A Genetically Engineered Escherichia coli for Potential Utilization in Fungal Smut Disease Control
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Strains and Culture Conditions
2.2. Construction of JMT Expression Plasmid
2.3. Total RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
2.4. JMT Gene Induction
2.5. MeJA or JA Detection
2.6. Pathogenicity Assays
3. Results
3.1. MeJA Suppresses S. scitamineum Mating/Filamentation
3.2. MeJA Suppresses Maize Smut Disease Symptom in Pot Experiment
3.3. Construction of Escherichia coli Expressing Plant JMT Gene
3.4. Utilization of E. coli pJMT Strain in Controlling Smut Diseases
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bhuiyan, S.A.; Magarey, R.C.; McNeil, M.D.; Aitken, K.S. Sugarcane Smut, Caused by Sporisorium scitamineum, a Major Disease of Sugarcane: A Contemporary Review. Phytopathology 2021, 111, 1905–1917. [Google Scholar] [CrossRef]
- Rajput, M.A.; Rajput, N.A.; Syed, R.N.; Lodhi, A.M.; Que, Y. Sugarcane Smut: Current Knowledge and the Way Forward for Management. J. Fungi 2021, 7, 1095. [Google Scholar] [CrossRef]
- Agisha, V.N.; Nalayeni, K.; Ashwin, N.M.R.; Vinodhini, R.T.; Jeyalekshmi, K.; Suraj Kumar, M.; Ramesh Sundar, A.; Malathi, P.; Viswanathan, R. Molecular Discrimination of Opposite Mating Type Haploids of Sporisorium scitamineum and Establishing Their Dimorphic Transitions During Interaction with Sugarcane. Sugar Tech. 2022, 24, 1430–1440. [Google Scholar] [CrossRef]
- Zuo, W.; Okmen, B.; Depotter, J.R.L.; Ebert, M.K.; Redkar, A.; Misas Villamil, J.; Doehlemann, G. Molecular Interactions Between Smut Fungi and Their Host Plants. Annu. Rev. Phytopathol. 2019, 57, 411–430. [Google Scholar] [CrossRef]
- Kijpornyongpan, T.; Aime, M.C. Investigating the Smuts: Common Cues, Signaling Pathways, and the Role of MAT in Dimorphic Switching and Pathogenesis. J. Fungi 2020, 6, 368. [Google Scholar] [CrossRef]
- Spellig, T.; Bolker, M.; Lottspeich, F.; Frank, R.W.; Kahmann, R. Pheromones trigger filamentous growth in Ustilago maydis. Embo J. 1994, 13, 1620–1627. [Google Scholar] [CrossRef]
- Yan, M.; Dai, W.; Cai, E.; Deng, Y.Z.; Chang, C.; Jiang, Z.; Zhang, L.H. Transcriptome analysis of Sporisorium scitamineum reveals critical environmental signals for fungal sexual mating and filamentous growth. BMC Genom. 2016, 17, 354. [Google Scholar] [CrossRef]
- Sun, S.; Deng, Y.; Cai, E.; Yan, M.; Li, L.; Chen, B.; Chang, C.; Jiang, Z. The Farnesyltransferase Beta-Subunit Ram1 Regulates Sporisorium scitamineum Mating, Pathogenicity and Cell Wall Integrity. Front. Microbiol. 2019, 10, 976. [Google Scholar] [CrossRef]
- Deng, Y.Z.; Zhang, B.; Chang, C.Q.; Wang, Y.X.; Lu, S.; Sung, S.Q.; Zhang, X.M.; Chen, B.S.; Jiang, Z.D. The MAP Kinase SsKpp2 Is Required for Mating/Filamentation in Sporisorium scitamineum. Front. Microbiol. 2018, 9, 2555. [Google Scholar] [CrossRef]
- Chang, C.; Cai, E.; Deng, Y.Z.; Mei, D.; Qiu, S.; Chen, B.; Zhang, L.H.; Jiang, Z. cAMP/PKA signalling pathway regulates redox homeostasis essential for Sporisorium scitamineum mating/filamentation and virulence. Environ. Microbiol. 2019, 21, 959–971. [Google Scholar] [CrossRef]
- Cai, E.; Li, L.; Deng, Y.; Sun, S.; Jia, H.; Wu, R.; Zhang, L.; Jiang, Z.; Chang, C. MAP kinase Hog1 mediates a cytochrome P450 oxidoreductase to promote the Sporisorium scitamineum cell survival under oxidative stress. Environ. Microbiol. 2021, 23, 3306–3317. [Google Scholar] [CrossRef]
- Mousavi, S.R.; Niknejad, Y.; Fallah, H.; Tari, D.B. Methyl jasmonate alleviates arsenic toxicity in rice. Plant Cell Rep. 2020, 39, 1041–1060. [Google Scholar] [CrossRef]
- Krol, P.; Igielski, R.; Pollmann, S.; Kepczynska, E. Priming of seeds with methyl jasmonate induced resistance to hemi-biotroph Fusarium oxysporum f.sp. lycopersici in tomato via 12-oxo-phytodienoic acid, salicylic acid, and flavonol accumulation. J. Plant Physiol. 2015, 179, 122–132. [Google Scholar] [CrossRef]
- Farooq, M.A.; Gill, R.A.; Islam, F.; Ali, B.; Liu, H.; Xu, J.; He, S.; Zhou, W. Methyl Jasmonate Regulates Antioxidant Defense and Suppresses Arsenic Uptake in Brassica napus L. Front. Plant Sci. 2016, 7, 468. [Google Scholar] [CrossRef]
- Thomma, B.P.H.J.; Eggermonta, K.; Broekaerta, W.F.; Cammueab, B.P.A. Disease development of several fungi on Arabidopsis can be reduced by treatment with methyl jasmonate. Plant Physiol. Biochem. 2000, 38, 421–427. [Google Scholar] [CrossRef]
- Santino, A.; Taurino, M.; De Domenico, S.; Bonsegna, S.; Poltronieri, P.; Pastor, V.; Flors, V. Jasmonate signaling in plant development and defense response to multiple (a)biotic stresses. Plant Cell Rep. 2013, 32, 1085–1098. [Google Scholar] [CrossRef]
- Seo, H.S.; Song, J.T.; Cheong, J.J.; Lee, Y.H.; Lee, Y.W.; Hwang, I.; Lee, J.S.; Choi, Y.D. Jasmonic acid carboxyl methyltransferase: A key enzyme for jasmonate-regulated plant responses. Proc. Natl. Acad. Sci. USA. 2001, 98, 4788–4793. [Google Scholar] [CrossRef]
- Qi, J.; Li, J.; Han, X.; Li, R.; Wu, J.; Yu, H.; Hu, L.; Xiao, Y.; Lu, J.; Lou, Y. Jasmonic acid carboxyl methyltransferase regulates development and herbivory-induced defense response in rice. J. Integr. Plant Biol. 2016, 58, 564–576. [Google Scholar] [CrossRef]
- Yan, M.; Cai, E.; Zhou, J.; Chang, C.; Xi, P.; Shen, W.; Li, L.; Jiang, Z.; Deng, Y.Z.; Zhang, L.H. A Dual-Color Imaging System for Sugarcane Smut Fungus Sporisorium scitamineum. Plant Dis. 2016, 100, 2357–2362. [Google Scholar] [CrossRef]
- Yang, B.; Zheng, P.; Wu, D.; Chen, P. Efficient Biosynthesis of Raspberry Ketone by Engineered Escherichia coli Coexpressing Zingerone Synthase and Glucose Dehydrogenase. J. Agric. Food Chem. 2021, 69, 2549–2556. [Google Scholar] [CrossRef]
- Zhang, C.; Liu, L.; Teng, L.; Chen, J.; Liu, J.; Li, J.; Du, G.; Chen, J. Metabolic engineering of Escherichia coli BL21 for biosynthesis of heparosan, a bioengineered heparin precursor. Metab. Eng. 2012, 14, 521–527. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Huang, N.; Ling, H.; Su, Y.; Liu, F.; Xu, L.; Su, W.; Wu, Q.; Guo, J.; Gao, S.; Que, Y. Transcriptional analysis identifies major pathways as response components to Sporisorium scitamineum stress in sugarcane. Gene. 2018, 678, 207–218. [Google Scholar] [CrossRef]
- Cui, G.; Yin, K.; Lin, N.; Liang, M.; Huang, C.; Chang, C.; Xi, P.; Deng, Y.Z. Burkholderia gladioli CGB10: A Novel Strain Biocontrolling the Sugarcane Smut Disease. Microorganisms. 2020, 8, 1943. [Google Scholar] [CrossRef]
- Yan, M.; Zhu, G.; Lin, S.; Xian, X.; Chang, C.; Xi, P.; Shen, W.; Huang, W.; Cai, E.; Jiang, Z.; et al. The mating-type locus b of the sugarcane smut Sporisorium scitamineum is essential for mating, filamentous growth and pathogenicity. Fungal. Genet. Biol. 2016, 86, 1–8. [Google Scholar] [CrossRef]
- Comstock, J.C. Sugarcane Smut: Comparison of Natural Infection Testing and Artificial Inoculation. Hawaii. Plant. Rec. 1987, 60, 17. [Google Scholar]
- Khan, H.M.W.A.; Chattha, A.A.; Munir, M.; Zia, A. Evaluation of resistance in sugarcane promising lines against whip smut. Pak. J. Phytopathol. 2009, 21, 92–93. [Google Scholar]
- Tadesse, A. Increasing Crop Prodcution through Improved Plant Protection; Ethiopian Institute of Agricultural Research: Addis Ababa, Ethiopia, 2009. [Google Scholar]
- Ming, R.; Moore, P.H.; Wu, K.K.; D’Hont, A.; Glaszmann, J.C.; Tew, T.L.; Mirkov, T.E.; da Silva, J.; Jifon, J.; Rai, M.; et al. Sugarcane Improvement through Breeding and Biotechnology. Plant Breed. Rev. 2010, 27, 15–118. [Google Scholar]
- Sundar, A.R.; Barnabas, E.L.; Malathi, P.; Viswanathan, R. A Mini-Review on Smut Disease of Sugarcane Caused by Sporisorium scitamineum. InTech Open. 2012, 5, 108–128. [Google Scholar]
- Shailbala; Sharma, S.K. Effect of fungicides and hot water treatment on control of sugarcane smut. Pestology 2013, 37, 29–32. [Google Scholar]
- Silva, J.A.; Sorrells, M.E.; Burnquist, W.L.; Tanksley, S.D. RFLP linkage map and genome analysis of Saccharum spontaneum. Genome 1993, 36, 782–791. [Google Scholar] [CrossRef] [PubMed]
- Burnquist, W.L.; Sorrelles, M.E. Characterization of Genetic Variability in Saccharum germplasm by Means of Restriction Fragment Length Polymorphism (RFLP) Analysis; FAO: Rome, Italy, 1995; pp. 355–366. [Google Scholar]
- Nelson, R.; Wiesner-Hanks, T.; Wisser, R.; Balint-Kurti, P. Navigating complexity to breed disease-resistant crops. Nat. Rev. Genet. 2018, 19, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Sundberg, E.; Ostergaard, L. Distinct and dynamic auxin activities during reproductive development. Cold Spring Harb. Perspect. Biol. 2009, 1, a001628. [Google Scholar] [CrossRef] [PubMed]
- Mah, K.M.; Uppalapati, S.R.; Tang, Y.H.; Allen, S.; Shuai, B. Gene expression profiling of Macrophomina phaseolina infected Medicago truncatula roots reveals a role for auxin in plant tolerance against the charcoal rot pathogen. Physiol. Mol. Plant Pathol. 2012, 79, 21–30. [Google Scholar] [CrossRef]
- Chen, Z.; Agnew, J.L.; Cohen, J.D.; He, P.; Shan, L.; Sheen, J.; Kunkel, B.N. Pseudomonas syringae type III effector AvrRpt2 alters Arabidopsis thaliana auxin physiology. Proc. Natl. Acad. Sci. USA. 2007, 104, 20131–20136. [Google Scholar] [CrossRef]
- Kidd, B.N.; Kadoo, N.Y.; Dombrecht, B.; Tekeoglu, M.; Gardiner, D.M.; Thatcher, L.F.; Aitken, E.A.; Schenk, P.M.; Manners, J.M.; Kazan, K. Auxin signaling and transport promote susceptibility to the root-infecting fungal pathogen Fusarium oxysporum in Arabidopsis. Mol. Plant Microbe Interact. 2011, 24, 733–748. [Google Scholar] [CrossRef]
- Katagiri, F.; Tsuda, K. Understanding the plant immune system. Mol. Plant Microbe Interact. 2010, 23, 1531–1536. [Google Scholar] [CrossRef]
- Al-Daoude, A.; Al-Shehadah, E.; Shoaib, A.; Jawhar, M.; Arabi, M.I.E. Salicylic Acid Pathway Changes in Barley Plants Challenged with either a Biotrophic or a Necrotrophic Pathogen. Cereal. Res. Commun. 2019, 47, 324–333. [Google Scholar] [CrossRef]
- An, C.; Mou, Z. Salicylic acid and its function in plant immunity. J. Integr. Plant Biol. 2011, 53, 412–428. [Google Scholar] [CrossRef]
- Bower, N.I.; Casu, R.E.; Maclean, D.J.; Reverter, A.; Chapman, S.C.; Manners, J.M. Transcriptional response of sugarcane roots to methyl jasmonate. Plant Sci. 2005, 168, 761–772. [Google Scholar] [CrossRef]
- Seema, G.; Srivastava, M.K.; Srivastava, S.; Shrivastava, A.K. Effect of methyl jasmonate on sugarcane seedlings. Sugar Tech. 2003, 5, 189–191. [Google Scholar] [CrossRef]
- Ali, M.B.; Yu, K.W.; Hahn, E.J.; Paek, K.Y. Methyl jasmonate and salicylic acid elicitation induces ginsenosides accumulation, enzymatic and non-enzymatic antioxidant in suspension culture Panax ginseng roots in bioreactors. Plant Cell Rep. 2006, 25, 613–620. [Google Scholar] [CrossRef] [PubMed]
- Keramat, B.; Kalantari, K.; Arvin, M. Effects of methyl jasmonate in regulating cadmium induced oxidative stress in soybean plant (Glycine max L.). Afr. J. Microbiol. Res. 2009, 3, 240–244. [Google Scholar]
- Garde-Cerdan, T.; Portu, J.; Lopez, R.; Santamaria, P. Effect of methyl jasmonate application to grapevine leaves on grape amino acid content. Food Chem. 2016, 203, 536–539. [Google Scholar] [CrossRef]
- Lu, S.; Shen, X.; Chen, B. Development of an efficient vector system for gene knock-out and near in-cis gene complementation in the sugarcane smut fungus. Sci. Rep. 2017, 7, 3113. [Google Scholar] [CrossRef] [PubMed]






| Primer | Sequence (5′-3′) | Notes |
|---|---|---|
| Actin-F | CAGCTCGATGAAGGTCAAGAT | qRT-PCR |
| Actin-R | CAGCTCGATGAAGGTCAAGAT | |
| Q-bE1-F | CCAACGACGAAAGCGCGACG | |
| Q-bE1-R | GACTCTCTGCGAGCGGGCAT | |
| Q-bE2-F | CCAACGACGAAAGCGCGACG | |
| Q-bE2-R | GACTCTCTGCGAGCGGGCAT | |
| Q-bW1-F | CGAGAAAGGCACACAACGTC | |
| Q-bW1-R | CACCTTTTGGGGAGTTCCGA | |
| Q-bW2-F | TGTTGATGAGCCAGTGCCTT | |
| Q-bW2-R | AGTTCCGACTGGCTGAAGTG | |
| Pra2-P1F | GAAGAGCCTCAGCCGTTATAC | |
| Pra2-P1R | GGGTTCCCTTACTGAACCTTAG | |
| Q-PCR-Mfa1-F | ATGCTTTCCATCTTTACCCAGA | |
| Q-PCR-Mfa1-R | GTGCAGCTAGAGTAGCCAAG | |
| Mfa2-P1F | CGTCCAGGCCATTGTTTCT | |
| Mfa2-P1R | TAGGCCACGGTGCAGTA | |
| Q-PCR-Pra1-F | GGACGCTATCACCCAATCTTAC | |
| Q-PCR-Pra1-R | TCTCCAACATGGCAACACTC | |
| pJMT-F | GAATTCATGGAGGTAATGCGA | Red front denotes restriction enzyme sites used for plasmid construction |
| pJMT-R | GTCGACTCAACCGGTTCTAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, G.; Bi, X.; Lu, S.; Jiang, Z.; Deng, Y. A Genetically Engineered Escherichia coli for Potential Utilization in Fungal Smut Disease Control. Microorganisms 2023, 11, 1564. https://doi.org/10.3390/microorganisms11061564
Cui G, Bi X, Lu S, Jiang Z, Deng Y. A Genetically Engineered Escherichia coli for Potential Utilization in Fungal Smut Disease Control. Microorganisms. 2023; 11(6):1564. https://doi.org/10.3390/microorganisms11061564
Chicago/Turabian StyleCui, Guobing, Xinping Bi, Shan Lu, Zide Jiang, and Yizhen Deng. 2023. "A Genetically Engineered Escherichia coli for Potential Utilization in Fungal Smut Disease Control" Microorganisms 11, no. 6: 1564. https://doi.org/10.3390/microorganisms11061564
APA StyleCui, G., Bi, X., Lu, S., Jiang, Z., & Deng, Y. (2023). A Genetically Engineered Escherichia coli for Potential Utilization in Fungal Smut Disease Control. Microorganisms, 11(6), 1564. https://doi.org/10.3390/microorganisms11061564

