Latest Advances in Arbovirus Diagnostics
Abstract
1. Introduction
2. Arbovirus Disease in Humans and Animals
3. Arbovirus Diagnostic Approaches
3.1. Serology
3.2. Next-Generation Sequencing (NGS)
3.3. Reverse Transcriptase PCR (RT-PCR)
Sample-to-Answer RT-PCR Systems
- To produce RT-PCR assays compatible with POC applications, several sample-to-answer devices have been developed, including the GenXpert™ system (Cepheid, Sunnyvale, CA, USA), FilmArray® (Biofire, Salt Lake City, UT, USA), Sal6830 MicroGEM (Dale Avenue, Charlottesville, VA, USA) and the Cobas™ Liat™ system (Roche Diagnostics, Indianapolis, IN, USA). These systems are all-in-one devices that simultaneously extract and purify nucleic acids from clinical samples, perform PCR amplification and yield a positive/negative read-out at the end of the reaction. Typical run times are 30–60 min, and sensitivity can range from as low as 12 to 6.4 × 103 copies/mL [55]. Veredus laboratories (Science Park Drive, Singapore) have developed a RT-PCR-based POC system for research use only, VereFever™, which can diagnose the presence of CHIKV, DENV 1–4, JEV, WNV, YFV and ZIKV on a single chip, making it the most comprehensive commercially developed system for arbovirus diagnostics. Although these systems are promising for POC and fieldwork applications in general, they are expensive, with reagent costs greater than USD 100 per sample.
4. Isothermal Amplification Technologies
4.1. Strand Displacement Amplification (SDA)/Nicking Endonuclease Amplification Reaction (NEAR)
4.2. Nucleic Acid Sequenced-Based Amplification (NASBA)
4.3. Helicase Dependant Amplification (HDA)
4.4. Loop Mediated AMPlification (LAMP)
4.5. Recombinase Polymerase Amplification (RPA)/Recombinase Aided Amplification (RAA)
5. Isothermal Amplification and Arbovirus Diagnostics
6. Point of Care Diagnostics
6.1. Lab on a Chip
6.2. Lab on a Disc (LOAD)
6.3. Microfluidic Paper-Based Analytical Devices (µPADs)
6.4. Lateral Flow Devices
6.5. CRISPR-CAS12/13
7. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Socha, W.; Kwasnik, M.; Larska, M.; Rola, J.; Rozek, W. Vector-Borne Viral Diseases as a Current Threat for Human and Animal Health—One Health Perspective. J. Clin. Med. 2022, 11, 3026. [Google Scholar] [CrossRef] [PubMed]
- Souza, J.H.M.; Barros, T.B.; Almeida, P.P.; Vieira, S.C.; Melo, F.F.; Silva, R.A.; Tomazi, L. Dynamics of Transmission of Urban Arbovirus Dengue, Zika and Chikungunya in Southwestern Region of Bahia, Brazil. An. Acad. Bras. Ciênc. 2021, 93, e20200670. [Google Scholar] [CrossRef] [PubMed]
- Cappai, S.; Rolesu, S.; Loi, F.; Liciardi, M.; Leone, A.; Marcacci, M.; Teodori, L.; Mangone, I.; Sghaier, S.; Portanti, O.; et al. Western Bluetongue virus serotype 3 in Sardinia, diagnosis and characterization. Transbound. Emerg. Dis. 2019, 66, 1426–1431. [Google Scholar] [CrossRef] [PubMed]
- Sardi, S.I.; Somasekar, S.; Naccache, S.N.; Bandeira, A.C.; Tauro, L.B.; Campos, G.S.; Chiu, C.Y. Coinfections of Zika and Chikungunya Viruses in Bahia, Brazil, Identified by Metagenomic Next-Generation Sequencing. J. Clin. Microbiol. 2016, 54, 2348–2353. [Google Scholar] [CrossRef]
- Wilson, M.R.; Zimmermann, L.L.; Crawford, E.D.; Sample, H.A.; Soni, P.R.; Baker, A.N.; Khan, L.M.; De Risi, J.L. Acute West Nile Virus Meningoencephalitis Diagnosed Via Metagenomic Deep Sequencing of Cerebrospinal Fluid in a Renal Transplant Patient. Am. J. Transplant. 2017, 17, 803–808. [Google Scholar] [CrossRef]
- Huremović, D. Brief History of Pandemics (Pandemics Throughout History). In Psychiatry of Pandemics; Springer: Cham, Switzerland, 2019; pp. 7–35. [Google Scholar] [CrossRef]
- Pierson, T.C.; Diamond, M.S. The continued threat of emerging flaviviruses. Nat. Microbiol. 2020, 5, 796–812. [Google Scholar] [CrossRef]
- Liang, G.; Gao, X.; Gould, E.A. Factors responsible for the emergence of arboviruses; strategies, challenges and limitations for their control. Emerg. Microbes Infect. 2015, 4, e18. [Google Scholar] [CrossRef]
- De Figueiredo, M.L.G.; Figueiredo, L.T.M. Emerging alphaviruses in the Americas: Chikungunya and Mayaro. Rev. Soc. Bras. Med. Trop. 2014, 47, 677–683. [Google Scholar] [CrossRef]
- Plourde, A.R.; Bloch, E.M. A Literature Review of Zika Virus. Emerg. Infect. Dis. 2016, 22, 1185–1192. [Google Scholar] [CrossRef]
- Waggoner, J.J.; Rojas, A.; Pinsky, B.A. Yellow Fever Virus: Diagnostics for a Persistent Arboviral Threat. J. Clin. Microbiol. 2018, 56, e00827-18. [Google Scholar] [CrossRef]
- Harapan, H.; Michie, A.; Sasmono, R.T.; Imrie, A. Dengue: A Minireview. Viruses 2020, 12, 829. [Google Scholar] [CrossRef] [PubMed]
- Rossi, S.L.; Ross, T.M.; Evans, J.D. West Nile Virus. Clin. Lab. Med. 2010, 30, 47–65. [Google Scholar] [CrossRef] [PubMed]
- Mulvey, P.; Duong, V.; Boyer, S.; Burgess, G.; Williams, D.T.; Dussart, P.; Horwood, P.F. The Ecology and Evolution of Japanese Encephalitis Virus. Pathogens 2021, 10, 1534. [Google Scholar] [CrossRef]
- Bogovic, P.; Strle, F. Tick-borne encephalitis: A review of epidemiology, clinical characteristics, and management. World J. Clin. Cases 2015, 3, 430–441. [Google Scholar] [CrossRef] [PubMed]
- Wagner, E.; Shin, A.; Tukhanova, N.; Turebekov, N.; Nurmakhanov, T.; Sutyagin, V.; Berdibekov, A.; Maikanov, N.; Lezdinsh, I.; Shapiyeva, Z.; et al. First Indications of Omsk Haemorrhagic Fever Virus beyond Russia. Viruses 2022, 14, 754. [Google Scholar] [CrossRef]
- Diaz, A.; Coffey, L.L.; Burkett-Cadena, N.; Day, J.F. Reemergence of St. Louis Encephalitis Virus in the Americas. Emerg. Infect. Dis. 2018, 24, 2150–2157. [Google Scholar] [CrossRef]
- Mourya, D.; Munivenkatappa, A.; Sahay, R.; Yadav, P.; Viswanathan, R. Clinical & epidemiological significance of Kyasanur forest disease. Indian J. Med. Res. 2018, 148, 145–150. [Google Scholar] [CrossRef]
- Cavalcanti, T.Y.V.d.L.; Pereira, M.R.; de Paula, S.O.; Franca, R.F.D.O. A Review on Chikungunya Virus Epidemiology, Pathogenesis and Current Vaccine Development. Viruses 2022, 14, 969. [Google Scholar] [CrossRef]
- LaBeaud, A.D.; Banda, T.; Brichard, J.; Muchiri, E.M.; Mungai, P.L.; Mutuku, F.M.; Borland, E.; Gildengorin, G.; Pfeil, S.; Teng, C.Y.; et al. High Rates of O’Nyong Nyong and Chikungunya Virus Transmission in Coastal Kenya. PLoS Negl. Trop. Dis. 2015, 9, e0003436, Erratum in PLoS Negl. Trop. Dis. 2015, 9, e0003674. [Google Scholar] [CrossRef]
- Qian, W.; Hurst, C.; Glass, K.; Harley, D.; Viennet, E. Spatial and Temporal Patterns of Ross River Virus in Queensland, 2001–2020. Trop. Med. Infect. Dis. 2021, 6, 145. [Google Scholar] [CrossRef]
- Corrin, T.; Ackford, R.; Mascarenhas, M.; Greig, J.; Waddell, L.A. Eastern Equine Encephalitis Virus: A Scoping Review of the Global Evidence. Vector-Borne Zoonotic Dis. 2021, 21, 305–320. [Google Scholar] [CrossRef] [PubMed]
- Calisher, C.H. Medically important arboviruses of the United States and Canada. Clin. Microbiol. Rev. 1994, 7, 89–116. [Google Scholar] [CrossRef] [PubMed]
- Guzmán-Terán, C.; Calderón-Rangel, A.; Rodriguez-Morales, A.; Mattar, S. Venezuelan equine encephalitis virus: The problem is not over for tropical America. Ann. Clin. Microbiol. Antimicrob. 2020, 19, 19. [Google Scholar] [CrossRef] [PubMed]
- Madzokere, E.T.; Qian, W.; Webster, J.A.; Walker, D.M.H.; Lim, E.X.Y.; Harley, D.; Herrero, L.J. Human Seroprevalence for Dengue, Ross River, and Barmah Forest viruses in Australia and the Pacific: A systematic review spanning seven decades. PLoS Negl. Trop. Dis. 2022, 16, e0010314. [Google Scholar] [CrossRef] [PubMed]
- Lledó, L.; Giménez-Pardo, C.; Gegúndez, M.I. Epidemiological Study of Thogoto and Dhori Virus Infection in People Bitten by Ticks, and in Sheep, in an Area of Northern Spain. Int. J. Environ. Res. Public Health 2020, 17, 2254. [Google Scholar] [CrossRef]
- Hartman, A. Rift Valley Fever. Clin. Lab. Med. 2017, 37, 285–301. [Google Scholar] [CrossRef]
- Omoga, D.C.A.; Tchouassi, D.P.; Venter, M.; Ogola, E.O.; Eibner, G.J.; Kopp, A.; Slothouwer, I.; Torto, B.; Junglen, S.; Sang, R. Circulation of Ngari Virus in Livestock, Kenya. Msphere 2022, 7, e0041622. [Google Scholar] [CrossRef]
- Seo, J.-W.; Kim, D.; Yun, N.; Kim, D.-M. Clinical Update of Severe Fever with Thrombocytopenia Syndrome. Viruses 2021, 13, 1213. [Google Scholar] [CrossRef]
- Hawman, D.W.; Feldmann, H. Recent advances in understanding Crimean–Congo hemorrhagic fever virus. F1000Research 2018, 7, 1715. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention (CDC). Human Jamestown canyon virus infection—Montana, 2009. MMWR Morb. Mortal. Wkly. Rep. 2011, 60, 652–655. [Google Scholar]
- Harding, S.; Greig, J.; Mascarenhas, M.; Young, I.; Waddell, L.A. La Crosse virus: A scoping review of the global evidence. Epidemiol. Infect. 2018, 147, E66. [Google Scholar] [CrossRef]
- Da Rosa, J.F.T.; De Souza, W.M.; De Paula Pinheiro, F.; Figueiredo, M.L.; Cardoso, J.F.; Acrani, G.O.; Nunes, M.R.T. Oropouche Virus: Clinical, Epidemiological, and Molecular Aspects of a Neglected Orthobunyavirus. Am. J. Trop. Med. Hyg. 2017, 96, 1019–1030. [Google Scholar] [CrossRef]
- Karabatsos, N. International Catalogue of Arthropod-Borne Viruses, 3rd ed.; American Society for Tropical Medicine and Hygiene: San Antonio, TX, USA, 1985. [Google Scholar]
- Madewell, Z.J. Arboviruses and Their Vectors. South. Med. J. 2020, 113, 520–523. [Google Scholar] [CrossRef]
- Beckham, J.D.; Tyler, K.L. Arbovirus Infections. Continuum 2015, 21, 1599–1611. [Google Scholar] [CrossRef] [PubMed]
- Lwande, O.W.; Obanda, V.; Lindström, A.; Ahlm, C.; Evander, M.; Näslund, J.; Bucht, G. Globe-Trotting Aedes aegypti and Aedes albopictus: Risk Factors for Arbovirus Pandemics. Vector-Borne Zoonotic Dis. 2020, 20, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Dengue 2015 Case Definition. Available online: https://ndc.services.cdc.gov/case-definitions/dengue-2015/ (accessed on 14 April 2023).
- Fischer, C.; Jo, W.K.; Haage, V.; Moreira-Soto, A.; Filho, E.F.D.O.; Drexler, J.F. Challenges towards serologic diagnostics of emerging arboviruses. Clin. Microbiol. Infect. 2021, 27, 1221–1229. [Google Scholar] [CrossRef] [PubMed]
- Chan, K.R.; Ismail, A.A.; Thergarajan, G.; Raju, C.S.; Yam, H.C.; Rishya, M.; Sekaran, S.D. Serological cross-reactivity among common flaviviruses. Front. Cell. Infect. Microbiol. 2022, 12, 975398. [Google Scholar] [CrossRef]
- Piantadosi, A.; Kanjilal, S. Diagnostic Approach for Arboviral Infections in the United States. J. Clin. Microbiol. 2020, 58, e01926-19. [Google Scholar] [CrossRef]
- Chaterji, S.; Allen, J.C., Jr.; Chow, A.; Leo, Y.-S.; Ooi, E.-E. Evaluation of the NS1 Rapid Test and the WHO Dengue Classification Schemes for Use as Bedside Diagnosis of Acute Dengue Fever in Adults. Am. J. Trop. Med. Hyg. 2011, 84, 224–228. [Google Scholar] [CrossRef]
- Batovska, J.; Mee, P.T.; Sawbridge, T.I.; Rodoni, B.C.; Lynch, S.E. Enhanced Arbovirus Surveillance with High-Throughput Metatranscriptomic Processing of Field-Collected Mosquitoes. Viruses 2022, 14, 2759. [Google Scholar] [CrossRef]
- Magurano, F.; Baggieri, M.; Gattuso, G.; Fortuna, C.; Remoli, M.E.; Vaccari, G.; Zaccaria, G.; Marchi, A.; Bucci, P.; Benedetti, E.; et al. Toscana Virus Genome Stability: Data from a Meningoencephalitis Case in Mantua, Italy. Vector-Borne Zoonotic Dis. 2014, 14, 866–869. [Google Scholar] [CrossRef] [PubMed]
- Chiu, C.Y.; Coffey, L.L.; Murkey, J.; Symmes, K.; Sample, H.; Wilson, M.; Naccache, S.N.; Arevalo, S.; Somasekar, S.; Federman, S.; et al. Diagnosis of Fatal Human Case of St. Louis Encephalitis Virus Infection by Metagenomic Sequencing, California, 2016. Emerg. Infect. Dis. 2017, 23, 1964–1968. [Google Scholar] [CrossRef] [PubMed]
- Souza, J.V.C.; Santos, H.d.O.; Leite, A.B.; Giovanetti, M.; Bezerra, R.D.S.; de Carvalho, E.; Bernardino, J.d.S.T.; Viala, V.L.; Haddad, R.; Ciccozzi, M.; et al. Viral Metagenomics for the Identification of Emerging Infections in Clinical Samples with Inconclusive Dengue, Zika, and Chikungunya Viral Amplification. Viruses 2022, 14, 1933. [Google Scholar] [CrossRef]
- Fuchs, J.; Lamkiewicz, K.; Kolesnikova, L.; Hölzer, M.; Marz, M.; Kochs, G. Comparative Study of Ten Thogotovirus Isolates and Their Distinct In Vivo Characteristics. J. Virol. 2022, 96, e0155621. [Google Scholar] [CrossRef] [PubMed]
- Ciuoderis, K.A.; Berg, M.G.; Perez, L.J.; Hadji, A.; Perez-Restrepo, L.S.; Aristizabal, L.C.; Forberg, K.; Yamaguchi, J.; Cardona, A.; Weiss, S.; et al. Oropouche virus as an emerging cause of acute febrile illness in Colombia. Emerg. Microbes Infect. 2022, 11, 2645–2657. [Google Scholar] [CrossRef] [PubMed]
- Murota, K.; Ishii, K.; Mekaru, Y.; Araki, M.; Suda, Y.; Shirafuji, H.; Kobayashi, D.; Isawa, H.; Yanase, T. Isolation of Culicoides- and Mosquito-Borne Orbiviruses in the Southwestern Islands of Japan Between 2014 and 2019. Vector-Borne Zoonotic Dis. 2021, 21, 796–808. [Google Scholar] [CrossRef]
- Hernández-Triana, L.M.; Garza-Hernández, J.A.; Morales, A.I.O.; Prosser, S.W.J.; Hebert, P.D.N.; Nikolova, N.I.; Barrero, E.; de Luna-Santillana, E.d.J.; González-Alvarez, V.H.; Mendez-López, R.; et al. An Integrated Molecular Approach to Untangling Host–Vector–Pathogen Interactions in Mosquitoes (Diptera: Culicidae) From Sylvan Communities in Mexico. Front. Vet. Sci. 2021, 7, 564791. [Google Scholar] [CrossRef]
- Brinkmann, A.; Uddin, S.; Krause, E.; Surtees, R.; Dinçer, E.; Kar, S.; Hacıoğlu, S.; Özkul, A.; Ergünay, K.; Nitsche, A. Utility of a Sequence-Independent, Single-Primer-Amplification (SISPA) and Nanopore Sequencing Approach for Detection and Characterization of Tick-Borne Viral Pathogens. Viruses 2021, 13, 203. [Google Scholar] [CrossRef]
- Batovska, J.; Lynch, S.E.; Cogan, N.O.I.; Brown, K.; Darbro, J.M.; Kho, E.A.; Blacket, M.J. Effective mosquito and arbovirus surveillance using metabarcoding. Mol. Ecol. Resour. 2018, 18, 32–40. [Google Scholar] [CrossRef] [PubMed]
- Diego, J.G.-B.; Fernández-Soto, P.; Domínguez-Gil, M.; Belhassen-García, M.; Bellido, J.; Muro, A. A Simple, Affordable, Rapid, Stabilized, Colorimetric, Versatile RT-LAMP Assay to Detect SARS-CoV-2. Diagnostics 2021, 11, 438. [Google Scholar] [CrossRef]
- Garae, C.; Kalo, K.; Pakoa, G.J.; Baker, R.; Isaacs, P.; Millar, D.S. Validation of the easyscreen flavivirus dengue alphavirus detection kit based on 3base amplification technology and its application to the 2016/17 Vanuatu dengue outbreak. PLoS ONE 2020, 15, e0227550. [Google Scholar] [CrossRef] [PubMed]
- Diego, J.G.-B.; Fernández-Soto, P.; Muro, A. The Future of Point-of-Care Nucleic Acid Amplification Diagnostics after COVID-19: Time to Walk the Walk. Int. J. Mol. Sci. 2022, 23, 14110. [Google Scholar] [CrossRef] [PubMed]
- Walker, G.T.; Little, M.C.; Nadeau, J.G.; Shank, D.D. Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system. Proc. Natl. Acad. Sci. USA 1992, 89, 392–396. [Google Scholar] [CrossRef] [PubMed]
- Walker, G.T.; Fraiser, M.S.; Schram, J.L.; Little, M.C.; Nadeau, J.G.; Malinowski, D.P. Strand displacement amplification—An isothermal, in vitro DNA amplification technique. Nucleic Acids Res. 1992, 20, 1691–1696. [Google Scholar] [CrossRef] [PubMed]
- Farfour, E.; Roux, A.; Ballester, M.; Gagneur, L.; Renaux, C.; Jolly, E.; Vasse, M. Improved performances of the second generation of the ID NOW influenza A&B 2® and comparison with the GeneXpert®. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 1681–1686. [Google Scholar] [CrossRef] [PubMed]
- Compton, J. Nucleic acid sequence-based amplification. Nature 1991, 350, 91–92. [Google Scholar] [CrossRef]
- Vincent, M.; Xu, Y.; Kong, H. Helicase-dependent isothermal DNA amplification. EMBO Rep. 2004, 5, 795–800. [Google Scholar] [CrossRef]
- Zasada, A.A.; Zacharczuk, K.; Formińska, K.; Wiatrzyk, A.; Ziółkowski, R.; Malinowska, E. Isothermal DNA amplification combined with lateral flow dipsticks for detection of biothreat agents. Anal. Biochem. 2018, 560, 60–66. [Google Scholar] [CrossRef]
- Lee, J.-E.; Kim, S.-A.; Park, H.-J.; Mun, H.; Ha, K.-S.; Shim, W.-B. Colorimetric detection of norovirus by helicase-dependent amplification method based on specific primers integrated with HRPzyme. Anal. Bioanal. Chem. 2022, 414, 6723–6733. [Google Scholar] [CrossRef]
- Zasada, A.A.; Mosiej, E.; Prygiel, M.; Polak, M.; Wdowiak, K.; Formińska, K.; Ziółkowski, R.; Żukowski, K.; Marchlewicz, K.; Nowiński, A.; et al. Detection of SARS-CoV-2 Using Reverse Transcription Helicase Dependent Amplification and Reverse Transcription Loop-Mediated Amplification Combined with Lateral Flow Assay. Biomedicines 2022, 10, 2329. [Google Scholar] [CrossRef]
- Shanmugakani, R.K.; Bonam, W.; Erickson, D.; Mehta, S. An isothermal amplification-based point-of-care diagnostic platform for the detection of Mycobacterium tuberculosis: A proof-of-concept study. Curr. Res. Biotechnol. 2021, 3, 154–159. [Google Scholar] [CrossRef] [PubMed]
- Gaydos, C.A.; Hobbs, M.; Marrazzo, J.; Schwebke, J.; Coleman, J.S.; Masek, B.; Dize, L.; Jang, D.; Li, J.; Chernesky, M. Rapid Diagnosis of Trichomonas vaginalis by Testing Vaginal Swabs in an Isothermal Helicase-Dependent AmpliVue Assay. Sex. Transm. Dis. 2016, 43, 369–373. [Google Scholar] [CrossRef] [PubMed]
- Escadafal, C.; Faye, O.; Sall, A.A.; Faye, O.; Weidmann, M.; Strohmeier, O.; Von Stetten, F.; Drexler, J.; Eberhard, M.; Niedrig, M.; et al. Rapid Molecular Assays for the Detection of Yellow Fever Virus in Low-Resource Settings. PLoS Negl. Trop. Dis. 2014, 8, e2730. [Google Scholar] [CrossRef] [PubMed]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef]
- Sherlock Biosciences Licenses Wyss Institute’s Ambient Nucleic Acid Amplification Technology from Harvard to Develop Highly Accurate, Low Cost Diagnostics for Point-of-Need. Available online: https://wyss.harvard.edu/news/sherlock-biosciences-licenses-wyss-institutes-ambient-nucleic-acid-amplification-technology-from-harvard-to-develop-highly-accurate-low-cost-diagnostics-for-point-of-need/ (accessed on 14 April 2023).
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef]
- Everitt, M.L.; Tillery, A.; David, M.G.; Singh, N.; Borison, A.; White, I.M. A critical review of point-of-care diagnostic technol-ogies to combat viral pandemics. Anal. Chim. Acta 2021, 1146, 184–199. [Google Scholar] [CrossRef]
- Silva, S.J.R.d.; Pardee, K.; Pena, L. Loop-Mediated Isothermal Amplification (LAMP) for the Diagnosis of Zika Virus: A Review. Viruses 2020, 12, 19. [Google Scholar] [CrossRef]
- Kurosaki, Y.; Magassouba, N.; Oloniniyi, O.K.; Cherif, M.S.; Sakabe, S.; Takada, A.; Hirayama, K.; Yasuda, J. Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea. PLoS Negl. Trop. Dis. 2016, 10, e0004472. [Google Scholar] [CrossRef]
- Edwards, T.; Burke, P.A.; Smalley, H.B.; Gillies, L.; Hobbs, G. Loop-Mediated Isothermal Amplification Test for Detection of Neisseria gonorrhoeae in Urine Samples and Tolerance of the Assay to the Presence of Urea. J. Clin. Microbiol. 2014, 52, 2163–2165. [Google Scholar] [CrossRef]
- Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of Loop-Mediated Isothermal Amplification Reaction by Turbidity Derived from Magnesium Pyrophosphate Formation. Biochem. Biophys. Res. Commun. 2001, 289, 150–154. [Google Scholar] [CrossRef]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.-I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 2009, 46, 167–172. [Google Scholar] [CrossRef] [PubMed]
- Gadkar, V.J.; Goldfarb, D.M.; Gantt, S.; Tilley, P.A.G. Real-time Detection and Monitoring of Loop Mediated Amplification (LAMP) Reaction Using Self-quenching and De-quenching Fluorogenic Probes. Sci. Rep. 2018, 8, 5548. [Google Scholar] [CrossRef] [PubMed]
- Broughton, J.P.; Deng, X.; Yu, G.; Fasching, C.L.; Servellita, V.; Singh, J.; Miao, X.; Streithorst, J.A.; Granados, A.; Sotomayor-Gonzalez, A.; et al. CRISPR–Cas12-based detection of SARS-CoV-2. Nat. Biotechnol. 2020, 38, 870–874. [Google Scholar] [CrossRef]
- Ramachandran, A.; Huyke, D.A.; Sharma, E.; Sahoo, M.K.; Huang, C.; Banaei, N.; Pinsky, B.A.; Santiago, J.G. Electric field-driven microfluidics for rapid CRISPR-based diagnostics and its application to detection of SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020, 117, 29518–29525. [Google Scholar] [CrossRef] [PubMed]
- Woo, C.H.; Jang, S.; Shin, G.; Jung, G.Y.; Lee, J.W. Sensitive fluorescence detection of SARS-CoV-2 RNA in clinical samples via one-pot isothermal ligation and transcription. Nat. Biomed. Eng. 2020, 4, 1168–1179. [Google Scholar] [CrossRef]
- Piepenburg, O.; Williams, C.H.; Stemple, D.; Armes, N.A. DNA Detection Using Recombination Proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef]
- El Wahed, A.A.; Sanabani, S.S.; Faye, O.; Pessôa, R.; Patriota, J.V.; Giorgi, R.R.; Patel, P.; Böhlken-Fascher, S.; Landt, O.; Niedrig, M.; et al. Rapid Molecular Detection of Zika Virus in Acute-Phase Urine Samples Using the Recombinase Polymerase Amplification Assay. PLoS Curr. 2017, 9, 1–6. [Google Scholar] [CrossRef]
- Euler, M.; Wang, Y.; Nentwich, O.; Piepenburg, O.; Hufert, F.T.; Weidmann, M. Recombinase polymerase amplification assay for rapid detection of Rift Valley fever virus. J. Clin. Virol. 2012, 54, 308–312. [Google Scholar] [CrossRef]
- Euler, M.; Wang, Y.; Otto, P.; Tomaso, H.; Escudero, R.; Anda, P.; Hufert, F.T.; Weidmann, M. Recombinase Polymerase Amplification Assay for Rapid Detection of Francisella tularensis. J. Clin. Microbiol. 2012, 50, 2234–2238. [Google Scholar] [CrossRef]
- Rohrman, B.A.; Richards-Kortum, R.R. A paper and plastic device for performing recombinase polymerase amplification of HIV DNA. Lab Chip 2012, 12, 3082–3088. [Google Scholar] [CrossRef]
- Euler, M.; Wang, Y.; Heidenreich, D.; Patel, P.; Strohmeier, O.; Hakenberg, S.; Niedrig, M.; Hufert, F.T.; Weidmann, M. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents. J. Clin. Microbiol. 2013, 51, 1110–1117. [Google Scholar] [CrossRef]
- Mann, J.G.; Pitts, R.J. PrimedSherlock: A tool for rapid design of highly specific CRISPR-Cas12 crRNAs. BMC Bioinform. 2022, 23, 428. [Google Scholar] [CrossRef] [PubMed]
- Kettler, H.; White, K.; Hawkes, S. Mapping the Landscape of Diagnostics for Sexually Transmitted Infections: Key Findings and Recommandations; WHO: Geneva, Switzerland, 2004; pp. 1–44. [Google Scholar]
- Land, K.J.; Boeras, D.I.; Chen, X.-S.; Ramsay, A.R.; Peeling, R.W. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat. Microbiol. 2019, 4, 46–54. [Google Scholar] [CrossRef] [PubMed]
- Rahman, R.; Majumder, T.R.; Apu, A.I.; Paul, A.K.; Afrose, A.; Dash, B.K. CRISPR-Based Programmable Nucleic Acid-Binding Protein Technology Can Specifically Detect Fatal Tropical Disease-Causing Pathogens. J. Trop. Med. 2022, 2022, 5390685. [Google Scholar] [CrossRef]
- Wang, C.; Liu, M.; Wang, Z.; Li, S.; Deng, Y.; He, N. Point-of-care diagnostics for infectious diseases: From methods to devices. Nano Today 2021, 37, 101092. [Google Scholar] [CrossRef] [PubMed]
- Velders, A.H.; Schoen, C.; Saggiomo, V. Loop-mediated isothermal amplifica-tion (LAMP) shield for Arduino DNA detection. BMC Res. 2018, 11, 93. [Google Scholar]
- Sharma, S.; Kabir, M.A.; Asghar, W. Lab-on-a-Chip Zika Detection with Reverse Transcription Loop-Mediated Isothermal Amplification–Based Assay for Point-of-Care Settings. Arch. Pathol. Lab. Med. 2020, 144, 1335–1343. [Google Scholar] [CrossRef]
- Song, J.; Mauk, M.G.; Hackett, B.A.; Cherry, S.; Bau, H.H.; Liu, C. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Anal. Chem. 2016, 88, 7289–7294. [Google Scholar] [CrossRef] [PubMed]
- Ganguli, A.; Ornob, A.; Yu, H.; Damhorst, G.L.; Chen, W.; Sun, F.; Bhuiya, A.; Cunningham, B.T.; Bashir, R. Hands-free smartphone-based diagnostics for simultaneous detection of Zika, Chikungunya, and Dengue at point-of-care. Biomed. Microdevices 2017, 19, 73. [Google Scholar] [CrossRef]
- Liu, Q.; Zhang, X.; Chen, L.; Yao, Y.; Ke, S.; Zhao, W.; Yang, Z.; Sui, G. A sample-to-answer labdisc platform integrated novel membrane-resistance valves for detection of highly pathogenic avian influenza viruses. Sens. Actuators B Chem. 2018, 270, 371–381. [Google Scholar] [CrossRef]
- Strohmeier, O.; Keil, S.; Kanat, B.; Patel, P.; Niedrig, M.; Weidmann, M.; Hufert, F.; Drexler, J.; Zengerle, R.; von Stetten, F. Automated nucleic acid extraction from whole blood, B. subtilis, E. coli, and Rift Valley fever virus on a centrifugal microfluidic LabDisk. RSC Adv. 2015, 5, 32144–32150. [Google Scholar] [CrossRef]
- Hin, S.; Lopez-Jimena, B.; Bakheit, M.; Klein, V.; Stack, S.; Fall, C.; Sall, A.; Enan, K.; Mustafa, M.; Gillies, L.; et al. Fully automated point-of-care differential diagnosis of acute febrile illness. PLoS Negl. Trop. Dis. 2021, 15, e0009177. [Google Scholar] [CrossRef] [PubMed]
- Martinez, A.W.; Phillips, S.T.; Butte, M.; Whitesides, G.M. Patterned Paper as a Platform for Inexpensive, Low-Volume, Portable Bioassays. Angew. Chem. Int. Ed. 2007, 46, 1318–1320. [Google Scholar] [CrossRef] [PubMed]
- Bedin, F.; Boulet, L.; Voilin, E.; Theillet, G.; Rubens, A.; Rozand, C. Paper-based point-of-care testing for cost-effective diagnosis of acute flavivirus infections. J. Med. Virol. 2017, 89, 1520–1527. [Google Scholar] [CrossRef]
- Theillet, G.; Grard, G.; Galla, M.; Maisse, C.; Enguehard, M.; Cresson, M.; Dalbon, P.; Leparc-Goffart, I.L.; Bedin, F. Detection of chikungunya virus-specific IgM on laser-cut paper-based device using pseudo-particles as capture antigen. J. Med. Virol. 2019, 91, 899–910. [Google Scholar] [CrossRef]
- Chowdury, M.A.; Khalid, F. Application of microfluidic paper-based analytical device (μPAD) to detect COVID -19 in energy deprived countries. Int. J. Energy Res. 2021, 45, 18275–18280. [Google Scholar] [CrossRef]
- Wang, J.; Jiang, C.; Jin, J.; Huang, L.; Yu, W.; Su, B.; Hu, J. Ratiometric Fluorescent Lateral Flow Immunoassay for Point-of-Care Testing of Acute Myocardial Infarction. Angew. Chem. Int. Ed. 2021, 60, 13042–13049. [Google Scholar] [CrossRef]
- Cvak, B.; Warth, B.; Atehnkeng, J.; Parich, A.; Moritz, A.; Sulyok, M.; Krska, R. Evaluating the Performance of Lateral Flow Devices for Total Aflatoxins with Special Emphasis on Their Robustness under Sub-Saharan Conditions. Toxins 2021, 13, 742. [Google Scholar] [CrossRef]
- Zheng, S.; Yang, X.; Zhang, B.; Cheng, S.; Han, H.; Jin, Q.; Wang, C.; Xiao, R. Sensitive detection of Escherichia coli O157:H7 and Salmonella typhimurium in food samples using two-channel fluorescence lateral flow assay with liquid Si@quantum dot. Food Chem. 2021, 363, 130400. [Google Scholar] [CrossRef]
- Fogaça, M.B.T.; Bhunia, A.K.; Lopes-Luz, L.; de Almeida, E.P.R.P.; Vieira, J.D.G.; Bührer-Sékula, S. Antibody- and nucleic acid–based lateral flow immunoassay for Listeria monocytogenes detection. Anal. Bioanal. Chem. 2021, 413, 4161–4180. [Google Scholar] [CrossRef]
- Salvador, M.; Marqués-Fernández, J.L.; Bunge, A.; Martínez-García, J.C.; Turcu, R.; Peddis, D.; García-Suárez, M.D.M.; Cima-Cabal, M.D.; Rivas, M. Magnetic Nanoclusters Increase the Sensitivity of Lateral Flow Immunoassays for Protein Detection: Application to Pneumolysin as a Biomarker for Streptococcus pneumoniae. Nanomaterials 2022, 12, 2044. [Google Scholar] [CrossRef] [PubMed]
- Ketema, F.; Zeh, C.; Edelman, D.C.; Saville, R.; Constantine, N.T. Assessment of the Performance of a Rapid, Lateral Flow Assay for the Detection of Antibodies to HIV. J. Acquir. Immune Defic. Syndr. 2001, 27, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Grant, B.D.; Anderson, C.E.; Alonzo, L.F.; Garing, S.H.; Williford, J.R.; Baughman, T.A.; Rivera, R.; Glukhova, V.A.; Boyle, D.S.; Dewan, P.K.; et al. A SARS-CoV-2 coronavirus nucleocapsid protein antigen-detecting lateral flow assay. PLoS ONE 2021, 16, e0258819. [Google Scholar] [CrossRef] [PubMed]
- Kaewphinit, T.; Arunrut, N.; Kiatpathomchai, W.; Santiwatanakul, S.; Jaratsing, P.; Chansiri, K. Detection of Mycobacterium tuberculosis by Using Loop-Mediated Isothermal Amplification Combined with a Lateral Flow Dipstick in Clinical Samples. Biomed. Res. Int. 2013, 2013, 926230. [Google Scholar] [CrossRef]
- Ge, Y.; Wu, B.; Qi, X.; Zhao, K.; Guo, X.; Zhu, Y.; Qi, Y.; Shi, Z.; Zhou, M.; Wang, H.; et al. Rapid and Sensitive Detection of Novel Avian-Origin Influenza A (H7N9) Virus by Reverse Transcription Loop-Mediated Isothermal Amplification Combined with a Lateral-Flow Device. PLoS ONE 2013, 8, e69941. [Google Scholar] [CrossRef]
- Deng, J.; Pei, J.; Gou, H.; Ye, Z.; Liu, C.; Chen, J. Rapid and simple detection of Japanese encephalitis virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 2015, 213, 98–105. [Google Scholar] [CrossRef]
- Lee, D.; Shin, Y.; Chung, S.; Hwang, K.S.; Yoon, D.S.; Lee, J.H. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Anal. Chem. 2016, 88, 12272–12278. [Google Scholar] [CrossRef]
- Zhang, C.; Zheng, T.; Wang, H.; Chen, W.; Huang, X.; Liang, J.; Qiu, L.; Han, D.; Tan, W. Rapid One-Pot Detection of SARS-CoV-2 Based on a Lateral Flow Assay in Clinical Samples. Anal. Chem. 2021, 93, 3325–3330. [Google Scholar] [CrossRef]
- Mao, L.; Ying, J.; Selekon, B.; Gonofio, E.; Wang, X.; Nakoune, E.; Wong, G.; Berthet, N. Development and Characterization of Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of Monkeypox Virus. Viruses 2022, 14, 2112. [Google Scholar] [CrossRef]
- Wang, Z.; Yu, W.; Xie, R.; Yang, S.; Chen, A. A strip of lateral flow gene assay using gold nanoparticles for point-of-care diagnosis of African swine fever virus in limited environment. Anal. Bioanal. Chem. 2021, 413, 4665–4672. [Google Scholar] [CrossRef]
- Shelite, T.R.; Bopp, N.E.; Moncayo, A.; Reynolds, E.S.; Thangamani, S.; Melby, P.C.; Bloch, K.; Aguilar, P.V.; Travi, B.L. Isothermal Recombinase Polymerase Amplification-Lateral Flow Point-of-Care Diagnostic Test for Heartland Virus. Vector-Borne Zoonotic Dis. 2021, 21, 110–115. [Google Scholar] [CrossRef] [PubMed]
- Xiong, D.; Dai, W.; Gong, J.; Li, G.; Liu, N.; Wu, W.; Pan, J.; Chen, C.; Jiao, Y.; Deng, H.; et al. Rapid detection of SARS-CoV-2 with CRISPR-Cas12a. PLoS Biol. 2020, 18, e3000978. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Hu, L.; Ying, L.; Zhao, Z.; Chu, P.K.; Yu, X.-F. A CRISPR–Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection. Nat. Commun. 2018, 9, 5012. [Google Scholar] [CrossRef]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [PubMed]
- Xu, B.; Gong, P.; Zhang, Y.; Wang, Y.; Tao, D.; Fu, L.; Khazalwa, E.M.; Liu, H.; Zhao, S.; Zhang, X.; et al. A one-tube rapid visual CRISPR assay for the field detection of Japanese encephalitis virus. Virus Res. 2022, 319, 198869. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Bello, A.; Smith, G.; Kielich, D.M.S.; Strong, J.E.; Pickering, B.S. Degenerate sequence-based CRISPR diagnostic for Crimean–Congo hemorrhagic fever virus. PLoS Negl. Trop. Dis. 2022, 16, e0010285. [Google Scholar] [CrossRef]
- Park, B.J.; Yoo, J.R.; Heo, S.T.; Kim, M.; Lee, K.H.; Song, Y.-J. A CRISPR-Cas12a-based diagnostic method for multiple genotypes of severe fever with thrombocytopenia syndrome virus. PLoS Negl. Trop. Dis. 2022, 16, e0010666. [Google Scholar] [CrossRef]
- Bhatt, S.; Gething, P.W.; Brady, O.J.; Messina, J.P.; Farlow, A.W.; Moyes, C.L.; Drake, J.M.; Brownstein, J.S.; Hoen, A.G.; Sankoh, O.; et al. The global distribution and burden of dengue. Nature 2013, 496, 504–507. [Google Scholar] [CrossRef] [PubMed]
- Gubler, D.J. Dengue and Dengue Hemorrhagic Fever. Clin. Microbiol. Rev. 1998, 11, 480–496. [Google Scholar] [CrossRef]
- Simmons, C.P. A Candidate Dengue Vaccine Walks a Tightrope. N. Engl. J. Med. 2015, 373, 1263–1264. [Google Scholar] [CrossRef]
- Thomas, S.J.; L’azou, M.; Barrett, A.D.; Jackson, N.A. Fast-Track Zika Vaccine Development—Is It Possible? N. Engl. J. Med. 2016, 375, 1212–1216. [Google Scholar] [CrossRef] [PubMed]
Virus | Family/Order | Vector | Symptoms | Reference |
---|---|---|---|---|
Zika virus (ZIKV) | Flaviviridae |
Aedes
mosquitoes | Fever, conjunctivitis, joint pain, headache, maculopapular rash, microcephaly, Guillain–Barré syndrome. | [10] |
Yellow fever virus (YFV) | Flaviviridae |
Aedes
mosquitoes |
Jaundice, liver damage, gastrointestinal bleeding,
recurring fever. | [11] |
Dengue Virus (DENV) | Flaviviridae |
Aedes
mosquitoes | Fever, headache, nausea, muscle and joint pain, skin rash, hypovolemic shock, hemorrhage. | [12] |
West Nile virus (WNV) | Flaviviridae | Culex mosquitoes | Fever, headache, nausea, vomiting, swollen lymph nodes, meningitis, encephalitis, acute flaccid paralysis. | [13] |
Japanese encephalitis virus (JEV) | Flaviviridae | Culex mosquitoes | Mild flu-like symptoms, encephalitis, seizures, paralysis, coma and long-term brain damage. | [14] |
Tick-borne encephalitis virus (TBEV) | Flaviviridae | Ixodes ticks, Dermacentor and Haemaphysalis |
Mild meningitis to severe
meningoencephalitis with or without paralysis and long-term brain damage damage. | [15] |
Omsk hemorrhagic fever virus (OHFV) | Flaviviridae | Dermacentor ticks | Fever, headache, nausea, muscle pain, cough and hemorrhages. | [16] |
Saint Louis encephalitis virus (SLEV) | Flaviviridae | Culex mosquitoes | Headache, sensory depression, temporal–spatial disorientation, tremors and changes in consciousness. | [17] |
Kyasanur Forest disease virus (KFDV) | Flaviviridae | Haemaphysalis spinigera | Fever with hemorrhagic and/or neurological features in 20% of patients. | [18] |
Chikungunya virus (CHIKV) | Togaviridae |
Aedes
mosquitoes | Fever frequently associated with joint pain, polyarthralgia and arthritis, rash, myalgia and headache. | [19] |
O’nyong nyong virus (ONNV) | Togaviridae |
Anophles
mosquitoes | Low-grade fever, symmetrical polyarthralgia, lymphadenopathy, generalized papular or maculopapular exanthema and joint pain. | [20] |
Ross river virus (RRV) | Togaviridae | Culex and Aedes mosquitoes | Arthritis, rash, fever, fatigue and myalgia. | [21] |
Eastern equine encephalitis virus (EEEV) | Togaviridae |
Culiseta
mosquitoes | Fever, chills, vomiting, myalgia, arthralgia, malaise and encephalitis. | [22] |
Western equine encephalitis virus (WEEV) | Togaviridae | Aedes, Culex and Culiseta mosquitoes | Fever, chills, headache, aseptic meningitis and encephalitis. | [23] |
Venezuelan equine encephalitis virus (VEEV) | Togaviridae | Culex mosquitoes | Fever, chills, malaise, severe headache, myalgia, seizures, drowsiness, confusion and photophobia. | [24] |
Barmah Forest virus (BFV) | Togaviridae | Culex and Aedes mosquitoes | Asymptomatic to relatively mild symptomatic presentations, such as fever and rash; in more severe diseases, polyarthralgia or arthritis. | [25] |
Thogoto virus (THOV) | Orthomyxoviridae | Haemaphysalis and Amblyomma ticks | Benign febrile symptoms to meningoencephalitis. | [26] |
Rift Valley fever virus (RVFV) | Bunyvirales | Culex and Aedes mosquitoes | Fever, headache, backache, vertigo, anorexia, photophobia, hepatitis, jaundice, hemorrhagic disease and ocular complications | [27,28] |
Ngari virus
(NRIV) | Bunyvirales | Aedes, Culex and Anopheles mosquitoes | Fever, joint pain, rash, can induce severe and fatal hemorrhagic fever | [28] |
Severe fever with thrombocytopenia syndrome virus (SFTSV) | Bunyvirales | Haemophysalis Amblyomma, Ixodes and Rhipicephalus ticks | High fever, gastrointestinal symptoms, thrombocytopenia, leukopenia and multiple organ failure | [29] |
Crimean–Congo hemorrhagic fever virus (CCHFV) | Bunyvirales | Hyalomma, Rhipicephalus and Dermacentor ticks | Non-specific febrile illness, sudden onset of fever, myalgia, diarrhea, nausea and vomiting, hemorrhages at various sites around the body. | [30] |
Jamestown Canyon virus (JCV) | Bunyvirales | Aedes, Coquillettidia, Culex mosquitoes | Non-specific febrile illness, meningitis or meningoencephalitis | [31] |
La Crosse encephalitis virus (LACV) | Bunyvirales |
Aedes
mosquitoes | Fever, headache, myalgia, malaise and occasional prostration, encephalitis and lifelong sequelae. | [32] |
Oropouche Virus (OROV) | Bunyvirales | Culicoides and Culex mosquitoes | Acute febrile illness, myalgia, arthralgia, dizziness, photophobia, rash, nausea, vomiting, diarrhea, conjunctive congestion and meningitis. | [33] |
Sequence | ||
---|---|---|
Alphavirus Species | Before Conversion | After Conversion |
Barmah Forest virus | CCUUACUUCUGUGGAGGAUUU | TTTTATTTTTGTGGAGGATTT |
Ndumu virus | CCGUAUUUCUGCGGCGGGUUC | TTGTATTTTTGTGGTGGGTTT |
Chikungunya virus | CCUUACUUUUGUGGAGGGUUU | TTTTATTTTTGTGGAGGGTTT |
O’nyong-nyong virus | CCAUACUUCUGUGGGGGAUUU | TTATATTTTTGTGGGGGATTT |
Middelburg virus | CCCUACUUCUGCGGAGGGUUU | TTTTATTTTTGTGGAGGGTTT |
Mayaro virus | CCCUACUUUUGUGGAGGUUUC | TTTTATTTTTGTGGAGGTTTT |
Ross River virus | CCAUACUUCUGCGGCGGGUUU | TTATATTTTTGTGGTGGGTTT |
Semliki Forest virus | CCAUAUUUUUGUGGGGGAUUC | TTATATTTTTGTGGGGGATTT |
Una virus | CCUUACUUCUGCGGAGGAUUC | TTTTATTTTTGTGGAGGATTT |
Aura virus | CCUUACUUUUGCGGCGGAUUU | TTTTATTTTTGTGGTGGATTT |
Rio Negro virus | CCAUACUUUUGUGGAGGGUUU | TTATATTTTTGTGGAGGGTTT |
Mucambo virus | CCGUACUUUUGCGGCGGGUUU | TTGTATTTTTGTGGTGGGTTT |
Everglages virus | CCCUAUUUUUGUGGAGGGUUU | TTTTATTTTTGTGGAGGGTTT |
Venezuelan equine encephalitis virus | CCCUAUUUUUGUGGAGGGUUU | TTTTATTTTTGTGGAGGGTTT |
Eastern equine encephalitis virus | CCGUACUUUUGCGGAGGGUUC | TTGTATTTTTGTGGAGGGTTT |
Western equine encephalitis virus | CCCUACUUCUGUGGGGGAUUU | TTTTATTTTTGTGGGGGATTT |
Consensus sequence | CCNUAYUUYUGYGGDGGDUUY | TTDTATTTTTGTGGDGGDTTT |
Number of variants | 576 | 27 |
Amplification Method | Template | Temperature | Primers | Time to Result | Enzymes (RNA) | Advantages | Disadvantages |
---|---|---|---|---|---|---|---|
Real-time PCR | DNA/RNA | Thermal cycling | 2 | 15–60 min | 2 | Established method, high sensitivity and specificity; multiplexing. | Thermal cycler required and highly trained staff. |
Nucleic-Acid-Sequence-Based Amplification | RNA | 41 °C | 2 | 90–120 min | 3 | Isothermal, rapid. | RNA-based amplification only. |
Strand Displacement Amplification | DNA/RNA | 37–65 °C | 4 | 10–60 min | 3 | Isothermal, rapid results NEAR method <10 min. POC compatible | Sensitivity can be lower than other methods. Thermal denaturation required for DNA. |
Helicase Dependant Amplification | DNA/RNA | 37–65 °C | 2 | 30–60 min | 3 | Isothermal, rapid. POC compatible. | Not as sensitive as other techniques |
Loop mediated AMPlification | DNA/RNA | 65 °C | 4–6 | 5–30 min | 2 | Isothermal, rapid, POC adaptable. Multiplex capability. | Complex primer design. |
Recombinase Polymerase Amplification | DNA/RNA | 37–42 °C | 2 | 5–30 min | 3 | Isothermal, rapid, POC compatible. | RUO only reagents available. |
Method | Cost | Ease of Use | Sensitivity | Specificity | POC Applicable | Advantages | Disadvantages |
---|---|---|---|---|---|---|---|
Serology | Low | Simple | Medium | Medium | Yes | Proven technology, cheap, easy to use, requires minimal infrastructure. | Sensitivity and specificity lower than nucleic acid detection technologies. |
NGS | High | Highly complex | High | N/A, unless using targeted enrichment | No | High sensitivity provides unbiased results, ideal for surveillance approaches. | High cost, dedicated infrastructure. High level of technical skill required. |
RT-PCR | Medium | Complex | High | High | No | Proven technology, high level of sensitivity and specificity. | Thermal cycler required. Not readily adaptable to POC |
INAAT | Low-medium | Medium complexity | High | High | Yes | POC adaptable, no thermal cycling equipment required. | Can be complex to design, newer technology. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Varghese, J.; De Silva, I.; Millar, D.S. Latest Advances in Arbovirus Diagnostics. Microorganisms 2023, 11, 1159. https://doi.org/10.3390/microorganisms11051159
Varghese J, De Silva I, Millar DS. Latest Advances in Arbovirus Diagnostics. Microorganisms. 2023; 11(5):1159. https://doi.org/10.3390/microorganisms11051159
Chicago/Turabian StyleVarghese, Jano, Imesh De Silva, and Douglas S. Millar. 2023. "Latest Advances in Arbovirus Diagnostics" Microorganisms 11, no. 5: 1159. https://doi.org/10.3390/microorganisms11051159
APA StyleVarghese, J., De Silva, I., & Millar, D. S. (2023). Latest Advances in Arbovirus Diagnostics. Microorganisms, 11(5), 1159. https://doi.org/10.3390/microorganisms11051159