Heat-Killed Lactobacillus paracasei SMB092 Reduces Halitosis by Stimulating the Expression of β-Defensins in Oral Keratinocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Whole-Genome Sequencing Analysis of SMB092
2.3. Identification of the Putative MuB Responsible for the Adhesion Protein in SMB092
2.4. Mucin-Binding Assay
2.5. Cell Culture
2.6. Determination of Cell Viability
2.7. Measurement of mRNA Expression
2.8. Bactericidal Assay
2.9. Measurement of H2S
2.10. Statistical Analysis
3. Results
3.1. General Genome Features of SMB092
3.2. Defining Genes Encoding MuB and Mucin-Binding Activity of SMB092
3.3. The Effect of SMB092 on Cytotoxicity and BD Production in HOK-16B Cells
3.4. The Effect of SMB092 on the Expression of TLRs in HOK-16B Cells
3.5. The Effect of TLR2 Neutralization on the Expression of hBD1/hBD2 and CD14/CD36 in HOK-16B Cells
3.6. Effects of the FCM on P. gingivalis and Its Mediated H2S Production
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Chavda, R.M.; Patel, E.D.; Shah, S.H.; Shah, S.K.; Sheth, S.; Munia, V. A study to assess the unique oral health challenges faced by elderly individuals, including denture use, dry mouth, and periodontal diseases. Int. J. Oral Care Res. 2023, 11, 44–47. [Google Scholar] [CrossRef]
- Byrne, S.J.; Dashper, S.G.; Darby, I.B.; Adams, G.G.; Hoffmann, B.; Reynolds, E.C. Progression of chronic periodontitis can be predicted by the levels of Porphyromonas gingivalis and Treponema denticola in subgingival plaque. Oral Microbiol. 2009, 24, 469–477. [Google Scholar] [CrossRef] [PubMed]
- Hajishengallis, G.; Kajikawa, T.; Hajishengallis, E.; Maekawa, T.; Reis, E.S.; Mastellos, D.C.; Tancopoulou, D.; Hasturk, H.; Lambris, J.D. Complement-dependent mechanisms and interventions in periodontal disease. Front. Immunol. 2019, 10, 406. [Google Scholar] [CrossRef]
- Karbalaei, M.; Keikha, M.; Kobyliak, N.M.; Zadeh, Z.K.; Yousefi, B.; Eslami, M. Alleviation of halitosis by use of probiotics and their protective mechanisms in the oral cavity. New Microbes New Infect. 2021, 42, 100887. [Google Scholar] [CrossRef]
- Kim, T.I.; Choi, E.J.; Jeong, J.P.; Han, S.B.; Gu, Y. Antimicorbial effect of Zea mays L. and Magnoliae cortex extract mixtures on periodontal pathogen and effect on human gingival fibrobla. J. Periodont. Implant Sci. 2002, 32, 249–255. [Google Scholar]
- Lim, H.S.; Yeu, J.E.; Hong, S.P.; Kang, M.S. Characterization of Antibacterial cell-free supernatant from oral care probiotic Weissella cibaria, CMU. Molecules 2018, 23, 1984. [Google Scholar] [CrossRef]
- Chen, Y.T.; Hsieh, P.S.; Ho, H.H.; Hsieh, S.H.; Kuo, Y.W.; Yang, S.F.; Lin, C.W. Antibacterial activity of viable and heat-killed probiotic strains against oral pathogens. Lett. Appl. Microbiol. 2020, 70, 310–317. [Google Scholar] [CrossRef] [PubMed]
- Rossoni, R.D.; Velloso, M.D.S.; de Barros, P.P.; de Alvarenga, J.A.; Santos, J.D.D.; Santos Prado, A.C.C.D.; Ribeiro, F.C.; Anbinder, A.L.; Junqueira, J.C. Inhibitory effect of probiotic Lactobacillus supernatants from the oral cavity on Streptococcus mutans biofilms. Microb. Pathog. 2018, 123, 361–367. [Google Scholar] [CrossRef] [PubMed]
- Van Tassell, M.L.; Miller, M.J. Lactobacillus adhesion to mucus. Nutrients 2011, 3, 613–636. [Google Scholar] [CrossRef]
- Sanders, M.E. Impact of probiotics on colonizing microbiota of the gut. J. Clin. Gastroenterol. 2011, 45, S115–S119. [Google Scholar] [CrossRef]
- Habil, N.; Abate, W.; Beal, J.; Foey, A.D. Heat-killed probiotic bacteria differentially regulate colonic epithelial cell production of human β-defensin-2: Dependence on inflammatory cytokines. Benef. Microbes 2014, 5, 483–495. [Google Scholar] [CrossRef] [PubMed]
- Dommisch, H.; Skora, P.; Hirschfeld, J.; Olk, G.; Hildebrandt, L.; Jepsen, S. The guardians of the periodontium-sequential and differential expression of antimicrobial peptides during gingival inflammation. Results from in vivo and in vitro studies. J. Clin. Periodontol. 2019, 46, 276–285. [Google Scholar] [CrossRef] [PubMed]
- Siciliano, R.A.; Reale, A.; Mazzeo, M.F.; Morandi, S.; Silvetti, T.; Brasca, M. Parabiotics: A new perspective for functional foods and nutraceuticals. Nutrients 2021, 13, 1225. [Google Scholar] [CrossRef]
- Hyatt, D.; Chen, G.L.; LoCascio, P.F.; Land, M.L.; Larimer, F.W.; Hauser, L.J. Prodigal: Prokaryotic gene recognition and translation initiation site identification. BMC Bioinform. 2010, 11, 119. [Google Scholar] [CrossRef] [PubMed]
- Schattner, P.; Brooks, A.N.; Lowe, T.M. The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids Res. 2005, 33, W686–W689. [Google Scholar] [CrossRef]
- Nawrocki, E.P.; Burge, S.W.; Bateman, A.; Daub, J.; Eberhardt, R.Y.; Eddy, S.R.; Floden, E.W.; Gardner, P.P.; Jones, T.A.; Tate, J.; et al. Rfam 12.0: Updates to the RNA families database. Nucleic Acids Res. 2015, 43, D130–D137. [Google Scholar] [CrossRef]
- Edgar, R.C. PILER-CR: Fast and accurate identification of CRISPR repeats. BMC Bioinform. 2007, 8, 18. [Google Scholar] [CrossRef]
- Bland, C.; Ramsey, T.L.; Sabree, F.; Lowe, M.; Brown, K.; Kyrpides, N.C.; Hugenholtz, P. CRISPR Recognition Tool (CRT): A tool for automatic detection of clustered regularly interspaced palindromic repeats. BMC Bioinform. 2007, 8, 209. [Google Scholar] [CrossRef] [PubMed]
- Powell, S.; Forslund, K.; Szklarczyk, D.; Trachana, K.; Roth, A.; Huerta-Cepas, J.; Gabalón, T.; Rattei, T.; Creevey, C.; Kuhn, M.; et al. EggNOG v4.0: Nested orthology inference across 3686 organisms. Nucleic Acids Res. 2014, 42, D231–D239. [Google Scholar] [CrossRef]
- The UniProt Consortium. UniProt: A hub for protein information. Nucleic Acids Res. 2015, 43, D204–D212. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. Data, information, knowledge and principle: Back to metabolism in KEGG. Nucleic Acids Res. 2014, 42, D199–D205. [Google Scholar] [CrossRef] [PubMed]
- Overbeek, R.; Begley, T.; Butler, R.M.; Choudhuri, J.V.; Chuang, H.Y.; Cohoon, M.; de Crécy-Lagard, V.; Diaz, N.; Disz, T.; Edwards, R.; et al. The subsystems approach to genome annotation and its use in the project to annotate 1000 genomes. Nucleic Acids Res. 2005, 33, 5691–5702. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef]
- Ren, J.; Wen, L.; Gao, X.; Jin, X.; Xue, Y.; Yao, X. DOG 1.0: Illustrator of Protein Domain Structures. Cell Res. 2009, 19, 271–273. [Google Scholar] [CrossRef]
- Karbowiak, M.; Galek, M.; Szydlowska, A.; Zielińska, D. The influence of the degree of thermal inactivation of probiotic lactic acid bacteria and their postbiotics on aggregation and adhesion inhibition of selected pathogens. Pathogens 2022, 11, 1260. [Google Scholar] [CrossRef] [PubMed]
- Ji, S.; Kim, Y.S.; Oh, J.; Min, B.; Choi, Y. Toll-like receptor 2 and NALP2 mediate induction of human beta-defensin by Fusobacterium nucleatum in gingival epithelial cells. Infect. Immun. 2009, 77, 1044–1052. [Google Scholar] [CrossRef]
- Kim, W.J.; Yu, H.S.; Lee, N.K.; Paik, H.D. Levilactobacillus brevis KU15151 inhibits Staphylococcus aureus lipoteichoic acid-induced inflammation in RAW 264.7 macrophages. Probiotics Antimicrob. Proteins 2022, 14, 767–777. [Google Scholar] [CrossRef]
- Nguyen, A.T.; Kim, M.; Kim, Y.E.; Kim, H.; Lee, S.; Lee, Y.; Kim, K.Y. MSF enhances human antimicrobial peptide β-defensin (HBD2 and HBD3) expression and attenuates inflammation via the NF-κB and p38 signaling pathways. Molecules 2023, 28, 2744. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Meyer, K.; Di Bisceglie, A.M.; Ray, R. Hepatitis C Virus suppresses C9 complement synthesis and impairs membrane attack complex function. J. Virol. 2013, 87, 5858–5867. [Google Scholar] [CrossRef]
- Kang, M.S.; Kim, B.G.; Chung, J.; Lee, H.C.; Oh, J.S. Inhibitory effect of Weissella cibaria isolates on the production of volatile sulphur compounds. J. Clin. Periodontol. 2006, 33, 226–232. [Google Scholar] [CrossRef]
- Carpenter, G.H. The secretion, components, and properties of saliva. Annu. Rev. Food Sci. Technol. 2013, 4, 267–276. [Google Scholar] [CrossRef] [PubMed]
- Lebeer, S.; Vanderleyden, J.; De Keersmaecker, S.C.J. Host interactions of probiotic bacterial surface molecules: Comparison with commensals and pathogens. Nat. Rev. Microbiol. 2010, 8, 171–184. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, K.; Sakuragi, N.; Takakuwa, A.; Ayabe, T. Paneth cell α-defensins and enteric microbiota in health and disease. Biosci. Microbiota Food Health 2016, 35, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Toropov, V.; Demyanova, E.; Shalaeva, O.; Stikin, S.; Vakhitov, T. Whole-genome sequencing of Lactobacillus helveticus D75 and D76 confirms safety and probiotic potential. Microorganisms 2020, 8, 329. [Google Scholar] [CrossRef]
- Nishiyama, K.; Nakamata, K.; Uemo, S.; Terao, A.; Aryantini, N.P.D.; Sujaya, N.; Fukuda, K.; Urashima, T.; Yamamoto, Y.; Mukai, T. Adhesion properties of Lactobacillus rhamnosus mucus-binding factor to mucin and extracellular matrix proteins. Biosci. Biotechnol. Biochem. 2015, 79, 271–279. [Google Scholar] [CrossRef] [PubMed]
- Jensen, H.; Roos, S.; Jonsson, H.; Rud, I.; Grimmer, S.; van Pijkeren, J.-P.; Britton, R.A.; Axelsson, L. Role of Lactobacillus reuteri cell and mucus-binding protein A (CmbA) in adhesion to intestinal epithelial cells and mucus in vitro. Microbiology 2014, 160, 671–681. [Google Scholar] [CrossRef]
- Madsen, K.L. Enhancement of epithelial barrier function by probiotics. J. Epithel. Biol. Pharmacol. 2012, 5, 55–59. [Google Scholar] [CrossRef]
- Kobatake, E.; Kobayashi, R.; Kabuki, T.L.; Kurita-Ochiai, T. Lactobacillus helveticus SBT2171 upregulates the expression of β-defensin and ameliorates periodontal disease caused by Porphyromonas gingivalis. Microbiol. Immunol. 2019, 63, 293–302. [Google Scholar] [CrossRef]
- Pahumunto, N.; Duangnumsawang, Y.; Teanpaisan, R. Effects of potential proviotics on the expression of cytokines and human β-defensin in human gingival epithelial cells and in vivo efficacy in a dog model. Arch. Oral Biol. 2022, 142, 105513. [Google Scholar] [CrossRef]
- Kim, J.H.; Kim, K.H.; Kim, H.J.; Lee, J.; Myung, S.C. Expression of beta-defensin 131 promotes an innate immune response in human prostate epithelial cells. PLoS ONE 2015, 10, e0144776. [Google Scholar] [CrossRef]
- Schlee, M.; Harder, J.; Köten, B.; Stange, E.F.; Wehkamp, J.; Fellermann, K. Probiotic lactobacilli and VSL#3 induce enterocyte β-defensin 2. Clin. Exp. Immunol. 2008, 151, 528–535. [Google Scholar] [CrossRef] [PubMed]
- Kielian, T.; Haney, A.; Mayes, P.M.; Garg, S.; Esen, N. Toll-like receptor 2 modulates the proinflammatory milieu in Staphylococcus aureus-induced brain abscess. Infect. Immun. 2005, 73, 7428–7435. [Google Scholar] [CrossRef] [PubMed]
- Pazgier, M.; Hoover, D.M.; Yang, D.; Lu, W.; Lubkowski, J. Human β-defensins. Cell. Mol. Life Sci. 2006, 63, 1294–1313. [Google Scholar] [CrossRef] [PubMed]
- Vandar-Sengul, S.; Demirci, T.; Sen, B.H.; Erkizan, V.; Kurulgan, E.; Baylas, H. Human β defensin-1 and -2 expression in the gingiva of patients with specific periodontal diseases. J. Periodont. Res. 2007, 42, 429–437. [Google Scholar] [CrossRef] [PubMed]
- de Lima, P.O.; Nani, B.D.; Rolim, G.S.; Groppo, F.C.; Franz-Montan, M.; de Moraes, A.B.A.; Cogo-Müller, K.; Marcondes, F.K. Effects of academic stress on the levels of oral volatile sulfur compounds, halitosis-related bacteria and stress biomarkers of healthy undergraduate students. J. Breath Res. 2020, 14, 036005. [Google Scholar] [CrossRef]
- Ghosh, S.K.; Feng, Z.; Fujioka, H.; Lux, R.; McCormick, T.S.; Weinburg, A. Conceptual perspectives: Bacterial antimicrobial peptide induction as a novel strategy for symbiosis with the human host. Front. Microbiol. 2018, 9, 302. [Google Scholar] [CrossRef]
- Choi, W.J.; Cho, S.K.; Dong, H.J.; Kim, T.H.; Soon, J.; Lee, H.J.; Yoon, K.H.; Kwak, S.; Yun, J. Preventive effect of Lacticaseibacillus paracasei LMT18-32 on Porphyromonas gingivalis induced periodontitis. Food Sci. Biotechnol. 2024, 33, 2161–2167. [Google Scholar] [CrossRef]
- Zhao, Z.; Wu, J.; Sum, Z.; Fan, J.; Liu, F.; Zhao, W.; Liu, W.H.; Zhang, M.; Hung, W.L. Postbiotics derived from L. paracasei ET-22 inhibit the formation of S. mutans biofilms and bioactive substances: An analysis. Molecules 2023, 28, 1236. [Google Scholar] [CrossRef]
- Wuri, G.; Liu, F.; Sun, Z.; Fang, B.; Zhao, W.; Hung, W.L.; Liu, W.H.; Zhang, X.; Wang, R.; Wu, F.; et al. Lactobacillus paracasei ET-22 and derived postbiotics reduce halitosis and modulate oral microbiome dysregulation—A randomized, double-blind placebo-controlled clinical trial. Food Func. 2023, 14, 7335. [Google Scholar] [CrossRef]
- Ghapanchi, J.L.; Kamali, F.; Jalaly, Z.; Ebrahimi, H.; Bazargani, A.; Shahidi, S.P.; Vossoughi, M. Lack of association between halitosis and the presence of Streptococcus mutans in saliva. Br. J. Med. Med. Res. 2015, 10, 1–7. [Google Scholar] [CrossRef]
- Carda-Diéguez, M.; Rosier, B.T.; Lloret, S.; Llena, C.; Mira, A. The tongue biofilm metatransciptome identifies metabolic pathways associated with halitosis and its prevention. medRxiv 2021, 11, 21266067. [Google Scholar] [CrossRef]







| Primers | Forward | Reverse | 
|---|---|---|
| hBD1 | CTGCCTGCCCGATCTTTACC | CACTCCCAGCTCACTTGCAG | 
| hBD2 | CATCAGCCATGAGGGTCTTGT | ACAGGATCGCCTATACCACCA | 
| TLR1 | CTTCTGTTTTTGTGGCCAGGG | GGTGCCCAATATGCCTTTGTTA | 
| TLR2 | TTCCCTGGGCAGTCTTGAAC | GGCTTGAACCAGGAAGACGA | 
| TLR3 | CGGCCAACACTGTGAATGTG | CAGTGTCTCAGCTGTCAGGG | 
| TLR4 | TGGTGTCCCAGCACTTCATC | TGATACCAGCACGACTGCTC | 
| TLR5 | ACTGACAACGTGGCTTCTCC | GGGCAACTATAAGGTCAGGGG | 
| TLR6 | TGCAGACAAGTGTGAGGGAC | CTGAACCTGTGTGCTCCTGT | 
| TLR7 | TTCCCACGAACACCACGAAC | AGTCTGTGAAAGGACGCTGG | 
| TLR8 | TGCCACTGTGACTAATGGTCC | AAAACCGAACGCAACCACAG | 
| CD14 | CCTCAAGGAACTGACGCTCG | AGTGCAAGTCCTGTGGCTTC | 
| CD36 | GGACGCTGAGGACAACACA | AAGTTGTCAGCCTCTGTTCCA | 
| hGAPDH | AAGAAGGTGGTGAAGCAGGC | TGGGTGTCGCTGTTGAAGTC | 
| Contig Name | Length (bp) | GC Content (%) | CDS | tRNA | rRNA | 
|---|---|---|---|---|---|
| Chromosome | 2,849,542 | 46.3 | 2754 | 59 | 15 | 
| Plasmid1 | 34,051 | 39.2 | 36 | 0 | 0 | 
| Plasmid2 | 11,636 | 40.5 | 12 | 0 | 0 | 
| Total | 2,895,229 | 46.3 | 2802 | 59 | 15 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, W.-J.; Jung, G.; Kim, T.; Kim, J.; Hurh, B.-S.; Kim, H.; Soung, D.Y. Heat-Killed Lactobacillus paracasei SMB092 Reduces Halitosis by Stimulating the Expression of β-Defensins in Oral Keratinocytes. Microorganisms 2024, 12, 2147. https://doi.org/10.3390/microorganisms12112147
Kim W-J, Jung G, Kim T, Kim J, Hurh B-S, Kim H, Soung DY. Heat-Killed Lactobacillus paracasei SMB092 Reduces Halitosis by Stimulating the Expression of β-Defensins in Oral Keratinocytes. Microorganisms. 2024; 12(11):2147. https://doi.org/10.3390/microorganisms12112147
Chicago/Turabian StyleKim, Won-Ju, Gyubin Jung, Taewook Kim, Jinseon Kim, Byung-Serk Hurh, Hangeun Kim, and Do Yu Soung. 2024. "Heat-Killed Lactobacillus paracasei SMB092 Reduces Halitosis by Stimulating the Expression of β-Defensins in Oral Keratinocytes" Microorganisms 12, no. 11: 2147. https://doi.org/10.3390/microorganisms12112147
APA StyleKim, W.-J., Jung, G., Kim, T., Kim, J., Hurh, B.-S., Kim, H., & Soung, D. Y. (2024). Heat-Killed Lactobacillus paracasei SMB092 Reduces Halitosis by Stimulating the Expression of β-Defensins in Oral Keratinocytes. Microorganisms, 12(11), 2147. https://doi.org/10.3390/microorganisms12112147
 
        



 
       