Colletotrichum siamense Strain LVY 9 Causing Spot Anthracnose on Winterberry Holly in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Pathogen Isolation
2.2. Pathogenicity Test
2.3. Morphological Characteristics
2.4. Phylogenetic Analysis
2.4.1. Genomic DNA Extraction and PCR Amplification
2.4.2. Fungal Isolates Phylogenetic Analysis
3. Results
3.1. The Strain LVY 9 Was Pathogen of Anthracnose on Winterberry Holly through Koch’s Postulates
3.2. Strain LVY 9 Was Identified as Colletotrichum siamense by Phylogenetic Analyses
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Colletotrichum Species | Culture Collection | GenBank Accession Number | References | ||||
|---|---|---|---|---|---|---|---|
| ITS | GAPDH | CAL | ACT | CHS-1 | |||
| C.aenigma | ICMP 18,608 * | JX010244 | JX010044 | JX009683 | JX009443 | JX009774 | [13] |
| C.aeschynomenes | ICMP 17,673 * ATCC 201,874 | JX010176 | JX009930 | JX009721 | JX009483 | JX009799 | [13] |
| C.alatae | CBS 304.67 * ICMP 17,919 | JX010190 | JX009990 | JX009738 | JX009483 | JX009799 | [13] |
| C.alienum | ICMP 12,071 * | JX010251 | JX010028 | JX009654 | JX009572 | JX009882 | [13] |
| C.annellatum | CBS 129,826 CH1 * | JQ005222 | JQ005309 | JQ005743 | JQ005570 | JQ005396 | [16] |
| C.aotearoa | ICMP 18,537 * | JX010205 | JX010005 | JX009611 | JX009564 | JX009853 | [13] |
| C.asianum | ICMP 18,580 * CBS 130,418 | FJ972612 | JX010053 | FJ917506 | JX009584 | JX009867 | [13] |
| C.beeveri | ICMP 18,594 * CBS 125,827 | JQ005171 | JQ005258 | JQ005692 | JQ005519 | JQ005345 | [16] |
| C.boninense | MAFF 305,972 * CBS 123,755 | JQ005153 | JQ005240 | JQ005674 | JQ005501 | JQ005327 | [13] |
| C.brasiliense | CBS 128,501 PAS12 * | JQ005235 | JQ005322 | JQ005756 | JQ005583 | JQ005409 | [16] |
| C.brassicicola | CBS 101,059 LYN 16,331 * | JQ005172 | JQ005259 | JQ005693 | JQ005520 | JQ005346 | [16] |
| C.clidemiae | ICMP 18,658 * | JX010265 | JX009989 | JX009645 | JX009537 | JX009877 | [13] |
| C.cliviae | CBS 125,375 * | GQ485607 | GQ856756 | GQ849464 | GQ856777 | GQ856722 | [17] |
| C.colombiense | CBS 129,818 G2 * | JQ005174 | JQ005261 | JQ005695 | JQ005522 | JQ005348 | [16] |
| C.constrictum | ICMP 12,941 * CBS 128,504 | JQ005238 | JQ005325 | JQ005759 | JQ005586 | JQ005412 | [16] |
| C.cordylinicola | ICMP 18,579 MFLUCC 090,551 * | JX010226 | JX009975 | HM470237 | HM470234 | JX009864 | [13] |
| C.cymbidiicola | IMI 347,923 * | JQ005166 | JQ005253 | JQ005687 | JQ005514 | JQ005340 | [16] |
| C.dacrycarpi | ICMP 19,107 * CBS 130,241 | JQ005236 | JQ005323 | JQ005757 | JQ005584 | JQ005410 | [16] |
| C.dracaenophilum | CBS 118,199 * | JX519222 | JX546707 | - | JX519238 | JX519230 | [17] |
| C.fructicola | CBS 125,397 * ICMP 18,646 | JX010173 | JX010032 | JX009674 | JX009581 | JX009874 | [13] |
| C.fructicola | CBS 238.49 * ICMP 17,921 | JX010181 | JX009923 | JX009671 | JX009495 | JX009839 | [13] |
| C.fructicola | ICMP 18,581 * CBS 130,416 | JX010165 | JX010033 | FJ917508 | FJ907426 | JX009866 | [13] |
| C.gloeosporioides | CBS 273.51 * ICMP 19,121 | JX010148 | JX010054 | JX009745 | JX009558 | JX009903 | [13] |
| C.gloeosporioides | STE-U4295 * CBS 112,999 | JQ005152 | JQ005239 | JQ005673 | JQ005500 | JQ005326 | [16] |
| C.gloeosporioides | IMI 356,878 * ICMP 17,821 CBS 112,999 | JX010152 | JX010056 | JX009731 | JX009531 | JX009818 | [13] |
| C.hippeastri | CSSG 1 * CBS 125,376 | JQ005231 | JQ005318 | JQ005752 | JQ005579 | JQ005405 | [16] |
| C.hippeastri | CBS 241.78 | JX010293 | JX009932 | JX009740 | JX009485 | JX009838 | [13] |
| C.horii | NBRC 7478 * ICMP 10,492 | GQ329690 | GQ32961 | JX009604 | JX009438 | JX009752 | [13] |
| C.kahawae subsp | CBS 124.22* ICMP 19,122 | JX010228 | JX009950 | JX009744 | JX009536 | JX009902 | [13] |
| C.kahawae subsp | IMI 319,418 * ICMP 17,816 | JX010231 | JX010012 | JX009642 | JX009452 | JX009813 | [13] |
| C.kahawae subsp | ICMP 18,539 * | JX010230 | JX009966 | JX009635 | JX009523 | JX009800 | [13] |
| C.kahawae subsp | CBS 237.49 * ICMP 17,922 | JX010238 | JX010042 | JX009636 | JX009450 | JX009840 | [13] |
| C.karstii | CBS 132,134 * | HM585409 | HM858391 | HM582013 | HM581995 | HM582023 | [16] |
| C.karstii | CBS 128,550 ICMP 17,896 | JQ005219 | JQ005306 | JQ005740 | JQ005567 | JQ005393 | [16] |
| C.karstii | CBS 118,401 | JQ005192 | JQ005279 | JQ005713 | JQ005540 | JQ05366 | [16] |
| C.lindemuthianum | CBS 144.31 | JQ005779 | JX546712 | - | JQ005842 | JQ005800 | [17] |
| C.musae | CBS 192.31 ICMP 17,923 | JX010143 | JX009929 | JX009690 | JX009587 | JX009841 | [13] |
| C.musae | CBS 116,870 * ICMP 19,119 | JX010145 | JX010047 | JX009687 | JX009551 | JX009849 | [13] |
| C.novae-zelandiae | ICMP 12,944 * CBS 128,505 | JQ005228 | JQ005315 | JQ005749 | JQ005576 | JQ005402 | [16] |
| C.nupharicola | CBS 470.96 * ICMP 18,187 | JX010187 | JX009972 | JX009663 | JX009437 | JX009835 | [13] |
| C.oncidii | CBS 129,828 * | JQ005169 | JQ005256 | JQ005690 | JQ005517 | JQ005343 | [16] |
| C.parsonsiae | ICMP 18,590 * CBS 128,525 | JQ005223 | JQ005320 | JQ005754 | JQ005581 | JQ005407 | [16] |
| C.petchii | CBS 378.94 * | JQ005223 | JQ005310 | JQ005744 | JQ005571 | JQ005397 | [16] |
| C.phyllanthi | CBS 175.67 MACS 271 * | JQ005221 | JQ005308 | JQ005742 | JQ005569 | JQ005395 | [16] |
| C.psidii | CBS 145.29 * ICMP 19,120 | JX010219 | JX009967 | JX009743 | JX009515 | JX009901 | [13] |
| C.queenslandicum | ICMP 1778 * | JX010276 | JX009934 | JX009691 | JX009447 | JX009899 | [13] |
| C.salsolae | ICMP 19,051 * | JX010242 | JX009916 | JX009696 | JX009562 | JX009863 | [13] |
| C.siamense | CBS 125,378 * ICMP 18,642 | JX010278 | JX010019 | JX009709 | GQ85675 | GQ856730 | [13] |
| C.siamense | CBS 130,420 * ICMP 19,118 | HM131511 | HM13147 | JX009713 | HM13157 | JX009895 | [13] |
| C.siamense | ICMP 18,578 * CBS 130,417 | JX010171 | JX009924 | FJ917505 | FJ907423 | JX009865 | [13] |
| C.simmondsii | CBS 122,122, BRIP 28,519 * | JQ948276 | JQ948606 | FJ917510 | JQ949588 | JQ948937 | [16] |
| C.theobromicola | CBS 124,945 * ICMP 18,649 | JX010294 | JX010006 | JX009591 | JX009444 | JX009869 | [13] |
| C.theobromicola | CBS 142.31 * ICMP 17,927 | JX010286 | JX010024 | JX009582 | JX009516 | JX009830 | [13] |
| C.theobromicola | MUCL 42,294 * ICMP 17,957 | JX010289 | JX009962 | JX009597 | JX009575 | JX009821 | [13] |
| C.ti | ICMP 4832 * | JX010269 | JX009952 | JX009649 | JX009520 | JX009898 | [17] |
| C.torulosum | ICMP 18,586 * CBS 128,544 | JQ005164 | JQ005251 | JQ005685 | GU27899 | GU228291 | [17] |
| C.tropicale | CBS 124,949 * ICMP 18,653 | JX010264 | JX010007 | JX009719 | JX009489 | JX009870 | [13] |
| C.xanthorrhoeae | BRIP 45,094 * ICMP 17,903 | JX010261 | JX009927 | JX009653 | JX009478 | JX009823 | [13] |
| C.yunnanense | CBS 132,135 * | JX546804 | JX546706 | - | JX519239 | JX519231 | [17] |
References
- Xiang, W.; Xu, Z.; Lin, L.; Yongjun, Z.; Weisong, M. Monitoring system based on WSN for fresh cut branches of Ilex verticillata in the whole cold chain. Trans. Chin. Soc. Agric. Mach. 2017, 48, 394–400. [Google Scholar] [CrossRef]
- Juanjuan, M.; Bin, Z.; Yin, C.; Xichen, L.; Jie, Y.; Qian, C. Physiological responses of seedlings of four Ilex verticillata varieties to low temperature stress and a comparison of their cold resistance. J. Nanjing For. Univ. Nat. Sci. Ed. 2020, 44, 34–40. [Google Scholar] [CrossRef]
- Weili, W.; Liping, H.; Minfen, Y.; Huwei, Y.; Daoliang, Y.; Liang, Z.; Youxiang, Y.; Jun, L.; Peng, Z.; Bingsong, Z. Phylogenetic relationships among 12 cultivars of Ilex verticillata based on ISSR molecular markers. J. Zhejiang Agric. For. Univ. 2018, 35, 612–617. [Google Scholar] [CrossRef]
- Yuzhen, Y.; Yunxia, Z.; Zhihao, Z.; Bingqing, A. Diurnal changes of photosynthesis and relationship with the eco-physiological factors of IIex verticillata. J. Northwest Norm. Univ. Nat. Sci. 2016, 52, 88–92. [Google Scholar] [CrossRef]
- Dengfeng, S.; Bin, W.; Chuntao, H.; Minghua, L.; Tonghui, Y.; Jianhong, Z. Transcriptome analysis of Ilex verticillata leaf treated by different concentrations acetic acid solution. Mol. Plant Breed. 2020, 18, 401–408. [Google Scholar] [CrossRef]
- Lin, Z.; Ziqian, Y.; Jianhua, D.; Youxiang, Y.; Yichen, L. Regional introduction experiment of Ilex verticillate ‘Oosterwijk’. J. For. Eng. 2015, 29, 80–82. [Google Scholar] [CrossRef]
- Lin, S.; Taylor, N.J.; Peduto Hand, F. Identification and characterization of fungal pathogens causing fruit rot of deciduous holly. Plant Dis. 2018, 102, 2430–2445. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.; Peduto Hand, F. Investigations on the timing of fruit infection by fungal pathogens causing fruit rot of deciduous holly. Plant Dis. 2019, 103, 308–314. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.; Peduto Hand, F. Determining the sources of primary and secondary inoculum and seasonal inoculum dynamics of fungal pathogens causing fruit rot of deciduous holly. Plant Dis. 2019, 103, 951–958. [Google Scholar] [CrossRef] [Scilit]
- Qing, B.; Lifeng, Z.; Xiaoren, C.; Ni, H.; Wenxing, X.; Guoping, W. Biological and molecular characterization of five Phomopsis species associated with pear shoot canker in China. Plant Dis. 2015, 99, 1704–1712. [Google Scholar] [CrossRef] [Scilit]
- Noireung, P.; Phoulivong, S.; Fang, L.; Cai, L.; Eric, H.C.M.; Ekachai, C.; Jones, E.B.G.; Ali, H.B.; Hyde, D.K. Novel species of Colletotrichum revealed by morphology and molecular analysis. Cryptogam. Mycol. 2012, 33, 347–362. [Google Scholar] [CrossRef] [Scilit]
- Dissanayake, A.J.; Liu, M.; Zhang, W.; Chen, Z.; Udayanga, D.; Chukeatirote, E.; Li, X.H.; Yan, J.Y.; Hyde, K.D. Morphological and molecular characterisation of Diaporthe species associated with grapevine trunk disease in China. Fungal Biol. 2015, 119, 283–294. [Google Scholar] [CrossRef] [Scilit]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Scilit]
- Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Hyde, K.D. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers. 2009, 39, 89–109. [Google Scholar]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Stud. Mycol. 2012, 73, 37–113. [Google Scholar] [CrossRef] [Scilit]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S. The Colletotrichum boninense species complex. Stud. Mycology. 2012, 73, 1–36. [Google Scholar] [CrossRef] [Scilit]
- Jayawardena, R.S.; Hyde, K.D.; Damm, U.; Cai, L.; Liu, M.; Li, X.H.; Zhang, W.; Zhao, W.S.; Yan, J.Y. Notes on currently accepted species of Colletotrichum. Mycosphere 2016, 7, 1192–1260. [Google Scholar] [CrossRef] [Scilit]
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum-current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [Scilit]
- Xinlei, F.; Yingmei, L.; Rong, M.; Chenming, T. Morphological and phylogenetic studies of Cytospora (Valsaceae, Diaporthales) isolates from Chinese scholar tree, with description of a new species. Mycoscience 2014, 55, 252–259. [Google Scholar] [CrossRef] [Scilit]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef] [Scilit]
- Templeton, M.D.; Rikkerink, E.H.A.; Solon, S.L.; Crowhurst, R.N. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulate. Gene 1992, 122, 225–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., Whitem, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–332. [Google Scholar] [CrossRef] [Scilit]
- Hall, T. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef] [Scilit]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [Scilit]
- Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [Scilit]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Scilit]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinfotmatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
- Schena, L.; Mosca, S.; Cacciola, S.O.; Faedda, R.; Sanzani, S.M.; Agosteo, G.; Sergeeva, V.; Lio, G.M. Species of the Colletotrichum gloeosporioides and C. boninense complexes associated with olive anthracnose. Plant Pathol. 2014, 63, 437–446, Corpus ID: 59138976. [Google Scholar] [CrossRef] [Scilit]
- Huang, F.; Chen, G.; Hou, X.; Fu, Y.; Cai, L.; Hyde, K.; Li, H.Y. Colletotrichum species associated with cultivated citrus in China. Fungal Divers. 2013, 61, 61–74, Corpus ID: 15163531. [Google Scholar] [CrossRef] [Scilit]
- Rojas, E.; Rehner, S.; Samuels, G.; Bael, S.V.; Herre, E.; Cannon, P.; Chen, R.; Pang, J.; Wang, R.; Zhang, Y.; et al. Colletotrichum gloeosporioides associated with Theobroma cacao and other plants in Panamá: Multilocus phylogenies distinguish host-associated pathogens from asymptomatic endophytes. Mycologia 2010, 102, 1318–1338, Corpus ID: 44822023. [Google Scholar] [CrossRef] [Scilit]
- Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-kosack, K.E.; Dipietro, A.; Spanu, P.D.; Foster, G.D. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [Scilit]
- Crouch, J.A.; Beirn, L.A.; Cortese, L.M.; Bonos, S.A.; Clarke, B.B. Anthracnose disease of switchgrass caused by the novel fungal species Colletotrichum navitas. Mycol. Res. 2009, 113, 1411–1421. [Google Scholar] [CrossRef] [Scilit]
- Nam, M.; Park, M.; Lee, H.D.; Yu, S. Taxonomic Re-evaluation of Colletotrichum gloeosporioides Isolated from Strawberry in Korea. Plant Pathol. J. 2013, 29, 317–322, Corpus ID: 2295330. [Google Scholar] [CrossRef] [Scilit]
- Sharma, G.; Shenoy, B.D. Colletotrichum fructicola and C. siamense are involved in chilli anthracnose in India. Arch. Phytopathol. Plant Prot. 2014, 47, 1179–1194. [Google Scholar] [CrossRef] [Scilit]
- Li, H.N.; Jiang, J.J.; Hong, N.; Wang, G.P.; Xu, W.X. First Report of Colletotrichum fructicola causing bitter rot of Pear (Pyrus bretschneideri) in China. Plant Dis. 2013, 97, 1000. [Google Scholar] [CrossRef] [Scilit]
- Kyoko, W.; Hiromi, I.; Takashi, S. Anthracnose of genus Mandevilla caused by Colletotrichum truncatum and C. siamense in Japan. Fungal Dis. 2016, 82, 33–37. [Google Scholar] [CrossRef] [Scilit]
- Chunhua, L.; Huan, Y.; Xiaoyu, Z.; Xiaohan, P.; Wenbo, L.; Weiguo, L.; Fucong, Z. Identification and phylogenetic analysis of anthracnose pathogen Colletotrichum siamense and C. fructicola isolated from Rubber Tree in Hainan. Chin. J. Trop. Crops 2018, 39, 129–136. [Google Scholar] [CrossRef]
- Qinghai, W.; Kun, F.; Dewei, L.; Shanguang, N.; Xiaoqin, W. Walnut anthracnose caused by Colletotrichum siamense in China. Australas. Plant Pathol. 2017, 46, 585–595. [Google Scholar] [CrossRef] [Scilit]
- Fu, M.; Crous, P.W.; Bai, Q.; Zhang, P.F.; Xiang, J.; Guo, Y.S.; Zhao, F.F.; Yang, M.M.; Hong, N.; Wang, G.P. Colletotrichum species associated with anthracnose of Pyrus spp. in China. Pers. Mol. Phylogeny Evol. Fugal 2019, 42, 421–435. [Google Scholar] [CrossRef] [Scilit]
- Ling, J.F.; Song, X.B.; Xi, P.G.; Cheng, B.P.; Cui, Y.P.; Chen, X.; Peng, A.T.; Zhang, L.H. Identification of Colletotrichum siamense causing litchi pepper spot disease in mainland China. Plant Pathol. 2019, 68, 1533–1542. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.P.; Zhou, J.; Jiao, Z.B. Amorphophallus konjac anthracnose caused by Colletotrichum siamense in China. J. Appl. Microbiol. 2020, 128, 225–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shengfeng, M.; Haodong, C.; Yanjun, L. First report of the Colletotrichum siamense species complex causing anthracnose on Photinia × fraseri Dress in China. Plant Dis. 2020, 105, 510. [Google Scholar] [CrossRef] [Scilit]
- Lu, Q.; Wang, Y.; Li, N.; Ni, D.; Yang, Y.; Wang, X. Differences in the characteristics and pathogenicity of Colletotrichum camelliae and C. fructicola isolated from the tea plant [Camellia sinensis (L.) O. Kuntze]. For. Microbiol. 2018, 9, 30–60. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.Y.; Su, S.C.; Liu, T.; Fan, G.; Wang, J. First report of anthracnose caused by Colletotrichum gloeosporioides on pistachio (Pistacia vera) in China. Plant Dis. 2011, 95, 1314. [Google Scholar] [CrossRef] [Scilit]
- Sharma, G.; Pinnaka, A.K.; Shenoy, B.D. Resolving the Colletotrichum siamense species complex using ApMat marker. Fungal Divers. 2015, 71, 247–264. [Google Scholar] [CrossRef] [Scilit]
- Yaowen, Z.; Rong, S.; Yixue, M.; Qiqin, L.; Wei, L.; Gaoqing, Y. Colletotrichum siamense: A novel leaf pathogen of Sterculia nobilis Smith detected in China. For. Pathol. 2020, 50, e12575. [Google Scholar] [CrossRef] [Scilit]
- Afanador-Kafuri, L.; Minz, D.; Maymon, M.; Freeman, S. Characterization of Colletotrichum isolates from tamarillo, passiflora, and mango in colombia and identification of a unique species from the genus. Phytopathology 2003, 93, 579–587. [Google Scholar] [CrossRef] [Scilit]
- Gazis, R.; Rehner, S.; Chaverri, P. Species delimitation in fungal endophyte diversity studies and its implications in ecological and biogeographic inferences. Mol. Ecol. 2011, 20, 3001–3013. [Google Scholar] [CrossRef] [Scilit]




| Gene | Product Name | Primers | Sequence (5′–3′) | Reference |
|---|---|---|---|---|
| ACT | Actin | ACT-512F ACT-783R | ATGTGCAAGGCCGGTTTCGC TACGAGTCCTTCTGGCCCAT | [20] |
| CAL | Calmodulin | CL1C CL2C | GAATTCAAGGAGGCCTTCTC CTTCTGCATCATGAGCTGGAC | [13] |
| GAPDH | Glyceraldehyde-3- Phosphate dehydrogenase | GDF GDR | GCCGTCAACGACCCCTTCATTGA GGGTGGAGTCGTACTTGAGCATGT | [21] |
| CHS-1 | Chitin synthase | CHS-79F CHS-345R | TGGGGCAAGGATGCTTGGAAGAAG TGGAAGAACCATCTGTGAGAGTTG | [20] |
| ITS | Internal transcribed spacer | ITS-1F ITS-4 | CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC | [22] [23] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, L.; Zhang, Y.; Chen, W.; Mao, B. Colletotrichum siamense Strain LVY 9 Causing Spot Anthracnose on Winterberry Holly in China. Microorganisms 2023, 11, 976. https://doi.org/10.3390/microorganisms11040976
Feng L, Zhang Y, Chen W, Mao B. Colletotrichum siamense Strain LVY 9 Causing Spot Anthracnose on Winterberry Holly in China. Microorganisms. 2023; 11(4):976. https://doi.org/10.3390/microorganisms11040976
Chicago/Turabian StyleFeng, Lin, Yahui Zhang, Weiliang Chen, and Bizeng Mao. 2023. "Colletotrichum siamense Strain LVY 9 Causing Spot Anthracnose on Winterberry Holly in China" Microorganisms 11, no. 4: 976. https://doi.org/10.3390/microorganisms11040976
APA StyleFeng, L., Zhang, Y., Chen, W., & Mao, B. (2023). Colletotrichum siamense Strain LVY 9 Causing Spot Anthracnose on Winterberry Holly in China. Microorganisms, 11(4), 976. https://doi.org/10.3390/microorganisms11040976

