HO12 and Weissella koreensis HO20 isolated from kimchi as a starter culture for whole wheat sourdough. Food Chem. 2012, 134, 2208–2216. [Google Scholar] [CrossRef]
- Chang, J.Y.; Chang, H.C. Improvements in the Quality and Shelf Life of Kimchi by Fermentation with the Induced Bacteriocin-Producing Strain, Leuconostoc citreum GJ7 as a Starter. J. Food Sci. 2010, 75, M103–M110. [Google Scholar] [CrossRef]
- Choi, I.K.; Jung, S.H.; Kim, B.J.; Park, S.Y.; Kim, J.; Han, H.U. Novel Leuconostoc citreum starter culture system for the fermentation of kimchi, a fermented cabbage product. Antonie Van Leeuwenhoek 2003, 84, 247–253. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.J.; Lee, H.W.; Lee, M.E.; Roh, S.W.; Kim, T.W. Mixed starter of Lactococcus lactis and Leuconostoc citreum for extending kimchi shelf-life. J. Microbiol. 2019, 57, 479–484. [Google Scholar] [CrossRef] [PubMed]
- Patra, J.K.; Das, G.; Paramithiotis, S.; Shin, H.S. Kimchi and other widely consumed traditional fermented foods of Korea: A review. Front. Microbiol. 2016, 7, 149. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Heo, S.; Lee, G.; Hong, S.W.; Jeong, D.W. Bacterial community of kimchi added with seafood based on culture-dependent investigations. Heliyon 2024, 10, e34153. [Google Scholar] [CrossRef]
- Cho, J.; Lee, D.; Yang, C.; Jeon, J.; Kim, J.; Han, H. Microbial population dynamics of kimchi, a fermented cabbage product. FEMS Microbiol. Lett. 2006, 257, 262–267. [Google Scholar] [CrossRef]
- Jung, J.Y.; Lee, S.H.; Lee, H.J.; Seo, H.Y.; Park, W.S.; Jeon, C.O. Effects of Leuconostoc mesenteroides starter cultures on microbial communities and metabolites during kimchi fermentation. Int. J. Food Microbiol. 2012, 153, 378–387. [Google Scholar] [CrossRef]
- Lee, S.H.; Whon, T.W.; Roh, S.W.; Jeon, C.O. Unraveling microbial fermentation features in kimchi: From classical to meta-omics approaches. Appl. Microbiol. Biotechnol. 2020, 104, 7731–7744. [Google Scholar] [CrossRef]
- Moon, S.H.; Kim, C.R.; Chang, H.C. Heterofermentative lactic acid bacteria as a starter culture to control kimchi fermentation. LWT-Food Sci. Technol. 2018, 88, 181–188. [Google Scholar] [CrossRef]
- Lee, M.E.; Jang, J.Y.; Lee, J.H.; Park, H.W.; Choi, H.J.; Kim, T.W. Starter Cultures for Kimchi Fermentation. J. Microbiol. Biotechnol. 2015, 25, 559–568. [Google Scholar] [CrossRef]
- Kim, H.J.; Kwon, M.S.; Hwang, H.; Choi, H.-S.; Lee, W.; Choi, S.-P.; Jo, H.; Hong, S.W. A review of the health benefits of kimchi functional compounds and metabolites. Microbiol. Biotechnol. Lett. 2023, 51, 353–373. [Google Scholar] [CrossRef]
- Park, J.; Heo, S.; Na, H.-E.; Lee, G.; Kim, T.; Sung, M.-H.; Jeong, D.W. Culture-dependent and -independent investigations of the effect of addition of jogi on the bacterial community of kimchi. Food Biosci. 2023, 54, 102832. [Google Scholar] [CrossRef]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP). Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J. 2012, 10, 2740. [Google Scholar] [CrossRef]
- Lee, C.Y.; Buranen, S.L.; Zhi-Hai, Y. Construction of single-copy integration vectors for Staphylococcus aureus. Gene 1991, 103, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.-H.; Heo, S.; Jeong, M.; Jeong, D.-W. Transfer of a mobile Staphylococcus saprophyticus plasmid isolated from fermented seafood that confers tetracycline resistance. PLoS ONE 2019, 14, e0213289. [Google Scholar] [CrossRef]
- Monk, I.R.; Shah, I.M.; Xu, M.; Tan, M.W.; Foster, T.J. Transforming the untransformable: Application of direct transformation to manipulate genetically Staphylococcus aureus and Staphylococcus epidermidis. mBio 2012, 3, e00277-11. [Google Scholar] [CrossRef]
- Liu, C.; Zhang, Z.Y.; Dong, K.; Yuan, J.P.; Guo, X.K. Antibiotic resistance of probiotic strains of lactic acid bacteria isolated from marketed foods and drugs. Biomed. Environ. Sci. 2009, 22, 401–412. [Google Scholar] [CrossRef]
- Jeong, D.W.; Han, S.; Lee, J.H. Safety and technological characterization of Staphylococcus equorum isolates from jeotgal, a Korean high-salt-fermented seafood, for starter development. Int. J. Food Microbiol. 2014, 188, 108–115. [Google Scholar] [CrossRef]
- Kobayashi, N.; Alam, M.; Nishimoto, Y.; Urasawa, S.; Uehara, N.; Watanabe, N. Distribution of aminoglycoside resistance genes in recent clinical isolates of Enterococcus faecalis, Enterococcus faecium and Enterococcus avium. Epidemiol. Infect. 2001, 126, 197–204. [Google Scholar] [CrossRef]
- Gibreel, A.; Skold, O.; Taylor, D.E. Characterization of plasmid-mediated aphA-3 kanamycin resistance in Campylobacter jejuni. Microb. Drug Resist. 2004, 10, 98–105. [Google Scholar] [CrossRef]
- Rojo-Bezares, B.; Saenz, Y.; Poeta, P.; Zarazaga, M.; Ruiz-Larrea, F.; Torres, C. Assessment of antibiotic susceptibility within lactic acid bacteria strains isolated from wine. Int. J. Food Microbiol. 2006, 111, 234–240. [Google Scholar] [CrossRef]
- Ouoba, L.I.; Lei, V.; Jensen, L.B. Resistance of potential probiotic lactic acid bacteria and bifidobacteria of African and European origin to antimicrobials: Determination and transferability of the resistance genes to other bacteria. Int. J. Food Microbiol. 2008, 121, 217–224. [Google Scholar] [CrossRef] [PubMed]
- Berube, B.; Wardenburg, J. Staphylococcus aureus α-Toxin: Nearly a Century of Intrigue. Toxins 2013, 5, 1140–1166. [Google Scholar] [CrossRef] [PubMed]
- Heo, S.; Kim, T.; Na, H.E.; Lee, G.; Park, J.H.; Park, H.J.; Jeong, D.W. Safety Assessment Systems for Microbial Starters Derived from Fermented Foods. J. Microbiol. Biotechnol. 2022, 32, 1219–1225. [Google Scholar] [CrossRef] [PubMed]
- Chandra, P.; Enespa, N.; Singh, R.; Arora, P.K. Microbial lipases and their industrial applications: A comprehensive review. Microb. Cell Fact. 2020, 19, 169. [Google Scholar] [CrossRef]
- Gao, X.; Liu, E.; Yin, Y.; Yang, L.; Huang, Q.; Chen, S.; Ho, C. Enhancing Activities of Salt-Tolerant Proteases Secreted by Aspergillus oryzae Using Atmospheric and Room-Temperature Plasma Mutagenesis. J. Agric. Food Chem. 2020, 68, 2757–2764. [Google Scholar] [CrossRef]
- Gao, X.; Liu, E.; Zhang, J.; Yang, L.; Huang, Q.; Chen, S.; Ma, H.; Ho, C.; Liao, L. Accelerating aroma formation of raw soy sauce using low intensity sonication. Food Chem. 2020, 329, 127118. [Google Scholar] [CrossRef]
- Solanki, P.; Putatunda, C.; Kumar, A.; Bhatia, R.; Walia, A. Microbial proteases: Ubiquitous enzymes with innumerable uses. 3 Biotech. 2021, 11, 428. [Google Scholar] [CrossRef]
- FAO/WHO. Joint FAO/WHO. (Food and Agriculture Organization/World Health Organization). Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food; FAO: Rome, Italy; WHO: Geneva, Switzerland, 2002. [Google Scholar]
- Iosca, G.; De Vero, L.; Di Rocco, G.; Perrone, G.; Gullo, M.; Pulvirenti, A. Anti-Spoilage Activity and Exopolysaccharides Production by Selected Lactic Acid Bacteria. Foods 2022, 11, 1914. [Google Scholar] [CrossRef]
- Flórez, A.B.; Campedelli, I.; Delgado, S.; Alegria, Á.; Salvetti, E.; Felis, G.E.; Mayo, B.; Torriani, S. Antibiotic Suscepti.bility Profiles of Dairy Leuconostoc, Analysis of the Genetic Basis of Atypical Resistances and Transfer of Genes In Vitro and in a Food Matrix. PLoS ONE 2016, 11, e0145203. [Google Scholar] [CrossRef]
- Lee, J.H.; Jeong, D.W. Characterization of mobile Staphylococcus equorum plasmids isolated from fermented seafood that confer lincomycin resistance. PLoS ONE 2015, 10, e0140190. [Google Scholar] [CrossRef]
- Jeong, D.-W.; Heo, S.; Ryu, S.; Blom, J.; Lee, J.-H. Genomic insights into the virulence and salt tolerance of Staphylococcus equorum. Sci. Rep. 2017, 7, 5383. [Google Scholar] [CrossRef]
- Mathur, S.; Singh, R. Antibiotic resistance in food lactic acid bacteria—A review. Int. J. Food Microbiol. 2005, 105, 281–295. [Google Scholar] [CrossRef]



| Antibiotic | Target Gene | Oligonucleotide Sequence (5′-3′) | Size (bp) | Reference | |
|---|---|---|---|---|---|
| Forward | Reverse | ||||
| Ampicillin | blaZ | TACTTCAACACCTGCTGCTTTCG | ATTACACTCTTGGCGGTTTCAC | 325 | [27] |
| Chloramphenicol | cat | CCAGCAAACTACGTATAGCATTAC | GATGAAGCTGCAAGGCAACTGG | 499 | [28] |
| Gentamicin | aac(6′)-aph(2″) | CCAAGAGCAATAAGGGCATACC | ACCCTCAAAAACTGTTGTTGC | 675 | [29] |
| Kanamycin | aphA-3 | GGGACCACCTATGATGTGGAACG | CAGGCTTGATCCCCAGTAAGTC | 600 | [30] |
| Streptomycin | ant(6) | ACTGGCTTAATCAATTTGGG | GCCTTTCCGCCACCTCACCG | 597 | [31] |
| str(A) | CTTGGTGATAACGGCAATTC | CCAATCGCAGATAGAAGGC | 500 | [32] | |
| str(B) | ATCGTCAAGGGATTGAAACC | GGATCGTAGAACATATTGGC | 500 | [32] | |
| Tetracycline | tetK | TTAGGTGAAGGGTTAGGTCC | GCAAACTCATTCCAGAAGCA | 718 | [28] |
| tetM | ACAGAAAGCTTATTATATAAC | TGGCGTGTCTATGATGTTCAC | 171 | [28] | |
| Growth or Zone of Halo | NaCl (w/v) Tolerance | Protease Activity | Acid Production | ||||
|---|---|---|---|---|---|---|---|
| 3% | 6% | 0.5% a | 3% | 6% | 0.5% a | 3% | |
| G | 46 | 46 | |||||
| — | 1 | 15 | 11 | ||||
| W | 1 | 8 | 16 | 1 | 3 | ||
| + | 11 | 25 | 13 | 3 | 14 | ||
| ++ | 29 | 7 | 1 | 42 | 18 | ||
| +++ | 5 | 5 | 1 | ||||
| Total | 46 | 46 | 46 | 46 | 46 | 46 | 46 |
| Strain | NaCl (w/v) Tolerance | Protease a | Acid a | ||||
|---|---|---|---|---|---|---|---|
| 3% | 6% | 0.5% b | 3% | 6% | 0.5% | 3% | |
| AK5T17 | G | G | +++ | +++ | + | ++ | W |
| AK5T19 | G | G | +++ | +++ | W | ++ | W |
| AK10M04 | G | G | +++ | +++ | ++ | ++ | + |
| DMLC16 | G | G | +++ | +++ | +++ | ++ | ++ |
| YK10T20 | G | G | +++ | +++ | W | ++ | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.; Heo, S.; Lee, G.; Moon, Y.; Kim, M.; Kwak, M.-S.; Jeong, D.-W. Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates. Microorganisms 2024, 12, 2636. https://doi.org/10.3390/microorganisms12122636
Lee S, Heo S, Lee G, Moon Y, Kim M, Kwak M-S, Jeong D-W. Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates. Microorganisms. 2024; 12(12):2636. https://doi.org/10.3390/microorganisms12122636
Chicago/Turabian StyleLee, Sumin, Sojeong Heo, Gawon Lee, Yura Moon, Minkyeong Kim, Mi-Sun Kwak, and Do-Won Jeong. 2024. "Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates" Microorganisms 12, no. 12: 2636. https://doi.org/10.3390/microorganisms12122636
APA StyleLee, S., Heo, S., Lee, G., Moon, Y., Kim, M., Kwak, M.-S., & Jeong, D.-W. (2024). Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates. Microorganisms, 12(12), 2636. https://doi.org/10.3390/microorganisms12122636

