Next Article in Journal
Special Issue “Biotechnological Application of Photosynthetic Bacteria”
Previous Article in Journal
Animal Models for Studying Congenital Transmission of Hepatitis E Virus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigating Catheter-Related Infections in Southern Benin Hospitals: Identification, Susceptibility, and Resistance Genes of Involved Bacterial Strains

by
Victorien Tamègnon Dougnon
*,
Kevin Sintondji
,
Charles Hornel Koudokpon
,
Morènikè Houéto
,
Alidehou Jerrold Agbankpé
,
Phénix Assogba
,
Alida Oussou
,
Anderson Gnamy
,
Boris Legba
,
Abdoulaye Idrissou
and
Honoré Sourou Bankole
Research Unit in Applied Microbiology and Pharmacology of Natural Substances, Research Laboratory in Applied Biology, Polytechnic School of Abomey-Calavi, University of Abomey-Calavi, Cotonou BP 526, Benin
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(3), 617; https://doi.org/10.3390/microorganisms11030617
Submission received: 21 January 2023 / Revised: 7 February 2023 / Accepted: 10 February 2023 / Published: 28 February 2023
(This article belongs to the Section Medical Microbiology)

Abstract

The use of catheters and bladder catheters in hospitals can increase the risk of bacterial infections. This study aimed to identify the bacterial strains involved in catheter-related infections (CRI) in southern Benin hospitals. The study included 407 samples, including 95 catheter tip samples and 312 urine samples collected from bladder catheters from patients on the first day and 48 h after admission. The catheter tip samples were analyzed using traditional bacterial isolation and identification methods, while the urine samples were analyzed using VITEK-2. Antibiotic sensitivity was tested using the Kirby Bauer method, and virulence and resistance genes were detected through standard PCR. The results showed a predominance of Escherichia coli (53.5%), Klebsiella pneumoniae (23.3%), and Enterobacter aerogenes (7.0%) among Gram-negative bacilli, and coagulase-negative Staphylococcus as the most identified cocci. Bacterial susceptibility to antibiotics showed variable levels of resistance, with blaTEM being detected in 42.9% of identified bacterial species, followed by blaSHV (26.2%) and blaCTX-M-15 (16.7%). The blaNDM gene was only found in three identified bacterial strains, while vanA and vanB genes were detected in 3.2% of strains with a prevalence of 55% for the mecA gene. A prevalence of 18.8% for fimH was noted for the virulence genes. In conclusion, this study highlights the importance of following proper hygiene and aseptic practices during catheterization to effectively prevent CRIs. These findings should be used to improve interventions in hospitals and reduce healthcare-associated infections in developing countries.

1. Introduction

Healthcare-associated infections (HAIs) are a significant concern worldwide, caused by a variety of factors such as poor hospital environments, and the use of invasive devices such as catheters and probes. CRIs are one of the most common HAIs and can lead to increased morbidity, mortality, longer hospital stays, and increased costs [1,2,3,4]. Catheterization is a common procedure in hospital settings, with up to 80% of patients in critical care, neonatology, and pediatrics being catheterized [5]. The use of catheters and bladder catheters can lead to the spread of bacteria and cause infections such as urinary tract infections [6]. Germs can also be responsible for infections known as urinary tract infections related to bladder catheterization [7]. Catheter-related infections (CRIs) are nosocomial infections of concern. They are responsible for increased morbidity and mortality, longer lengths of stay and increased hospital costs [6,8]. These are the most common in the world and can rapidly become complicated with bacteraemia [9]. A total of 12–16% of hospitalized patients will require a urinary examination [10]. The infections often involve bacteria that make therapy complex [11]. Some studies carried out in West Africa have pointed to the real problem posed by infections due to catheters and bladder probes. The prevalence of infections due to catheterization and bladder probes varies from 5.8% to 38.6% in African countries [10,11]. Particularly in Benin, a study by Dougnon and his collaborators carried out in 2016 in the Zinvié’s area hospital (La Croix) showed that only 48 h after a catheter placement, 23.3% of patients (14 out of 60) contracted a urinary tract infection due to bladder catheters. These studies also revealed that the majority of bacteria isolated from catheters and bladder catheters are resistant to ampicillin and cefotaxime. While data and indicators are well monitored in industrialized countries, they are much less so in developing countries like Benin. In addition, the invasive procedures performed by the nursing staff, combined with their poor training, contribute to the alarming situation of these infections [12]. Studies in Benin have revealed poor hygiene in health facilities [13,14,15] and a lack of training of medical personnel in invasive procedures. To address this issue, various intervention projects in Benin aim to improve the technical skills of medical personnel [16]. However, there is no specific study that has analyzed the impact of these factors on the occurrence of infections. In the hospital environment in Benin, there is a risk of nosocomial infections, especially those related to catheterization. To better manage these infections, it is important to understand the bacterial ecology and antibiotic resistance levels involved. The incidence of catheter-related infections is still poorly understood, with only a study by Dougnon et al. [17] showing a high incidence of 33.7% in an urban environment. These observations suggest that the situation may be even more serious in rural areas due to a lack of hygiene and information on preventive measures. Therefore, this study was initiated with the aim of evaluating the status of catheterization and characterizing the bacterial strains involved in catheter-related infections in hospitals in southern Benin. The study aims to answer two questions: What is the level of knowledge about catheterization-related infections in the hospital environment in Benin, and what is the microbiological profile (resistance and virulence) of the bacteria involved in these infections? This study was conducted to assess the situation of catheterization and identify the bacterial strains responsible for CRI in some hospitals located in Southern Benin.

2. Materials and Methods

2.1. Ethical Approval

The research in our study, including sampling from hospitalized patients, sample processing, and data analysis, was carried out in accordance with the Declaration of Helsinki and was approved by the National Health Research Ethics Committee of Benin under reference number N°67/MS/DC/SGM/DRFMT/CNERS/SA dated 20 April 2021. Furthermore, written informed consent was obtained from all patients and/or their legal representatives.

2.2. Study Design

This study was a prospective and descriptive study conducted in southern Benin between June 2021 and June 2022. The study was carried out in two stages. The first stage took place from June to August 2021 in the Departmental Hospital of Lokossa and the Comè’s Area Hospital, located in rural areas. The study population consisted of neonates, children, and adults who underwent catheterization during the study period. Patients who were unable to undergo catheterization and those who were diagnosed with sepsis before catheterization were excluded. The catheter tips were collected from the veins of the patients. The techniques and methods used by health workers involved in catheterization were recorded, and the practice of hygiene measures was evaluated. A compliance rate of at least 60% was considered acceptable. The second stage of the study was conducted in four hospitals in Cotonou, including the Hubert Koutoukou Maga’s National University Hospital Center, the Bethesda Health Center, Saint Luc’s Hospital, and Suru-Léré’s Hospital. The emergency, medical, gynecological, and surgical departments were included in the study. Urine was collected from patients who underwent bladder catheterization, along with socio-demographic data. All patients who consented, either verbally or through their parents in the case of comatose patients, were included in the study. The study was approved by the National Health Research Ethics Committee of Benin (N°67/MS/DC/SGM/DRFMT/CNERS/SA of 20th April 2021) and all patients or their legal representatives provided written informed consent.

2.3. Samples Collection

The sample size was determined using the Schwartz [18] formula n = z 2 × p × q d 2 , with n = required sample size, p = prevalence; p = 0.5; q = 1 − p; z = confidence level according to the centered reduced normal distribution (for a confidence level of 95%, z = 1.96); d = margin of error tolerated for this study equal to 0.05 [18]. So, n = 385.
Thus, we collected a total of 407 samples, including 95 catheter tips and 312 urine samples. Of the 95 catheter samples, 30 were from the Departmental Hospital of Lokossa and 65 from the Comè Zone Hospital. The 312 urine samples from bladder catheters were collected from 85 patients at the CNHU of Cotonou, 70 patients at the Bethesda Health Center, 80 patients at Saint Luc Hospital, and 77 patients at Suru-Léré’s Hospital. The catheter tips were immediately collected after use and placed in sterile, dry tubes. The urine samples were collected 10 minutes after the catheterization and 48 h later (Day 3) using a 10 mL single-use syringe. The catheter was clamped for 10 min to allow urine to accumulate upstream before being disinfected with alcohol. The samples were then transported in coolers with accumulators to the Laboratory of the Research Unit in Applied Microbiology and Pharmacology of Natural Substances at the University of Abomey-Calavi for analysis.

2.4. Isolation and Identification of Bacterial Strains

For each catheter sample, 3 mL of Mueller Hinton broth was added, and it was then incubated at 37 °C for 24 h. Every 24 h, the culture broth was then inoculated on Eosin Methylene Blue (EMB), mannitol salt, Mueller Hinton (MH) agar enriched with fresh sheep blood, and incubated again at 37 °C for another 24 h. The isolated colonies underwent Gram staining and purification, and a Gram control was performed to verify the purity of the strains. The catalase test, free staphylocoagulase test, DNase test, and the determination of the type of hemolysis for catalase-negative strains were carried out to identify Gram-positive cocci. The identification of Enterobacterales species was done using API 20 E gallery.

2.5. Antibiotic Susceptibility Testing of Identified Species

The susceptibility of the isolated Enterobacterales was tested against 13 different antibiotics using the disc diffusion method on Mueller Hinton agar medium. This was done in accordance with the recommendations of the Antibiogram Committee of the French Society of Microbiology [19]. The bacterial suspension was standardized using the McFarland 0.5 control, and the following antibiotics were studied: Amoxicillin + clavulanic acid (30 µg), Ampicillin (10 µg), Fosfomycin (30 µg), Imipenem (10 µg), Ceftriaxone (30 µg), Nalidixic acid (30 µg), Oxacillin (5 µg), Chloramphenicol (25 µg), Vancomycin (5 µg), Erythromycin (15 µg), Kanamycin (30 µg), Gentamycin (10 µg), and Tobramycin (10 µg).
The analysis of urine samples was performed to identify bacterial species and determine their antibiotic susceptibility profile using the VITEK 2 COMPACT-AST-N233 system according to the manufacturer’s recommendations from BioMerieux®. The card used for the antibiotic susceptibility test contained the following antibiotics: Ampicillin (10 µg), Amoxicillin (20 µg), Amoxicillin/Clavulanic acid (20–10 µg), Cefalotin (30 µg), Cefotaxime (5 µg), Cefoxitin (30 µg), Ceftaxidime (10 µg), Ciprofloxacin (5 µg), Gentamicin (10 µg), Imipenem (10 µg), Nalidixic Acid (30 µg), Ofloxacin (5 µg), Ertapenem (10 µg), Nitrofurantoin (100 µg), Piperacillin/Tazobactam (30–6 µg), Ticarcillin (75 µg), Tobramycin (10 µg), and Trimethoprim-sulfamethoxazole (1.25–23.75 µg).

2.6. Molecular Identification of Resistance and Virulence Genes

The genetic material (DNA) of the identified bacterial species was extracted and the standard PCR technique was used to detect resistance genes (blaCTXM-1, blaCTXM-15, blaSHV, blaTEM, blaNDM, blaVIM, blaKPC, and blaOXA-48 for enterobacteria strains, and vanA, vanB, and mecA for Gram-positive cocci strains) and virulence genes (fimH and ISS). The PCR protocol consisted of an initial denaturation step at 94 °C for 4 min for all the genes, followed by specific cycles for each gene. For blaCTXM-1, blaCTXM-15, blaSHV, blaTEM, blaNDM, blaVIM, blaKPC, and blaOXA-48 genes, 30 cycles of denaturation at 94 °C for 30 s, hybridization at 55 °C for 30 s, and elongation at 72 °C for 40 s were performed. For mecA, vanA, and vanB genes, 30 cycles of denaturation at 94 °C for 60 s, hybridization at 50 °C for 60 s, and elongation at 72 °C for 60 s were performed. Finally, for fimH and ISS genes, 40 cycles of denaturation at 94 °C for 40 s, hybridization at 50 °C for 60 s, and elongation at 72 °C for 60 s were performed. The cycles were followed by a final elongation step at 72 °C for 5 min. The primers used in the PCR reaction are listed in Table 1.

2.7. Data Analysis

The statistical analysis was conducted using IBM SPSS Statistics 22 software. The graphs were created and edited using GraphPad Prism. The Chi2 test was employed to determine any possible associations between catheter-associated infections and the following variables: age, gender, appearance of bandages during catheter removal, type of product infused through the catheter, use of antiseptic prior to catheter placement, use of antiseptic during catheter placement, type of antiseptic solution used, duration of catheterization, presence of varnish after catheterization, hand hygiene practices before and during catheter removal, sterilization of materials, size of catheter, type of vein, placement site, and presence of tubular reflux during catheter removal.

3. Results

3.1. Venous Catheter Infection

A total of 95 catheter tips was collected for this study. Among the samples collected, 41 were positive after bacterial culture.

3.1.1. Catheterization in the Departmental Hospital of Lokossa and the Comè Zone Hospital

The results of the study showed that the majority of the samples (68.4%) came from Comè’s hospital, with a higher percentage of female patients (62.1%) compared to male patients (37.9%). The infection due to catheterization was more prevalent in women (33.7%). The age groups of 0-10 years and 20-30 years were the most represented (26.3% and 25.3% respectively). Nurses were the most represented professional category (78.9%). The most commonly used catheter sizes were G20 and G24 (45.3% and 27.4% respectively) and the peripheral vein was the most used (97.8%) with the upper limb being the most commonly used placement site (93.7%). In 52% of the samples, the duration of catheterization was between 48 and 96 h. Antiseptic was used before catheter insertion in 98.95% of cases, but during removal in only 78.9% of cases. Hand washing was performed in 74.7% of cases, but the material used during catheterization was not sterile in 94.7% of cases. There was no tubular reflux during catheter removal in 75.8% of cases, and germs were found in 43.2% of catheters. Alcohol at 70° was the most commonly used solution for disinfection (91.6%).
The study showed a significant association between the aspect of the bandages during removal and the infection of the catheter (p = 0.013), with 47.4% of the bandages being soiled. The study also showed a significant link between the nature of the product injected by the catheter and the infection of the catheter (p = 0.028). The bacterial culture revealed that 14.6% of the samples were polymicrobial (Table 2).

3.1.2. Identified Bacterial Species and Their Resistance Profile

The results of the catheter bacterial culture showed that 14.63% of the samples were found to contain multiple types of bacteria. The most common species were Coagulase Negative Staphylococci, accounting for 61.70%, followed by Klebsiella pneumoniae (8.5%), Pseudomonas aeruginosa (6.4%), and Enterobacter cloacae (6.4%) as shown in Figure 1. The results of the antibiotic susceptibility test indicated that coagulase negative Staphylococci displayed strong resistance to chloramphenicol (54.8%) and nalidixic acid (67.7%). The gram-negative bacilli showed resistance to ceftriaxone (68.7%) and ampicillin (75%). However, no resistance was observed for imipenem (Table 3 and Table 4).

3.1.3. Resistance and Virulence Genes Detected

The results of the study showed that 55% of the Staphylococci strains from catheter tips tested positive for the mecA gene. In contrast, the vanA and vanB genes were found in only 1% of the coagulase-negative Staphylococci strains. The blaTEM gene was present in 47.8% of the Gram-negative strains. All of the Enterobacter cloacae and Escherichia coli strains tested positive for the blaTEM gene, while none of the Klebsiella pneumoniae strains tested positive for the blaTEM gene, but all carried the blaSHV gene. The blaCTX-M-15 gene was the most common in both enterobacteria and non-enterobacteria strains, found in 50% of the strains tested. Out of these strains, only 18.8% of Klebsiella pneumoniae species tested positive for the fimH virulence gene. No strains tested positive for the ISS virulence gene. It is worth noting that, in addition to their resistance to antibiotics, the bacterial species responsible for bacteremia due to catheter-related care are also highly virulent (Table 5)

3.2. Bladder Catheter Infections

A total of 312 catheter bladder were collected for this study. Among the samples collected, 86 were positive after bacterial culture.

3.2.1. Sociodemographic Data and Clinical Factors Related to the Occurrence of Urinary Tract Infections in Cotonou Hospitals in Benin

The results of the study showed that 64.7% of the patients who provided urine samples were female. More than 90% of the patients who had a urinary tract infection were under 70 years of age (Table 6). The majority (31%) of the patients treated with third-generation cephalosporins had infections with a risk factor, representing 12.3% of the total cases. Out of the reasons for hospitalization, 4.5% of women who underwent caesarean section contracted a urinary tract infection, while 24.36% of those who had a urinary catheter in place also developed an infection (OR = 0.97) (Table 7).

3.2.2. Identified Bacterial Species and Their Resistance Profile

The most commonly isolated bacterial species from urine samples were Escherichia coli (53.5%), Klebsiella pneumoniae (23.3%), Enterobacter aerogenes (7%) and Citrobacter freundii (4.7%) (Figure 2). The different bacterial strains isolated showed varying patterns of antibiotic resistance. The isolated strain of Staphylococcus lentus was resistant to all antibiotics except clindamycin and vancomycin. Among the beta-lactam antibiotics tested on the isolated Gram-negative bacilli, the highest rates of resistance were observed for ticarcillin (93.02%), amoxicillin (79.07%), cephalothin (62.07%) and cefotaxime (53.48%). A high resistance rate (86.05%) was also noted for the trimethoprim/sulfamethoxazole combination. Overall, 74.42%, 65.12% and 62.79% of the Gram-negative bacilli were resistant to nalidixic acid, ciprofloxacin, and ofloxacin, respectively. All strains were sensitive to ertapenem. Regarding the isolated Enterobacterales strains, all Escherichia coli, Klebsiella pneumoniae, and Enterobacter aerogenes strains were resistant to ticarcillin, and all Escherichia coli and Klebsiella pneumoniae strains were resistant to amoxicillin. For the non-enterobacterial strains, with the exception of Pseudomonas aeruginosa strains, which were only resistant to cefotaxime, the other strains of other species were multidrug-resistant (Table 8).

3.2.3. Resistance and Virulence Genes Detected

A total of five resistance genes was detected in bacterial species from urine samples, including blaTEM (42.9%), blaSHV (26.2%), blaCTXM1 (28.6%) and blaCTXM15 (16.7%). The blaNDM gene (7.1%) was the only carbapenem resistance gene detected and was found in Escherichia coli and Klebsiella pneumoniae.
All detected genes were found in at least one strain of Escherichia coli or Klebsiella pneumoniae. No resistance genes were detected in Staphylococcus lentus (Table 9).

4. Discussion

4.1. Epidemiological Characteristics of the Study Population and Aspects Related to In-Hospital Care

The impact of catheterization on the occurrence of bacteraemia is of utmost significance in health care. Our study included patients of various genders and ages. The sample size of female patients was larger than that of male patients, and the examination of the relationship between patient gender and catheter infection showed a significant correlation. This suggests that women are more likely to be hospitalized for catheter-related care and are more susceptible to infections. These findings are in line with previous studies, such as [25], where most bladder catheter patients in a southern Benin hospital were female (75%). Many studies worldwide have reported a high incidence of urinary tract infections in female patients with bladder catheters [26,27]. A meta-analysis of various studies on risk factors for catheter-associated urinary tract infections found that female gender was a commonly reported determinant factor [28]. This female predilection may be attributed to anatomy, as the female urethra is short and wide, providing a direct pathway for bacteria to reach the bladder [27]. The age group 0-10 years (26.3%) was the most prevalent among patients from whom catheter tips were collected. This is in line with previous research, which shows that catheter-related bacteraemia is more common in neonates and children [29]. This can be partly attributed to the immune incompetence of children, especially neonates [29]. According to Douard [30], the frequency of catheter-related bacteraemia remained constant throughout the hospitalization period. In this study, 98.9% of nurses utilized good aseptic techniques before catheter placement, although they were unaware of their importance in catheter removal (78.9% of cases). The disinfection process was of good quality and alcohol at 70 °C was the most commonly used solution (91.6%). Handwashing was performed before catheter insertion and during removal in 74.7% of cases. These results indicate that disinfection, the alcohol solution used, or the cleanliness of the hands of the catheterization agents were not related to the causes of bacteraemia. However, the material used during catheterization in the participating hospitals was not sterile in 94.7% of cases, and 47.4% of bandages were soiled. This highlights the need for education and training for healthcare professionals to emphasize the importance of using sterile materials and proper techniques for removing catheters to reduce the risk of infections. Non-sterilized equipment and contaminated bandages can increase the risk of infection in patients after catheter placement. This conclusion aligns with the findings of Dougnon et al. [17], who demonstrated a significant correlation between infection and the condition of the bandages at catheter removal. The relationship between infection and bandage condition may be due to the contamination of the bandages. It is recommended to cover the catheter insertion site with a sterile, transparent polyurethane bandage (B-3) to facilitate monitoring. Previous research has shown that increasing age is a risk factor for urinary tract infections (UTIs) in catheterized patients. Although over 90% of the patients in our study were under 70 years of age, special consideration should be given to elderly patients undergoing catheterization [31].

4.2. Bacterial Species Identified and Sensitivity to Antibiotics

The most commonly identified bacterial species found at the end of the catheters were coagulase-negative Staphylococcus (61.7%), followed by Pseudomonas aeruginosa (6.4%), Citrobacter freundii (4.3%), Enterobacter gergoviae (2.1%), and Enterobacter spp. (4.3%). Other species included Escherichia vulneris (2.1%), Klebsiella oxytoca (4.3%), Klebsiella pneumoniae (2.1%), Klebsiella spp. (2.1%), Shigella sonnei (2.1%), Staphylococcus aureus (4.3%), and Yersinia pestis (4.3%). According to Lachassinne et al. [32], Gram-positive cocci, such as Staphylococcus aureus and coagulase-negative Staphylococcus, are involved in 75% of catheter-related infections. Our results align with these findings. Coagulase-negative Staphylococci have been identified as a significant contributor to nosocomial bacteremia in numerous studies [33,34,35]. This highlights the importance of addressing the issue for the overall well-being of the population, especially children. Several studies, including those by Floret et al. [36], have shown the role of Pseudomonas aeruginosa in hospital-acquired infections, and our results are consistent with the findings of Lukuke et al. [37]. Our results did not show Escherichia coli, Proteus vulgaris, or Enterobacter cloacae, which was different from the findings of Dougnon et al. [17]. Yersinia pestis was not reported in Dougnon et al. [17]. These differences could be attributed to the specific care environment. Antibiotic susceptibility testing showed a high prevalence of multidrug-resistant strains, including resistance to ceftriaxone. This highlights the importance of finding solutions to improve patient care, especially in light of the ongoing shortage of antibiotics. This observed resistance is believed to be due to the frequent use of antibiotics in treating bacterial infections. The antibiogram of the cocci showed that 16.1% were resistant to vancomycin.
The high prevalence of E. coli among the Gram-negative bacilli isolated from urine samples supports the findings of Koçak et al. [38], who reported that this bacterium is the most commonly involved in catheter-associated UTIs. This result is also consistent with the results of several studies conducted in other countries that focused on the role of enterobacteria in nosocomial UTIs [39,40,41]. The high involvement of E. coli in UTIs can be attributed to its pathogenic factors, such as pili that enable it to bind to the urinary epithelium and prevent elimination through urine [42]. In addition to E. coli, other bacteria were also isolated, including E. aerogenes (7%), Citrobacter freundii (4.7%), and non-enterobacteria, such as Pseudomonas luteola, P. aeruginosa, P. putida, and S. paucimobilis (2.3% each). The role of these bacteria in nosocomial UTIs has been reported in previous studies [43]. Our study also identified the presence of Staphylococcus lentus, which is consistent with the findings of Al-azawi et al. [44]. Antibiotic susceptibility testing showed that the S. lentus strain was resistant to all antibiotics except clindamycin and vancomycin, similar to the results of Al-Salamy et al. [45].
For Gram-negative bacilli, high resistance to beta-lactams, such as ticarcillin (93%), amoxicillin (79.1%), cefalotin (62.1%), and cefotaxime (53.5%), was observed. This resistance is also reported by [46]. However, all strains were sensitive to ertapenem, as reported by Chaussade et al. [47]. This differential resistance may be due to the overconsumption of antibiotics in developing countries [48] and self-medication, as well as a lack of infection management guidelines [49]. Among the enterobacteria, all strains of E. coli, Klebsiella pneumoniae, and E. aerogenes were resistant to ticarcillin and amoxicillin. Additionally, 100% of E. aerogenes and 95.7% of E. coli strains were resistant to the combination of trimethoprim/sulfamethoxazole, which is consistent with the findings of Konaré [50]. All Citrobacter freundii strains were resistant to amoxicillin/clavulanic acid, cefalotin, cefoxitin, and nalidixic acid, similar to the results of Kbirou et al. [51]. The non-enterobacteria strains were mostly multidrug-resistant, with the exception of P. aeruginosa strains that were only resistant to cefotaxime, consistent with the results of Bitsori et al. [52]. The study also revealed a total of five resistance genes.

4.3. Resistance and Virulence Genes Detected

The ranking of bacterial species found in urine samples showed that the most frequently detected resistance gene was blaTEM (42.9%), followed by blaSHV (26.2%), blaCTX-M1 (28.6%), and blaCTX-M15 (16.7%). These results align with the results of phenotypic tests, which showed a high incidence of beta-lactam resistance. Prior studies have also reported the presence of these same resistance genes in uropathogenic bacteria, with blaCTX-M being the most prevalent [53,54]. Bacteria employ various mechanisms to resist antibiotics, one of which is the inactivation of the antibiotic through the production of enzymes such as β-lactamases [55,56]. This mechanism represents a significant factor in beta-lactam resistance [57]. β-lactamases can inactivate penicillins, cephalosporins, monobactams, and carbapenems by breaking down the amide bond in the β-lactam ring [58]. The most commonly found enzymes are TEM, SHV, CTX-M, OXA, VIM, IMP, and NDM variants [59]. These genes are often carried by transmissible plasmids and can be horizontally transferred between species [60]. As a result, bacteria that produce these enzymes become multidrug-resistant, reducing treatment options for infections [61]. The blaNDM gene (7.1%), which confers carbapenem resistance, was the only carbapenem resistance gene found and was present in Escherichia coli and Klebsiella pneumoniae. All of the detected genes were present in at least one strain of E. coli or K. pneumoniae. This finding is consistent with the results of a study by El-Houssaini et al. [62], which showed an increase in the frequency of β-lactamase resistance genes (blaTEM, blaSHV, and blaCTX-M) in isolates of E. coli and K. pneumoniae. The potential transfer of ESBL genes to other bacteria is a significant concern in the clinical management of infections caused by ESBL-carrying bacteria [62].

5. Conclusions

This study found a high incidence of Catheter-Related Infections (CRIs) and Urinary Tract Infections (UTIs) associated with bladder catheterization. Factors such as gender, the appearance of the catheter dressing upon removal, the nature of the product injected through the catheter, and the professional category of the nurse who inserts the catheter increase the risk of UTI in patients and are also related to the occurrence of catheter-related bacteremia. The identified bacterial species were multidrug-resistant and carried resistance and virulence genes, constituting a major public health concern. This study will be used to improve patient management in hospitals. However, the main limitation is the absence of sequencing of the multidrug-resistant strains isolated in this study. Further sequencing and analysis of sequences would have provided a deeper understanding of the epidemiology of catheter-related infections in Benin.

Author Contributions

V.T.D. and C.H.K. equally contribute to this manuscript. V.T.D., K.S. and C.H.K. wrote the protocol. K.S., C.H.K., M.H. and A.J.A. processed the samples. C.H.K., V.T.D. and P.A. did the statistical analyses. C.H.K., V.T.D., A.O., A.G. and B.L. wrote the draft of the manuscript. A.I. and H.S.B. reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

All data generated and/or analyzed during the current study are included in this published article. The datasets used and/or analyzed during this study are also available from the corresponding author on reasonable request.

Acknowledgments

The authors are grateful to Eric Agbodjento who helped to address the comments from the reviewers. They also thank Jean Robert Klotoé, Esther Déguénon and Kafayath Fabiyi for their contribution to this work. They are also very grateful to all the staff of the hospitals involved in the study and their willing to support any kind of interventions for a better care of patients. They thank the patients who accepted to participate in this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Forrester, J.; Maggio, P.; Tennakoon, L. Cost of Health Care-Associated Infections in the United States. J. Patient Saf. 2022, 18, e477–e479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Bagley, K.; Severud, L. Preventing Catheter-Associated Urinary Tract Infections with Incontinence Management Alternatives: PureWick and Condom Catheter. Nurs. Clin. N. Am. 2021, 56, 413–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Chenoweth, C.E. Urinary Tract Infections: Update. Infect. Dis. Clin. 2021, 35, 857–870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Zikria, S.; Brian, G.; Mohamed, A.H.; Furqan, K.H.; Faiza, A.; Inayat, R. Point prevalence surveys of health-care associated infections: A systematic review. Pathog. Glob. Health 2019, 113, 191–205. [Google Scholar]
  5. Flores-Mireles, A.L.; Walker, J.N.; Caparon, M.; Hultgren, S.J. Urinary tract infections: Epidemiology, mechanisms of infection and treatment options. Nat. Rev. Microbiol. 2015, 13, 269–284. [Google Scholar] [CrossRef] [Scilit]
  6. Aissaoui, Y.; Chouaib, N.; Chouikh, C.; Rafai, M.; Azendour, H.; Balkhi, H.; Haimeur, C.; Drissi Kamili, N. Central venous catheter-related bacteraemia: Prospective study in a Moroccan medical intensive care unit. Ann. Fr. d’Anesthésie Réanim. 2010, 29, 897–901. [Google Scholar] [CrossRef] [Scilit]
  7. Jiang, J.; DU, L.; Wang, X.; Huang, S.; Hu, W.; Zhou, L.; Liu, X. Specific nursing care improves postoperative urinary control function and self-efficacy in patients undergoing radical prostatectomy. Am. J. Transl. Res. 2022, 14, 1695. [Google Scholar]
  8. Merrer, J. Epidemiology of catheter–related infections in intensive care unit. Ann. Fr. d’Anesthésie Réanim. 2005, 24, 278–281. [Google Scholar] [CrossRef] [Scilit]
  9. Meddings, J.; Rogers, M.A.; Macy, M.; Saint, S. Systematic review and meta-analysis: Reminder systems to reduce catheter-associated urinary tract infections and urinary catheter use in hospitalized patients. Clin. Infect. Dis. 2010, 51, 550–560. [Google Scholar] [CrossRef] [Scilit]
  10. Elahi, R.; Siddiqui, M.H.; Rana, M.A.; Qayyum, M.A.; Iqbal, W.; Khalid, M.S.; Pervaiz, R.; Hafeez, M.M. The efficacy of taurolidine citrate solution versus heparin blocking solution instilled into the catheter lumens of end-stage renal disease. Pak. J. Med. Health Sci. 2022, 16, 152. [Google Scholar]
  11. Sikora, A.; Zahra, F. Nosocomial infections. StatPearls 2022, 5, 14–17. [Google Scholar]
  12. Gad, H.M.; Abdel-Aziz, H.H. Catheter-Associated Urinary Tract Infections in the Adult Patient Group: A Qualitative Systematic Review on the Adopted Preventative and Interventional Protocols from the Literature. Cureus 2021, 13, e16284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Degbey, C.; Aguemon, B.; Ouendo, E.M.; Makoutode, M.; Simon, A. Study of the quality of medical-technical equipment used in operating theaters for the prevention of infections associated with care and services at the National Hospital and University Center of Cotonou in Benin. J. Soc. Clin. Biol. 2013, 18, 29–35. [Google Scholar]
  14. Dougnon, T.V.; Koudokpon, H.; Yossounon, C.; Fabiyi, K.; Legba, B.; Dougnon, J.; Baba-Moussa, L. Infection Risks and Antimicrobial Resistance in Tertiary Hospitals in Benin: Study Cases of Sakété-Ifangni and Menontin Hospitals. Int. J. Infect. 2020, 7, e99649. [Google Scholar] [CrossRef] [Scilit]
  15. Afle, F.C.D.; Agbankpe, A.J.; Johnson, R.C.; Houngbégnon, O.; Houssou, S.C.; Bankole, H.S. Healthcare-associated infections: Bacteriological characterization of the hospital surfaces in the University Hospital of Abomey-Calavi/So-ava in South Benin (West Africa). BMC Infect. Dis. 2019, 19, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Legba, B.B.; Dougnon, V.; Koudokpon, H.; Mero, S.; Elovainio, R.; Parry, M.; Bankole, H.; Haukka, K. Assessment of blood cultures and antibiotic susceptibility testing for bacterial sepsis diagnosis and utilization of results by clinicians in Benin: A qualitative study. Front. Public Health 2023, 10, 1088590. [Google Scholar] [CrossRef] [Scilit]
  17. Dougnon, V.; Koudokpon, H.; Hounmanou, Y.M.; Azonbakin, S.; Fabiyi, K.; Oussou, A.; Codjia, I.; Ahoyo, A.; Baba-Moussa, L.; Bankolé, H. High Prevalence of Multidrug-Resistant Bacteria in the Centre Hospitalier et Universitaire de la Mère et de l’Enfant Lagune (CHU-MEL) Reveals Implications of Poor Hygiene Practices in Healthcare. SN Compr. Clin. Med. 2019, 1, 1029–1037. [Google Scholar] [CrossRef] [Scilit]
  18. Schwartz, D. La méthode statistique en médecine: Les enquêtes éthiologiques. Rev. Stat. Appl. 1960, 8, 5–27. [Google Scholar]
  19. CASFM “Comité de l’Antibiogramme de la Société Française de Microbilogie: Recommandations. 2021. Available online: https://www.sfmmicrobiologie.org/2021/05/06/casfm-eucast-2021-v2/ (accessed on 25 September 2022).
  20. Memariani, M.; Peerayeh, S.N.; Salehi, T.Z.; Mostafavi, S.K.S. Occurrence of SHV, TEM and CTX-M β-lactamase genes among Enteropathogenic Escherichia coli strains isolated from children with diarrhea. Jundishapur J. Microbiol. 2015, 8, e15620. [Google Scholar] [CrossRef] [Scilit]
  21. Cerezales, M.; Biniossek, L.; Gerson, S.; Xanthopoulou, K.; Wille, J.; Wohlfarth, E.; Kaase, M.; Seifert, H.; Higgins, P.G. Novel multiplex PCRs for detection of the most prevalent carbapenemase genes in gram-negative bacteria within Germany. J. Med. Microbiol. 2021, 70, 001310. [Google Scholar] [CrossRef] [Scilit]
  22. Hassan, D.; Omolo, C.A.; Gannimani, R.; Waddad, A.Y.; Mocktar, C.; Rambharose, S.; Agrawal, N.; Govender, T. Delivery of novel Vancomycin nanoplexes for combating methicillin resistant Staphylococcus aureus (MRSA) infections. Int. J. Pharm. 2019, 558, 143–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Yu, Y.; Ji, S.; Chen, Y.; Zhou, W.; Wei, Z.; Li, L.; Ma, Y. Resistance of strains producing extended-spectrum β-lactamases and genotype distribution in China. J. Infect. 2007, 54, 53–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Hassoun-Kheir, N.; Stabholz, Y.; Kreft, J.U.; De La Cruz, R.; Romalde, J.L.; Nesme, J.; Sørensen, S.J.; Smets, B.F.; Graham, D.; Paul, M. Comparison of antibiotic-resistant bacteria and antibiotic resistance genes abundance in hospital and community wastewater: A systematic review. Sci. Total Environ. 2020, 743, 140804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Harbarth, S.; Balkhy, H.H.; Goossens, H.; Jarlier, V.; Kluytmans, J.; Laxminarayan, R.; Saam, M.; Van Belkum, A.; Pittet, D. For the World Healthcare-Associated Infections Resistance Forum participants. Antimicrobial resistance: One world, one fight! Antimicrob. Resist. Infect. Control 2015, 18, 49. [Google Scholar] [CrossRef] [Scilit]
  26. Kim, B.; Pai, H.; Choi, W.S.; Kim, Y.; Kweon, K.T.; Kim, H.A.; Ryu, S.Y.; Wie, S.H.; Kim, J. Current status of indwelling urinary catheter utilization and catheter-associated urinary tract infection throughout hospital wards in Korea: A multicenter prospective observational study. PLoS ONE 2017, 12, e0185369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Kakaria, B.A.; Ashish, K.; Tushar, R. Study of incidence and risk factors for urinary tract infection in catheterized patients admitted at tertiary care. Int. J. Res. Med. Sci. 2015, 6, 1730–1733. [Google Scholar] [CrossRef] [Scilit]
  28. Li, F.; Song, M.; Xu, L.; Deng, B.; Zhu, S.; Li, X. Risk factors for catheter-associated urinary tract infection among hospitalized patients: A systematic review and meta-analysis of observational studies. J. Adv. Nurs. 2019, 75, 517–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Faiq, A.; Najem, J.N. Some of clinical characteristics of neonatal sepsis in Children’s hospital at Kirkuk city, Iraq. Eurasian Med. Res. Period. 2022, 9, 133–138. [Google Scholar]
  30. Douard, M.C. Infections liées aux cathéters (ILC): Moyens diagnostiques. Nutr. Clin. Métab. 2002, 16, 59–61. [Google Scholar] [CrossRef] [Scilit]
  31. Vincitorio, D.; Barbadoro, P.; Pennacchietti, L.; Pellegrini, I.; David, S.; Ponzio, E.; Prospero, E. Risk factors for catheter-associated urinary tract infection in Italian elderly. Am. J. Infect. Control 2014, 42, 898–901. [Google Scholar] [CrossRef] [Scilit]
  32. Lachassinne, E.; Letamendia-Richard, E.; Gaudelus, J. Epidemiology of nosocomial infections in neonates. Arch. Pediatr. Organe Off. Soc. Fr. Pediatr. 2004, 11, 229–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Faye, F.A.; Bingen, E. Place des infections nosocomiales en pédiatrie. Méd. Thér. Pédiatr. 2012, 15, 3–11. [Google Scholar]
  34. Kakupa, D.K.; Muenze, P.K.; Byl, B.; Wilmet, M.D. Etude de la prévalence des infections nosocomiales et des facteurs associés dans les deux hôpitaux universitaires de Lubumbashi, République Démocratique du Congo: Cas des Cliniques Universitaires de Lubumbashi et l’Hôpital Janson Sendwe. Pan Afr. Med. J. 2016, 24, 275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Zemmour, H.; Derbale, F.Z. Incidence des Infections Liées aux Cathéters Veineux Centraux et Périphériques et Facteurs de Risque Attribuables au Niveau du Service de Chirurgie Générale «A» au CHU de Tlemcen. Ph.D. Thesis, Département de Pharmacie, Université Abou Bekr Belkaid, Tlemcen, Algeria, 2016; 150p. [Google Scholar]
  36. Floret, N.; Bertrand, X.; Thouverez, M.; Talon, D. Infections nosocomiales à Pseudomonas aeruginosa: Origine exogène ou endogène de la bactérie responsable? Pathol. Biol. 2009, 57, 9–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Lukuke, H.M.; Kasamba, E.; Mahuridi, A.; Ngatu, N.R.; Narufumi, S.; Mukengeshayi, A.N.; Malou, V.; Makoutode, M.; Kaj, F.M. L’incidence des infections nosocomiales urinaires et des sites opératoires dans la maternité de l’Hôpital Général de Référence de Katuba à Lubumbashi en République Démocratique du Congo. Pan Afr. Med. J. 2017, 28. [Google Scholar] [CrossRef] [Scilit]
  38. Koçak, M.; Büyükkaragöz, B.; Çelebi Tayfur, A.; Çaltik, A.; Köksoy, A.Y.; Çizmeci, Z. Causative pathogens and antibiotic resistance in children hospitalized for urinary tract infection. Pediatr. Int. 2016, 58, 467–471. [Google Scholar] [CrossRef] [Scilit]
  39. Moutachakkir, M.; Chinbo, M.; Elkhoudri, N.; Soraa, N. Antibiotic resistance in uropathogenic Enterobacteriaceae in a pediatric environment at the University Hospital of Marrakech. J. Pediatr. Child. 2015, 28, 16–22. [Google Scholar]
  40. Raji, M.A.; Jamal, W.; Ojemhen, O.; Rotimi, V.O. Point-surveillance of antibiotic resistance in Enterobacteriaceae isolates from patients in a Lagos Teaching Hospital, Nigeria. J. Infect. Public Health 2013, 6, 431–437. [Google Scholar] [CrossRef] [Scilit]
  41. Rangaiahagari, A.; Uwizeyimana, J.P.; Nyirabanzi, J.; Ngoga, E.; Wane, J. Antibiotic sensitivity patterns of Enterobacteriaceae isolated at King Faisal Hospital, Kigali: A three years study. Rwanda Med. J. 2013, 70, 11–14. [Google Scholar]
  42. Sekhsokh, Y.; Chadli, M.; El Hamzaoui, S.A. Frequency and antibiotic susceptibility of bacteria identified in urine. Med. Infect. Dis. 2008, 38, 324–327. [Google Scholar]
  43. Sushitha, T.S.; Suseela, K.V. Catheter Associated Urinary Tract Infections: A Cross-sectional Study from a Tertiary Care Center in Kerala, India. Natl. J. Lab. Med. 2022, 11, 9–12. [Google Scholar] [CrossRef] [Scilit]
  44. Al-azawi, I.H.; Al-hamadan, A.H.; Hasson, S.O. Association between biofilm formation and antibiotic sensitivity in strains of Staphylococccus lentus isolated from urinary catheterized patients. Nano. Biomed. Eng. 2018, 10, 97–103. [Google Scholar] [CrossRef] [Scilit]
  45. Al-Salamy, M.H.; Darweesh, M.F.; Almousawi, A. Study of Staphylococcus lentus isolated from end stage renal failure patients and their antibiotic susceptibility patterns. World J. Pharm. Res. 2017, 6, 186–196. [Google Scholar]
  46. Zahir, H.; Draiss, G.; Rada, N.; Abourrahouat, A.; Sbihi, M.; Bouskraoui, M.; Soraa, N. Microbial ecology and sensitivity to antibiotics of bacteria isolated from urinary tract infections in children in Morocco. Francoph. Rev. Lab. 2019, 211, 65–70. [Google Scholar]
  47. Chaussade, H.; Sunder, S.; Bernard, L.; Coloby, P.; Guy, L.; Karsenty, G. Antibiotic drugs in urology. Progrès Urol. 2013, 23, 1327–1341. [Google Scholar] [CrossRef] [Scilit]
  48. Ouedraogo, A.S.; Pierre, H.J.; Banuls, A.-L.; Ouédraogo, R.; Godreuil, S. Emergence and spread of antibiotic resistance in West Africa: Contributing factors and threat assessment. Trop. Med. Health 2017, 27, 147–154. [Google Scholar] [CrossRef] [Scilit]
  49. Bernabe, K.J.; Langendorf, C.; Ford, N.; Ronat, J.B.; Murphy, R.A. Antimicrobial resistance in West Africa: A systematic review and meta-analysis. Int. J. Antimicrob. Agents 2017, 50, 629–639. [Google Scholar] [CrossRef] [Scilit]
  50. Konaré, S. Sensitivity to Antibiotics of Enterobacteriaceae Strains Isolated in 2016 at the Laboratory of Medical Biology and Hospital Hygiene of the CHU du Point G. Thesis, University of Sciences, Techniques and Technologies of Bamako, Bamako, Mali, 2016. [Google Scholar]
  51. Kbirou, A.; Alafifi, M.; Nedjim, S.A.; Abdi, E.M.; Moataz, A.; Dakir, M.; Debbagh, A.; Aboutaieb, R. Catheter-Associated Urinary Tract Infection, approximately 321 Cases. IJCMCR 2021, 17, 0045. [Google Scholar]
  52. Bitsori, M.; Maraki, S.; Koukouraki, S.; Galanakis, E. Pseudomonas aeruginosa urinary tract infection in children: Risk factors and outcomes. J. Urol. 2012, 187, 260–264. [Google Scholar] [CrossRef] [Scilit]
  53. Ajayi, A.O.; Osanyinlusi, S.A.; Ojerinde, A.; Ogeneh, B. Detection of Extended Spectrum Beta-lactamase Gene (CTX-M) among Representative Multidrug-Resistant Gram-Negative Bacterial Isolates from Patients with Urinary Tract Infection in Ekiti State, Nigeria. Int. J. Trop. Dis. Health 2022, 42, 59–64. [Google Scholar] [CrossRef] [Scilit]
  54. Rajivgandhi, G.; Maruthupandy, M.; Ramachandran, G.; Priyanga, M.; Manoharan, N. Detection of ESBL genes from ciprofloxacin resistant gram-negative bacteria isolated from urinary tract infections (UTIs). Front. Lab. Med. 2018, 2, 5–13. [Google Scholar] [CrossRef] [Scilit]
  55. Singh, S.B.; Barrett, J.F. Empirical antibacterial drug discovery—Foundation in natural products. Biochem. Pharmacol. 2006, 71, 1006–1015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Davies, J. Microbes have the last word: A drastic re-evaluation of antimicrobial treatment is needed to overcome the threat of antibiotic-resistant bacteria. EMBO Rep. 2007, 8, 616–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Conen, A.; Frei, R.; Adler, H.; Dange, I.M.; Fux, C.A.; Widmer, A.F. Microbiological screening is necessary to distinguish carriers of plasmid-mediated AmpC beta-lactamase-producing enterobacteriaceae and extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae because of clinical similarity. PLoS ONE 2015, 10, e0120688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Yusuf, I.; Yushau, M.; Sharif, A.A.; Getso, M.I.; Yahaya, H.; Bala, J.A.; Aliyu, A.I.; Haruna, M. Detection of metallo-betalactamases among gram-negative bacterial isolates from Murtala Muhammad Specialist Hospital, Kano and Almadina Hospital Kaduna, Nigeria. Bayero J. Pure Appl. Sci. 2012, 5, 84–88. [Google Scholar] [CrossRef] [Scilit]
  59. Tzouvelekis, L.S.; Markogiannakis, A.; Psichogiou, M.; Tassios, P.T.; Daikos, G.L. Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: An evolving crisis of global dimensions. Clin. Microbiol. Rev. 2012, 25, 682–707. [Google Scholar] [CrossRef] [Scilit]
  60. Martens, E.; Demain, A.L. The antibiotic resistance crisis, with a focus on the United States. J. Antibiot. 2017, 70, 520–526. [Google Scholar] [CrossRef] [Scilit]
  61. Al-Mahfoodh, W.J.M.; Pekacar, F.S.; Abbas, A.H. The molecular study for evaluation the antibiotic resistance of Escherichia coli and Klebsiella pneumoniae bacteria isolated from urinary tract infection patients. Gene Rep. 2021, 25, 101423. [Google Scholar] [CrossRef] [Scilit]
  62. El-Houssaini, H.H.; Elnabawy, O.M.; Nasser, H.A.; Elkhatib, W.F. Correlation between antifungal resistance and virulence factors in Candida albicans recovered from vaginal specimens. Microb. Pathog. 2019, 128, 13–19. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Percentage of bacterial species isolated from catheter tip samples.
Figure 1. Percentage of bacterial species isolated from catheter tip samples.
Microorganisms 11 00617 g001
Figure 2. Percentage of bacterial species involved in urinary tract infections.
Figure 2. Percentage of bacterial species involved in urinary tract infections.
Microorganisms 11 00617 g002
Table 1. List of genes searched and their different primers.
Table 1. List of genes searched and their different primers.
GenesPrimersSequence 5′-3′References
blaTEMTEM FATGAGTATTCAACATTTCCGC[20]
TEM RCAATGCTTAATCAGTGAGG
blaSHVSHV FAAGATCCACTATCGCCAGCAG
SHV RATTCAGTTCCGTTTCCCAGCGG
blaCTX-M-1CTX-M-1 FGGTTAAAAAATCACTGCGTC
CTX-M-1 RTTGGTGACGATTTTAGCCGC
blaCTX-M-15CTX-M-15 FCACACGTGGAATTTAGGGACT
CTX-M-15 RGCCGTCTAAGGCGATAAACA
blaKPCKPC FCGCCAATTTGTTGCTGAAGG[21]
KPC RCAGGTTCCGGTTTTGTCTCC
blaNDMNDM FGTTTGATCGTCAGGGATGGC
NDM RCTCATCACGATCATGCTGGC
blaVIMVIM FGATGGTGTTTGGTCGCATATC
VIM RCGTCATGAAAGTGCGTGGAG
blaIMPIMP FGAAGGCGTTTATGTTCATAC
IMP RGTACGTTTCAAGAGTGATGC
blaOXA-48OXA-48 FGGTAGCAAAGGAATGGCAAGAA
OXA-48 RCGACCCACCAGCCAATCTTA
vanAvanA FGGGCTGTGAGGTCGGTTG[22]
vanA RTTCAGTACAATGCGGCCGTTA
vanBvanB FTTGTCGGCGAAGTGGATCA
vanB RAGCCTTTTTCCGGCTCGTT
mecAmecA FGTTAGATTGGGATCATAGCGTCATT[23]
mecA RTGCCTAATCTCATATGTGTTCCTGTAT
fimHfimH FTACTGCTGATGGGGCTGGTC[20,24]
fimH RTACTGCTGATGGGGCTGGTC
ISSISS FGGCAATGCTTATTACAGGATGTGC
ISS RGAGCAATATACCCGGGGCTTCC
Table 2. Sociodemographic data and some data related to catheterization in the departmental Hospital of Lokossa and the Comè’s Area Hospital.
Table 2. Sociodemographic data and some data related to catheterization in the departmental Hospital of Lokossa and the Comè’s Area Hospital.
PositiveNegativeTotalChi2Odds RatioZ
Sex
Male9 (9.5%)27 (28.4%)36 (37.9%)0.0050.068−3.53
Female32 (33.7%)27 (28.4%)59 (62.1%)
Age
(0–10)13 (13.7%)12 (12.6)25 (26.3%)0.3300.91−0.53
(10–20)4 (4.2%)6 (6.3%)10 (10.5%)
(20–30)11 (11.6%)13 (13.7%)24 (25.3%)
(30–40)2 (2.1%)11 (11.6%)13 (13.7%)
(40–50)7 (7.4%)4 (4.2%)11 (11.6%)
(50–60)2 (2.1%)2 (2.1%)4 (4.2%)
(60–70)1 (1.1%)3 (3.2%)4 (4.2%)
(70–80)1 (1.1%)3 (3.2%)4 (4.2%)
Professional category
Nurse33 (34.7%)42 (44.2%)75 (79%)0.5520.818−0.45
Health care aide1 (1.1%)4 (4.2%)5 (5.3%)
Midwife7 (7.4%)8 (8.4%)15 (15.8
Catheter size
G185 (5.3%)11 (11.6%)16 (16.8%)0.1730.348−239
G2016 (16.8%)27 (28.4%)45 (45.3%)
G227 (7.37%)3 (3.16%)10 (10.5%)
G2413 (13.7%)13 (13.7%)26 (27.4%)
Type of veins
Peripheral40 (42.1%)53 (55.8%)93 (97.9%)0.8430.15−1.04
Central1 (1.1%)1 (1.1%)2 (2.1%)
Placement site
Upper
extremity
39 (41.05%)50 (52.6%)89 (93.7%)0.74413.831.44
Lower limb1 (1.1%)3 (3.2%)4 (4.2%)
Jugular1 (1.01%)1 (1.1%)2 (2.1%)
Use of antiseptics before
Yes10 (10.5%)10 (10.5%)20 (21.1%)0.4873.561.56
No31 (32.6%)44 (46.3%)75 (79%)
Used solution
Alcohol 7039 (41.1%)48 (50.5%)87 (91.6%)0.3961.50.63
Beta-block
alcohol
1 (1.1%)1 (1.1%)2 (2.1%)
Others1 (1.1%)5 (5.3%)6 (6.3%)
Disinfection quality
Good41 (43.2%)54 (56.8%)95 (100%)
Duration of catheterization
11 (1.1%)0 (0%)1 (1.1%)0.4921.20.90
27 (7.4%)9 (9.5%)16 (16.8%)
315 (15.8%)13 (13.7%)28 (29.45%)
410 (10.5%)14 (14.7%)24 (25.3%)
56 (6.3%)12 (122%)18 (19%)
61 (1.1%)3 (3.2%)4 (4.2%)
70 (0%)2 (2.1%)2 (2.1%)
80 (0%)1 (1.1%)1 (1.1%)
>81 (1.1%)0 (0%)1 (1.1%)
Presence of varnish after catheter placement
Present4 (4.2%)8 (8.4%)12 (12.6%)0.4620.66−0.51
Absent37 (39%)46 (48.4%)83 (83.4%)
Hand washing before catheter insertion
Yes32 (33.7%)39 (41.1%)71 (74.7%)0.5171.890.90
No9 (9.5%)15 (15.8%)24 (25.3%)
Appearance of the bandages upon removal
Dirty22 (23.2%)23 (24.2%)45 (47.4%)0.00131.1850.73
Unstuck3 (3.2%)0 (0%)3 (3.2%)
Unstuck and dirty2 (2.1%)14 (14.7%)16 (16.8%)
Hermeneutical and clean14 (14.7%)17 (17.9%)31 (32.6%)
Nature of the injected product
Antibiotic34 (35.8%)52 (54.7%)86 (90.5%)0.0280.087−2.21
Not
antibiotic
7 (7.4%)2 (2.1%)9 (9.3%)
Table 3. Resistance to antibiotics in strains of Gram-positive cocci.
Table 3. Resistance to antibiotics in strains of Gram-positive cocci.
AMPOXTOBCENAFOXVAN
S. aureus-1 (50%)-2 (100%)1 (50%)1 (50%)-1 (50%)
NCS5 (17%)9 (31%)11 (38%)15 (52%)11 (38%)20 (72%)4 (14%)4 (14%)
Total5 (16.1%)10 (32.4%)11 (35.5%)17 (54.8%)12 (38.7%)21 (67.7%)4 (12.9%)5 (16.1%)
AMP: Ampicillin OX: Oxacillin, TOB: Tobramycin, C: Chloramphenicol, E: Erythromycin, NA: Nalidixic Acid, FOX: Fosfomycin and VAN: Vancomycin; S. aureus: Staphylococcus aureus; -: No resistance.
Table 4. Resistance to antibiotics in strains of Gram-negative bacilli.
Table 4. Resistance to antibiotics in strains of Gram-negative bacilli.
AMPAMCCROIMPKANGENNAFOX
Yersinia enterolitica1 (50%)1 (50%)1 (50%)-1 (50%)1 (50%)--
Shigella spp.-1 (100%)----1 (100%)-
Klebsiella
pneumoniae
4 (100%)4 (100%)2 (50%)-2 (50%)2 (50%)2 (50%)-
Enterobacter
cloaceae
3 (100%)2 (75%)3 (100%)-3 (100%)3 (100%)-1 (25%)
Pseudomonas
aeruginosa
3 (100%)1 (33%)3 (100%)-1 (33%)1 (33%)1 (33%)3 (100%)
Escherichia coli1 (100%)1 (100%)1 (100%)-1 (100%)1 (100%)--
Citrobacter freundii1 (50%)-1 (50%)--2 (100%)1 (50%)-
Total13 (81.3%)10 (62.5%)11 (68.8%)-8 (50%)10 (62.5%)5 (31.3%)4 (25%)
AMP: Ampicillin, AMC: Amoxicillin + clavulanic acid, CRO: Ceftriaxone, IMP: Imipenem, KAN: Kanamycin GEN: Gentamycin NA: Nalidixic Acid and FOX: Fosfomycin; -: No resistance.
Table 5. Distribution of resistance and virulence genes in enterobacterial and non-enterobacterial strains.
Table 5. Distribution of resistance and virulence genes in enterobacterial and non-enterobacterial strains.
Resistance GenesVirulence Genes
blaTEMblaSHVblaCTX-M-15fimHISS
Yersinia enterolitica1 (50%)1 (50%)2 (100%)--
Shigella spp.1 (100%)1 (100%)---
Klebsiella pneumoniae-4 (100%)1 (25%)4 (100%)-
Enterobacter cloaceae3 (100%)-3 (100%)--
Pseudomonas aeruginosa-----
Escherichia coli1 (100%)-1 (100%)--
Citrobacter freundii1 (50%)-2 (100%)--
Total7 (54%)6 (37.5%)8 (50%)4 (25%)-
-: Absence of resistance genes.
Table 6. Sociodemographic data.
Table 6. Sociodemographic data.
VariableNegativePositiveTotalChi2OR
Sex
Female176 (50%)46 (14.7%)202 (64.7%)0.0701.72
Male70 (22.4%)40 (12.8%)110 (35.3%)
Total226 (72.4%)86 (27.6%)312 (100%)
Age
(20, 30)52 (16.7%)18 (5.7%)70 (22.4%)0.1030.96
(30, 40)62 (19.87%)14 (4.5%)76 (24.4%)
(40, 50)38 (12.2%)16 (5.1%)54 (17.3%)
(50, 60)24 (7.7%)22 (7.1%)46 (14.7%)
(60, 70)30 (9.62%)14 (4.50%)44 (14.1%)
(70, 80)18 (5.8%)0 (0.00%)18 (5.6%)
(80, 90)2 (0.6%)2 (0.6%)4 (1.3%)
Table 7. Clinical factors linked to the occurrence of urinary tract infections by catheterization.
Table 7. Clinical factors linked to the occurrence of urinary tract infections by catheterization.
VariableNegativePositiveTotalPr Chi2OR
Routine antibiotic therapy
Yes110 (35.3%)56 (18%)166 (53.2%)0.0660.36
No116 (37.2%)30 (9.6%)146 (46.8%)
Total226 (72.4%)86 (27.6%)312 (100%)
Type of antibiotic therapy
C3G + Quinolones6 (1.9%)6 (1.9%)12 (3.9%)0.1450.96
3G + SXT22 (7.1%)2 (0.6%)24 (7.7%)
C3G + Aminosides4 (1.3%)2 (0.6%)6 (1.9%)
C3G58 (18.7%)38 (12.3%)96 (31%)
No ATB122 (38.7%)32 (10.3%)154 (49%)
Aminosides6 (1.9%)4 (1.3%)10 (3.2%)
Quinolones2 (0.6%)2 (0.6%)4 (1.3%)
Glycopeptides6 (1.9%)0 (0.0%)6 (1.9%)
Total226 (72.4%)86 (27.6%)312 (100%)
Reason for hospitalization
Uncomplicated delivery8 (2.6%)0 (0.00%)8 (2.6%)0.5170.97
Diabetic
ketoacidosis
8 (2.6%)8 (2.6%)16 (5.1%)
Change in general condition24 (7.70%)6 (1.9%)30 (9.6%)
Stroke24 (7.7%)6 (1.9%)30 (9.6%)
Cesarean section62 (19.9%)14 (4.5%)76 (24.4%)
Coma2 (0.6%)2 (0.6%)4 (1.3%)
Gastroenteritis6 (1.9%)4 (1.3%)10 (3.2%)
Head trauma26 (8.3%)8 (2.6%)34 (10.9%)
Infectious
syndrome
8 (2.6%)8 (2.6%)16 (5.1%)
Postoperative monitoring16 (5.1%)10 (3.2%)26 (8.3%)
Acute retention of urine12 (3.9%)4 (1.3%)16 (5.1%)
Renal failure8 (2.6%)2 (0.6%)10 (3.2%)
Other conditions22 (7.1%)14 (4.5%)36 (11.5%)
Total226 (72.4%)86 (27.6%)312 (100%)
Table 8. Resistance profile (%) of enterobacteria and non-enterobacteria strains to the antibiotics used.
Table 8. Resistance profile (%) of enterobacteria and non-enterobacteria strains to the antibiotics used.
AntibioticsAMXCMATICTZPCFFOXCTXCAZERTIMIANGENTOBN/ACIPOFXTINSXT
Escherichia coli10021.7410017.3932.5630.4343.4843.48---56.5230.4386.9673.9169.5621.7495.65
Klebsiella
pneumoniae
100401003080308080-301080207050503070
Enterobacter
aerogenes
2575100-757550----505075505025100
Citrobacter freundii-10050-100100-----50501005050-50
Pseudomonas
lutola
---100---100--100-100-100100-100
Pseudomonas
aeruginosa
------100-----------
Pseudomonas putida--100100--100--100-100--100100-100
Sphingomonas paucimobilis0010010000100100010010010010001001000100
AMX: Amoxicillin; AMC: Amoxicillin/Clavulanic Acid; TIC: Ticarcillin; TZP: Piperacillin/tazobactam; CF: Cefalotin; FOX: Cefoxitin; CTX: Cefotaxime; CAZ: Ceftazidim; ERT: Ertapenem; IMI: Imipenem; AN: Amikacin; GEN: Gentamicin; TOB: Tobramycin; NA: Nalidixic acid; CIP: Ciprofloxacin; OFX: Ofloxacin; NIF: Nitrofurantoin; SXT: Trimethoprim/Sulfamethoxazole; -: No resistance.
Table 9. Percentages of resistance genes detected from bacterial species isolated from urine.
Table 9. Percentages of resistance genes detected from bacterial species isolated from urine.
Isolated SpeciesGenes
blaTEMblaSHVblaCTXM15blaNDMblaCTXM1
Escherichia coli20 (50%)10 (25%)6 (15%)4 (10%)12 (30%)
Klebsiella pneumoniae10 (55.6%)8 (44.4%)4 (22.2%)2 (11.1%)6 (33.3%)
Citrobacter freundii2 (100%)-2 (100%)-2 (100%)
Pseudomonas putida2 (100%)2 (100%)2 (100%)-2 (100%)
Sphingomonas
paucimobilis
-----
Enterobacter aerogenes2 (100%)2 (100%)---
Total36 (42.9%)22 (26.2%)14 (16.7%)6
(7.2%)
24
(28.6%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dougnon, V.T.; Sintondji, K.; Koudokpon, C.H.; Houéto, M.; Agbankpé, A.J.; Assogba, P.; Oussou, A.; Gnamy, A.; Legba, B.; Idrissou, A.; et al. Investigating Catheter-Related Infections in Southern Benin Hospitals: Identification, Susceptibility, and Resistance Genes of Involved Bacterial Strains. Microorganisms 2023, 11, 617. https://doi.org/10.3390/microorganisms11030617

AMA Style

Dougnon VT, Sintondji K, Koudokpon CH, Houéto M, Agbankpé AJ, Assogba P, Oussou A, Gnamy A, Legba B, Idrissou A, et al. Investigating Catheter-Related Infections in Southern Benin Hospitals: Identification, Susceptibility, and Resistance Genes of Involved Bacterial Strains. Microorganisms. 2023; 11(3):617. https://doi.org/10.3390/microorganisms11030617

Chicago/Turabian Style

Dougnon, Victorien Tamègnon, Kevin Sintondji, Charles Hornel Koudokpon, Morènikè Houéto, Alidehou Jerrold Agbankpé, Phénix Assogba, Alida Oussou, Anderson Gnamy, Boris Legba, Abdoulaye Idrissou, and et al. 2023. "Investigating Catheter-Related Infections in Southern Benin Hospitals: Identification, Susceptibility, and Resistance Genes of Involved Bacterial Strains" Microorganisms 11, no. 3: 617. https://doi.org/10.3390/microorganisms11030617

APA Style

Dougnon, V. T., Sintondji, K., Koudokpon, C. H., Houéto, M., Agbankpé, A. J., Assogba, P., Oussou, A., Gnamy, A., Legba, B., Idrissou, A., & Bankole, H. S. (2023). Investigating Catheter-Related Infections in Southern Benin Hospitals: Identification, Susceptibility, and Resistance Genes of Involved Bacterial Strains. Microorganisms, 11(3), 617. https://doi.org/10.3390/microorganisms11030617

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop