Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Tick Collection and Identification
2.3. DNA Extraction
2.3.1. Rickettsia Screening
2.3.2. DNA Barcoding of H. intermedia
2.4. PCR Methods
2.4.1. Multilocus Sequence Typing (MLST)
2.4.2. DNA Barcoding
2.5. DNA Sequencing and Analysis
2.5.1. Rickettsial DNA Sequences
2.5.2. H. intermedia COI Sequences
3. Results
3.1. Detection of Rickettsial Pathogen
3.2. DNA Barcoding of Haemaphysalis intermedia
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mysterud, A.; Jore, S.; Østerås, O.; Vijiugrein, H. Emergence of tick-borne diseases at northern latitudes in Europe: A comparative approach. Sci. Rep. 2017, 7, 16316. [Google Scholar] [CrossRef] [Scilit]
- Rochlin, I.; Toledo, A. Emerging tick-borne pathogens of public health importance: A mini-review. J. Med. Microbiol. 2020, 69, 781–791. [Google Scholar] [CrossRef] [Scilit]
- Springer, A.; Glass, A.; Topp, A.K.; Strube, C. Zoonotic tick-borne pathogens in temperate and cold regions of Europe—A review on the prevalence in domestic animals. Front. Vet. Sci. 2020, 7, 604910. [Google Scholar] [CrossRef] [Scilit]
- Ogden, N.H.; Mechai, S.; Margos, G. Changing geographic ranges of ticks and tick-borne pathogens: Drivers, mechanisms and consequences for pathogen diversity. Fron. Cell. Infect. Microbiol. 2013, 3, 46. [Google Scholar] [CrossRef] [Scilit]
- Molaei, G.; Little, E.A.H.; Williams, S.C.; Stafford, K.C. Bracing for the Worst—Range Expansion of the Lone Star Tick in the Northeastern United States. N. Engl. J. Med. 2019, 381, 2189–2192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eisen, R.J.; Paddock, C.D. Tick and tick borne pathogen surveillance as a public health tool in the United States. J. Med. Entomol. 2021, 58, 1490–1502. [Google Scholar] [CrossRef] [Scilit]
- Low, V.L.; Tan, T.K.; Khoo, J.J.; Lim, F.S.; Abu Bakar, S. An overview of rickettsiae in Southeast Asia: Vector-animal-human interface. Acta Trop. 2020, 202, 105282. [Google Scholar] [CrossRef] [Scilit]
- Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.-E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [Scilit]
- de la Fuente, J.; Antunes, S.; Bonnet, S.; Cabezas-Cruz, A.; Domingos, A.G.; Estrda-Pena, A.; Johnson, N.; Kocan, K.M.; Mansfield, K.L.; Nijhof, A.M.; et al. Tick-Pathogen Interactions and Vector Competence: Identification of Molecular Drivers for Tick-Borne Diseases. Front. Cell. Infect. Microbiol. 2017, 7, 114. [Google Scholar] [CrossRef] [Scilit]
- Krishnamoorthi, S.; Goel, S.; Kaur, J.; Bisht, K.; Biswal, M. A Review of Rickettsial Diseases Other Than Scrub Typhus in India. Trop. Med. Infect. Dis. 2023, 8, 280. [Google Scholar] [CrossRef] [Scilit]
- Raoult, D. A new rickettsial disease in the United States. Clin. Infect. Dis. 2004, 38, 812–813. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Nagar, G. Problem of ticks and tick-borne diseases in India with special emphasis on progress in tick control research: A review. J. Vector Borne Dis. 2014, 51, 259. [Google Scholar]
- Rickettsia Threat Reduction Network. Global Burden of Rickettsial Diseases. Available online: https://www.rickettsia.net/infocat.aspx?pageID=104&contentID=1040102 (accessed on 15 June 2022).
- Chaisiri, K.; Tanganuchitcharnchai, A.; Kritiyakan, A.; Thinphovong, C.; Tanita, M.; Morand, S.; Blacksell, S.D. Risk factors analysis for neglected human rickettsiosis in rural communities in Nan province, Thailand: A community-based observational study along a landscape gradient. PLoS Negl. Trop. Dis. 2022, 16, e0010256. [Google Scholar] [CrossRef] [Scilit]
- Prakash, J.A.J.; SohanLal, T.; Rosemol, V.; Verghese, V.P.; Pulimood, S.A.; Reller, M.; Dumler, J.S. Molecular detection and analysis of spotted fever group Rickettsia in patients with fever and rash at a tertiary care centre in Tamil Nadu, India. Path. Glob Health 2012, 106, 40–45. [Google Scholar] [CrossRef] [Scilit]
- Khan, S.; Bora, T.; Richards, A. Human Rickettsia felis infection in India. J. Vector Borne Dis. 2020, 57, 187. [Google Scholar] [CrossRef] [Scilit]
- Biswal, M.; Krishnamoorthi, S.; Bisht, K.; Sehgal, A.; Kaur, J.; Sharma, N. Rickettsial Diseases: Not Uncommon Causes of Acute Febrile Illness in India. Trop. Med. Infec. Dis. 2020, 5, 59. [Google Scholar] [CrossRef] [Scilit]
- Negi, T.; Kandari, L.S.; Arunachalam, K. Update on prevalence and distribution pattern of tick-borne diseases among humans in India: A review. Parasitol. Res. 2021, 120, 1523–1539. [Google Scholar] [CrossRef] [Scilit]
- Perera, L.P.; Peiris, J.S.; Weilgama, D.J. Nairobi sheep disease virus isolated from Haemaphysalis intermedia ticks collected in Sri Lanka. Ann. Trop. Med. Parasitol. 1996, 90, 91–93. [Google Scholar] [CrossRef] [Scilit]
- Sharma, A.; Mishra, B. Rickettsial disease existence in India: Resurgence in outbreaks with the advent of 20th century. Indian J. Health Sci. Biomed. Res. 2020, 13, 5. [Google Scholar] [CrossRef] [Scilit]
- Mathai, E.; Lloyd, G.; Cherian, T.; Abraham, O.C.; Cherian, A.M. Serological evidence for the continued presence of human rickettsiosis in southern India. Ann. Trop. Med. Parasitol. 2001, 95, 395–398. [Google Scholar] [CrossRef] [Scilit]
- Kamarasu, K.; Malathi, M.; Rajagopal, V.; Subramani, K.; Jagadeeshramasamy, D.; Mathai, E. Serological evidence for wide distribution of spotted fevers & typhus fever in Tamil Nadu. Ind. J. Med. Res. 2007, 126, 128–130. [Google Scholar]
- Kalal, B.S.; Puranik, P.; Nagaraj, S.; Rego, S.; Shet, A. Scrub typhus and spotted fever among hospitalised children in South India: Clinical profile and serological epidemiology. Ind. J. Med. Microbiol. 2016, 34, 293–298. [Google Scholar] [CrossRef] [Scilit]
- Maiden, M.C.J.; Bygraves, J.A.; Feil, E.; Morelli, G.; Russell, J.E.; Urwin, R.; Zhang, Q.; Zhou, J.; Zurth, K.; Caught, D.A.; et al. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA 1998, 95, 3140–3145. [Google Scholar] [CrossRef] [Scilit]
- Leclerque, A. A Rickettsiella bacterium from the hard tick, Ixodes woodi: Molecular taxonomy combining multilocus sequence typing (MLST) with significance testing. PLoS. ONE 2012, 7, e38062. [Google Scholar] [CrossRef] [Scilit]
- Geevargheese, G.; Mishra, A.C. Haemaphysalis Ticks of India, 1st ed.; Elsevier: London, UK, 2011; Chapter 2.7.12 Haemaphysalis intermedia. [Google Scholar]
- Sharif, M.A. Revision of the Indian Ixodidae with special reference to the collection in the Indian Museum. Rec. Zool. Surv. India 1928, 30, 217–344. [Google Scholar] [CrossRef] [Scilit]
- Santibáñez, S.; Portillo, A.; Santibáñez, P.; Palomar, A.M.; Oteo, J.A. Usefulness of Rickettsial PCR assays for the molecular diagnosis of human rickettsiosis. Enferm. Infec. Microbiol. Clin. 2013, 31, 283–288. [Google Scholar] [CrossRef] [Scilit]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Clow, K.M.; Leighton, P.A.; Pearl, D.L.; Jardine, C.M. A framework for adaptive surveillance of emerging tick-borne zoonosis. One Health 2019, 7, 100083. [Google Scholar] [CrossRef] [Scilit]
- Johnson, N.; Phipps, L.P.; Hansford, K.M.; Folly, A.J.; Fooks, A.R.; Medlock, J.M.; Mansfield, K.L. One Health Approach to Tick and Tick-Borne Disease Surveillance in the United Kingdom. Int. J. Environ. Res. Public Health 2022, 19, 5833. [Google Scholar] [CrossRef] [Scilit]
- Salje, J.; Weitzel, T.; Newton, P.N.; Varghese, G.M.; Day, N. Rickettsial infections: A blind spot in our view of neglected tropical diseases. PLoS Neg. Trop. Dis. 2021, 15, e0009353. [Google Scholar] [CrossRef] [Scilit]
- Stewart, A.; Armstrong, M.; Graves, S.; Hajkowicz, K. Clinical manifestations and outcomes of Rickettsia australis infection: A 15-year retrospective study of hospitalized patients. Trop. Med. Infec. Dis. 2017, 2, 19. [Google Scholar] [CrossRef] [Scilit]
- Krishnamoorthi, R.; Govindarajan, R.; Elango, A.; Rajamannar, V.; Samuel, P.P. Species composition of hard ticks (Acari: Ixodidae) on domestic animals and their public health importance in Tamil Nadu, South India. Acarol. Stud. 2021, 3, 16–21. [Google Scholar]
- Li, H.; Zhang, P.H.; Huang, Y.; Du, J.; Cui, N.; Yang, Z.D.; Tang, F.; Fu, F.X.; Li, X.M.; Cui, X.M.; et al. Isolation and identification of Rickettsia raoultii in human cases: A surveillance study in 3 medical centers in China. Clin. Infect. Dis. 2018, 66, 1109–1115. [Google Scholar] [CrossRef] [Scilit]
- Fournier, P.E.; Dumler, J.S.; Greub, G.; Zhang, J.; Wu, Y.; Raoult, D. Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J. Clin. Microbiol. 2003, 41, 5456–5465. [Google Scholar] [CrossRef] [Scilit]
- Ellison, D.W.; Clark, T.R.; Sturdevant, D.E.; Virtaneva, K.; Porcella, S.F.; Hackstadt, T. Genomic comparison of virulent Rickettsia rickettsii Sheila Smith and avirulent Rickettsia rickettsii Iowa. Infect. Immun. 2008, 76, 542–550. [Google Scholar] [CrossRef] [Scilit]
- Olivieri, E.; Wijnveld, M.; Bonga, M.; Manfredi, M.T.; Veronesi, F.; Jongejan, F. Transmission Rickettsia raoultii and Rickettsia massiliae DNA Dermacentor reticulatus and Rhipicephalus sanguineus (s.l.) ticks during artificial feeding. Parasites Vectors 2018, 11, 494. [Google Scholar] [CrossRef] [Scilit]
- Brown, L.D.; Macaluso, K.R. Rickettsia felis, an Emerging Flea-Borne Rickettsiosis. Curr. Trop. Med. Rep. 2016, 3, 27–39. [Google Scholar] [CrossRef] [Scilit]




| Gene | Primer Name | Sequence 5′ to 3′ | PCR Type | Thermal Cycler Conditions | Amplicon Size (bp) |
|---|---|---|---|---|---|
| 16s rDNA | fD1 Rc16S.452n | AGAGTTTGATCCTGGCTCAG AACGTCATTATCTTCCTTGC | Single-stage | 95 °C 4 min, 35 cycles (94 °C 1 min, 52 °C 50 s, 72 °C 1 min), 72 °C 7 min. | 426 |
| ompA | Rr190.70p Rr190.701n | ATGGCGAATATTTCTCCAAAA GTTCCGTTAATGGCAGCATCT | Semi- Nested | 95 °C 4 min, 35 cycles (94 °C 1 min, 50 °C 50 s, 72 °C 1 min), 72 °C 7 min. | 631 |
| Rr190.70p Rr190.602n | ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT | 95 °C 4 min, 35 cycles (94 °C 1 min, 50 °C 40 s, 72 °C 50 s), 72 °C 7 min. | 532 | ||
| ompB | rOmpB OF rOmpB OR | GTAACCGGAAGTATCGTTTCGTAA GCTTTATAACCAGCTAAACCACC | Nested | 95 °C 4 min, 35 cycles (94 °C 40 s, 52 °C 45 s, 72 °C 1 min), 72 °C 7 min. | 511 |
| rOmpB SFG IF rOmpB SFG IR | GTTTAATACGTGCTGCTAACCAA GGTTTGGCCCATATACCATAAG | 95 °C 4 min, 35 cycles (94 °C 40 s, 51 °C 45 s, 72 °C 1 min), 72 °C 7 min. | 420 | ||
| gltA | RpCS.877p RpCS.1258n | GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA | Nested | 95 °C 4 min, 37 cycles (94 °C 50 s, 50 °C 30 s, 72 °C 50 s), 72 °C 7 min. | 381 |
| RpCS.896p RpCS.1233n | GGCTAATGAAGCAGTGATAA GCGACGGTATACCCATAGC | 95 °C 4 min, 37 cycles (94 °C 50 s, 51 °C 30 s, 72 °C 50 s), 72 °C 7 min. | 337 |
| Stage/Sex | No. of Pool | No. of Ticks | No +ve | Host +ve | Gene Sequenced | Rickettsia spp. | |||
|---|---|---|---|---|---|---|---|---|---|
| rRNA | OmpA | OmpB | gltA | ||||||
| Larva | 6 | 30 | 0 | 0 | -ve | -ve | -ve | -ve | - |
| Nymph | 14 | 70 | 1 | Goat | -ve | -ve | Rickettsia spp. | -ve | Rickettsia spp. |
| Female | 8 | 40 | 1 | Cow | × | Rf | Rf | Rf | R. felis |
| Male | 38 | 190 | 2 | Goat | Rf, Rr | Rr * | Rr, Rf | Rr, Rf | R. felis, R. raoultii |
| Genes | Taxon | Isolation Source | GenBank Acc. No. | Nucleotide Identity (%) | Closest Match in GenBank | Cut-Off Value (%) |
|---|---|---|---|---|---|---|
| R. conorii subsp. raoultii | ||||||
| 16s rDNA | R. conorii subsp. raoultii | H. intermedia | OP185249 | Present study | Present study | rrs > 98.1% (97.7–98.1) with at least one Rickettsia species |
| Rickettsia sp. | Sheep | KT733036 | 99.32 | Spain | ||
| R. conorii subsp. raoultii | D. reticulatus | MK304546 | 99.08 | Russia | ||
| H. asiaticum | KJ410261 | 99.08 | China | |||
| Homo sapiens | KY474575 | 98.86 | China | |||
| D. silvarum | CP098324 | 98.86 | China | |||
| rOmpA | R. conorii subsp. raoultii | H. intermedia | OK633269 | Present study | Present study | Either possess ompA or nucleotide homologies with gltA ≥ 92.7% & ompB ≥85.2% |
| Rickettsial sp. | D. marginatus | MG920563 | 93.38% | Turkey | ||
| R. conorii subsp. raoultii | D. nuttalli | KU361216 | 93.38% | Mongolia | ||
| I. ovatus | KX446992 | 93.38% | China | |||
| D. niveus | JQ792153 | 93.37% | Tibet | |||
| rOmpB | R. raoultii | H. intermedia | OK633270 | Present study | Present study | ≥85.8% |
| Rickettsia conorii | R. sanguineus | AF123726 | 97.39% | France | ||
| R. conorii raoultii | D.niveus | JQ792105 | 96.1% | Tibet | ||
| D. everestianus | JQ792107 | 96.1% | Tibet | |||
| Human Blood | KC847318 | 97.09% | Italy | |||
| gltA | R. conorii subsp. raoultii | H. intermedia | OK633271 | Present study | Present study | ≥92.7% |
| Rickettsial sp. | Dog blood | MT050445 | 98.57% | USA | ||
| R. conorii subsp. raoultii | D. marginatus | KU723493 | 98.29% | China | ||
| D. nuttalli | MT178338 | 98% | China | |||
| Human blood | MH267733 | 98% | Japan | |||
| Rickettsia felis | ||||||
| 16 s rDNA | R. felis | H. intermedia | OP185250 | Present study | Present study | rrs > 98.1% (97.7–98.1) with at least one Rickettsia species |
| Rickettsia species | ESTEC HYDRA facility | EU071486 | 99.54% | Germany | ||
| R. felis | Cultured | CP000053 | 99.54% | USA | ||
| Rickettsia endosymbiont | L. bostrychophila | DQ407743 | 99.31% | China | ||
| R. felis | C. felis | MF303722 | 99.08 | Mexico | ||
| rOmpA | R. felis | H. intermedia | OM675977 | Present study | Present study | Either possess ompA or pairwise nucleotide homologies with gltA ≥ 92.7% & ompB ≥85.2% |
| C. felis | AJ563398 | 100% | Mexico | |||
| C. felis | AY727036 | 99.6% | USA | |||
| Infested fleas | EU012496 | 99.6% | Mexico | |||
| L. bostrychophila | HM636635 | 99.6% | USA | |||
| Human Blood | KP318094 | 99.4% | Bangladesh | |||
| rOmpB | R. felis | H. intermedia | OM675973 | Present study | Present study | ≥85.8% |
| H. intermedia | OM675974 | Present study | Present study | |||
| Ixodes ricinus | MK301596 | 100% | Spain | |||
| Dog Blood | MG451836 | 99.72% | Italy | |||
| AF182279 | 99.72% | USA | ||||
| R. sanguineus | JF751024 | 99.15% | Chile | |||
| GltA | R. felis | H. intermedia | OM675975 | Present study | Present study | 92.7% |
| H. intermedia | OM675976 | Present study | Present study | |||
| Booklice | MG818715 | 99.41% | China | |||
| Cat flea | MG893575 | Malta | ||||
| C. felis | MF374381 | Austria | ||||
| Xenopsylla cheopis | KX446943 | Brazil | ||||
| Ixodes granulatus | MT847619 | Taiwan | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nallan, K.; Ayyavu, V.; Ayyanar, E.; Thirupathi, B.; Gupta, B.; Devaraju, P.; Kumar, A.; Rajaiah, P. Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India. Microorganisms 2023, 11, 1713. https://doi.org/10.3390/microorganisms11071713
Nallan K, Ayyavu V, Ayyanar E, Thirupathi B, Gupta B, Devaraju P, Kumar A, Rajaiah P. Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India. Microorganisms. 2023; 11(7):1713. https://doi.org/10.3390/microorganisms11071713
Chicago/Turabian StyleNallan, Krishnamoorthy, Veerapathiran Ayyavu, Elango Ayyanar, Balaji Thirupathi, Bhavna Gupta, Panneer Devaraju, Ashwani Kumar, and Paramasivan Rajaiah. 2023. "Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India" Microorganisms 11, no. 7: 1713. https://doi.org/10.3390/microorganisms11071713
APA StyleNallan, K., Ayyavu, V., Ayyanar, E., Thirupathi, B., Gupta, B., Devaraju, P., Kumar, A., & Rajaiah, P. (2023). Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India. Microorganisms, 11(7), 1713. https://doi.org/10.3390/microorganisms11071713
