Deciphering Molecular Factors That Affect Electron Transfer at the Cell Surface of Electroactive Bacteria: The Case of OmcA from Shewanella oneidensis MR-1
Abstract
1. Introduction
2. Materials and Methods
2.1. Construction of Plasmids Harboring OmcA Mutants
2.2. Purification of OmcA Mutants
2.3. Cyclic Voltammetry of Native OmcA and OmcA Mutants
2.4. Kinetic Experiments with Electron Shuttles
2.5. Interactions Studies with FMN Using NMR
2.6. Reduction of Methyl Orange by S. oneidensis
2.7. Reduction of Electrodes by S. oneidensis
3. Results
3.1. Not All OmcA Protein Mutant Variants Retain the Native Overall Structure
3.2. Mutations in the Axial Ligands of the Hemes Change the Reduction Potential of the Individual Redox Centers of OmcA
3.3. Mutation of the Axial Ligand of the Respective Heme Affects Electron Transfer Rates from OmcA to Soluble Acceptors
3.4. Mutations in OmcA Did Not Significantly Affect the Binding of FMN
3.5. The Electroactivity of the Different OmcA Mutants in S. oneidensis Generally Matches the Reactivity with Methyl Orange
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Modin, O.; Aulenta, F.; Harnisch, F.; Patil, S.A.; Carmona-Martinez, A.A.; Agarwal, S.; Zhang, Y.; Sinha-Ray, S.; Yarin, A.L.; Greiner, A.; et al. Three Promising Applications of Microbial Electrochemistry for the Water Sector. Environ. Sci. Water Res. Technol. 2017, 3, 391–402. [Google Scholar] [CrossRef] [Scilit]
- Prévoteau, A.; Carvajal-Arroyo, J.M.; Ganigué, R.; Rabaey, K. Microbial Electrosynthesis from CO2: Forever a Promise? Curr. Opin. Biotechnol. 2020, 62, 48–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prévoteau, A.; Rabaey, K. Electroactive Biofilms for Sensing: Reflections and Perspectives. ACS Sens. 2017, 2, 1072–1085. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Aulenta, F.; Puig, S.; Esteve-Núñez, A.; He, Y.; Mu, Y.; Rabaey, K. Microbial Electrochemistry for Bioremediation. Environ. Sci. Ecotechnol. 2020, 1, 100013. [Google Scholar] [CrossRef] [Scilit]
- Glaven, S.M. Bioelectrochemical Systems and Synthetic Biology: More Power, More Products. Microb. Biotechnol. 2019, 12, 819–823. [Google Scholar] [CrossRef] [Scilit]
- Alves, A.S.; Costa, N.L.; Tien, M.; Louro, R.O.; Paquete, C.M. Modulation of the Reactivity of Multiheme Cytochromes by Site-Directed Mutagenesis: Moving towards the Optimization of Microbial Electrochemical Technologies. J. Biol. Inorg. Chem. 2017, 22, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Tefft, N.M.; Teravest, M.A. Reversing an Extracellular Electron Transfer Pathway for Electrode-Driven Acetoin Reduction. ACS Synth. Biol. 2019, 8, 1590–1600. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Ding, Y.; Hu, Y.; Cao, B.; Rice, S.A.; Kjelleberg, S.; Song, H. Enhancing Bidirectional Electron Transfer of Shewanella oneidensis by a Synthetic Flavin Pathway. ACS Synth. Biol. 2015, 4, 815–823. [Google Scholar] [CrossRef] [Scilit]
- Choi, D.; Lee, S.B.; Kim, S.; Min, B.; Choi, I.G.; Chang, I.S.; Bom, S.; Kim, S.; Min, B.; Choi, I.G.; et al. Metabolically Engineered Glucose-Utilizing Shewanella Strains under Anaerobic Conditions. Bioresour. Technol. 2014, 154, 59–66. [Google Scholar] [CrossRef] [Scilit]
- Flynn, J.M.; Ross, D.E.; Hunt, K.A.; Bond, D.R.; Gralnick, J.A. Enabling Unbalanced Fermentations by Using Engineered Electrode- Interfaced Bacteria. MBio 2010, 1, e00190-10. [Google Scholar] [CrossRef] [Scilit]
- Johnson, E.T.; Baron, D.B.; Naranjo, B.; Bond, D.R.; Schmidt-Dannert, C.; Gralnick, J.A. Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping. Appl. Environ. Microbiol. 2010, 76, 4123–4129. [Google Scholar] [CrossRef] [Scilit]
- Ding, Y.; Peng, N.; Du, Y.; Ji, L.; Cao, B. Disruption of Putrescine Biosynthesis in Shewanella oneidensis Enhances Biofilm Cohesiveness and Performance in Cr(VI) Immobilization. Appl. Environ. Microbiol. 2014, 80, 1498–1506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, T.; Yu, Y.Y.; Deng, X.-P.P.; Ng, C.K.K.; Cao, B.; Wang, J.-Y.Y.; Rice, S.A.A.; Kjelleberg, S.; Song, H. Enhanced Shewanella Biofilm Promotes Bioelectricity Generation. Biotechnol. Bioeng. 2015, 112, 2051–2059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kouzuma, A.; Oba, H.; Tajima, N.; Hashimoto, K.; Watanabe, K. Electrochemical Selection and Characterization of a High Current-Generating Shewanella oneidensis Mutant with Altered Cell-Surface Morphology and Biofilm-Related Gene Expression. BMC Microbiol. 2014, 14, 190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, A.V.; Edel, M.; Gescher, J.; Paquete, C.M. Exploring the Effects of BolA in Biofilm Formation and Current Generation by Shewanella oneidensis MR-1. Front. Microbiol 2020, 11, 815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, W.; Lin, Z.; Yu, Q.; Cheng, S.; Gao, H. Promoting Extracellular Electron Transfer of Shewanella oneidensis MR-1 by Optimizing the Periplasmic Cytochrome c Network. Front. Microbiol. 2021, 12, 2963. [Google Scholar] [CrossRef] [Scilit]
- Delgado, V.P.; Paquete, C.M.; Sturm, G.; Gescher, J. Improvement of the Electron Transfer Rate in Shewanella oneidensis MR-1 Using a Tailored Periplasmic Protein Composition. Bioelectrochemistry 2019, 129, 18–25. [Google Scholar] [CrossRef] [Scilit]
- Vellingiri, A.; Song, Y.E.; Munussami, G.; Kim, C.; Park, C.; Jeon, B.H.; Lee, S.G.; Kim, J.R. Overexpression of C-Type Cytochrome, CymA in Shewanella oneidensis MR-1 for Enhanced Bioelectricity Generation and Cell Growth in a Microbial Fuel Cell. J. Chem. Technol. Biotechnol. 2019, 94, 2115–2122. [Google Scholar] [CrossRef] [Scilit]
- Hau, H.H.; Gralnick, J.A. Ecology and Biotechnology of the Genus Shewanella. Annu. Rev. Microbiol. 2007, 61, 237–258. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, B.M.; Soares, R.M.; Paquete, C.M.; Louro, R.O. Bacterial power: An alternative energy source. In Enzymes for Solving Humankind’s Problems; Springer International Publishing: Cham, Switzerland, 2021; pp. 215–246. [Google Scholar]
- Edwards, M.J.; White, G.F.; Butt, J.N.; Richardson, D.J.; Clarke, T.A. The Crystal Structure of a Biological Insulated Transmembrane Molecular Wire. Cell 2020, 181, 665–673.e10. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, B.M.; Paquete, C.M.; Neto, S.E.; Pacheco, I.; Soares, C.M.; Louro, R.O. Mind the Gap: Cytochrome Interactions Reveal Electron Pathways across the Periplasm of Shewanella oneidensis MR-1. Biochem. J. 2013, 449, 101–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chong, G.W.; Pirbadian, S.; Zhao, Y.; Zacharoff, L.A.; Pinaud, F.; El-Naggar, M.Y. Single Molecule Tracking of Bacterial Cell Surface Cytochromes Reveals Dynamics That Impact Long-Distance Electron Transport. Proc. Natl. Acad. Sci. USA 2022, 119, e2119964119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edwards, M.J.; Baiden, N.A.; Johs, A.; Tomanicek, S.J.; Liang, L.; Shi, L.; Fredrickson, J.K.; Zachara, J.M.; Gates, A.J.; Butt, J.N.; et al. The X-Ray Crystal Structure of Shewanella oneidensis OmcA Reveals New Insight at the Microbe-Mineral Interface. FEBS Lett. 2014, 588, 1886–1890. [Google Scholar] [CrossRef] [Scilit]
- Edwards, M.J.; Fredrickson, J.K.; Zachara, J.M.; Richardson, D.J.; Clarke, T.A. Analysis of Structural MtrC Models Based on Homology with the Crystal Structure of MtrF. Biochem. Soc. Trans. 2012, 40, 1181–1185. [Google Scholar] [CrossRef] [Scilit]
- Clarke, T.A.; Edwards, M.J.; Gates, A.J.; Hall, A.; White, G.F.; Bradley, J.; Reardon, C.L.; Shi, L.; Beliaev, A.S.; Marshall, M.J.; et al. Structure of a Bacterial Cell Surface Decaheme Electron Conduit. Proc. Natl. Acad. Sci. USA 2011, 108, 9384–9389. [Google Scholar] [CrossRef] [Scilit]
- Paquete, C.M.; Fonseca, B.M.; Cruz, D.R.; Pereira, T.M.; Pacheco, I.; Soares, C.M.; Louro, R.O. Exploring the Molecular Mechanisms of Electron Shuttling across the Microbe/Metal Space. Front. Microbiol. 2014, 5, 318. [Google Scholar] [CrossRef] [Scilit]
- Lower, B.H.; Lins, R.D.; Oestreicher, Z.; Straatsma, T.P.; Hochella, M.F.; Shi, L.; Lower, S.K. In Vitro Evolution of a Peptide with a Hematite Binding Motif That May Constitute a Natural Metal-Oxide Binding Archetype. Environ. Sci. Technol. 2008, 42, 3821–3827. [Google Scholar] [CrossRef] [Scilit]
- Neto, S.E.; de Melo-Diogo, D.; Correia, I.J.; Paquete, C.M.; Louro, R.O. Characterization of OmcA Mutants from Shewanella oneidensis MR-1 to Investigate the Molecular Mechanisms Underpinning Electron Transfer Across the Microbe-Electrode Interface. Fuel Cells 2017, 17, 601–611. [Google Scholar] [CrossRef] [Scilit]
- Edwards, M.J.; White, G.F.; Norman, M.; Tome-Fernandez, A.; Ainsworth, E.; Shi, L.; Fredrickson, J.K.; Zachara, J.M.; Butt, J.N.; Richardson, D.J.; et al. Redox Linked Flavin Sites in Extracellular Decaheme Proteins Involved in Microbe-Mineral Electron Transfer. Sci. Rep. 2015, 5, 11677. [Google Scholar] [CrossRef] [Scilit]
- Paradisi, A.; Lancellotti, L.; Borsari, M.; Bellei, M.; Bortolotti, C.A.; di Rocco, G.; Ranieri, A.; Sola, M.; Battistuzzi, G. Met80 and Tyr67 Affect the Chemical Unfolding of Yeast Cytochrome c: Comparing the Solution vs. Immobilized State. RSC Chem. Biol. 2020, 1, 421–435. [Google Scholar] [CrossRef] [Scilit]
- Kovach, M.E.; Elzer, P.H.; Steven Hill, D.; Robertson, G.T.; Farris, M.A.; Roop, R.M.; Peterson, K.M. Four New Derivatives of the Broad-Host-Range Cloning Vector PBBR1MCS, Carrying Different Antibiotic-Resistance Cassettes. Gene 1995, 166, 175–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coursolle, D.; Gralnick, J.A. Modularity of the Mtr Respiratory Pathway of Shewanella oneidensis Strain MR-1. Mol. Microbiol. 2010, 77, 995–1008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, L.; Lin, J.; Markillie, L.M.; Squier, T.C.; Brian, S. Overexpression of Multi-Heme c-Type Cytochromes. Biotechniques 2005, 38, 297–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corts, A.D.; Thomason, L.C.; Gill, R.T.; Gralnick, J.A. A New Recombineering System for Precise Genome-Editing in Shewanella oneidensis Strain MR-1 Using Single-Stranded Oligonucleotides. Sci. Rep. 2019, 9, 39. [Google Scholar] [CrossRef] [Scilit]
- Friis, E.P.; Andersen, J.E.T.; Madsen, L.L.; Bonander, N.; Møller, P.; Ulstrup, J. Dynamics of Pseudomonas aeruginosa Azurin and Its Cys3Ser Mutant at Single-Crystal Gold Surfaces Investigated by Cyclic Voltammetry and Atomic Force Microscopy. Electrochim. Acta 1998, 43, 1114–1122. [Google Scholar] [CrossRef] [Scilit]
- Fourmond, V.; Hoke, K.; Heering, H.A.; Baffert, C.; Leroux, F.; Bertrand, P.; Léger, C. QSoas: A Versatile Software for Data Analysis. Anal. Chem. 2016, 88, 5050–5052. [Google Scholar] [CrossRef] [Scilit]
- Massey, V. The Microestimation of Succinate and the Extinction Coefficient of Cytochrome c. Biochim. Biophys. Acta 1959, 34, 255–256. [Google Scholar] [CrossRef] [Scilit]
- Whitby, L. A New Method for Preparing Flavin-Adenine Dinucleotide. Biochem. J. 1953, 54, 437–442. [Google Scholar] [CrossRef] [Scilit]
- Aliverti, A.; Curti, B.; Vanoni, M.A. Identifying and quantitating FAD and FMN in simple and in Iron-Sulfur-Containing flavoproteins. In Flavoprotein Protocols; Chapman, S.K., Reid, G.A., Eds.; Humana Press: Totowa, NJ, USA, 1999; pp. 9–24. ISBN 978-0-89603-734-2/978-1-59259-266-1. [Google Scholar]
- Shi, Z.; Zachara, J.M.; Shi, L.; Wang, Z.; Moore, D.A.; Kennedy, D.W.; Fredrickson, J.K. Redox Reactions of Reduced Flavin Mononucleotide (FMN), Riboflavin (RBF), and Anthraquinone-2,6-Disulfonate (AQDS) with Ferrihydrite and Lepidocrocite. Environ. Sci. Technol. 2012, 46, 11644–11652. [Google Scholar] [CrossRef] [Scilit]
- Prince, R.C.; Linkletter, S.J.G.; Dutton, P.L. The Thermodynamic Properties of Some Commonly Used Oxidation-Reduction Mediators, Inhibitors and Dyes, as Determined by Polarography. BBA-Bioenerg. 1981, 635, 132–148. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, B.M.; Silva, L.; Trindade, I.B.; Moe, E.; Matias, P.M.; Louro, R.O.; Paquete, C.M. Optimizing Electroactive Organisms: The Effect of Orthologous Proteins. Front. Energy Res. 2019, 7, 2. [Google Scholar] [CrossRef] [Scilit]
- Estevez-Canales, M.; Berná, A.; Borjas, Z.; Esteve-Núñez, A. Screen-Printed Electrodes: New Tools for Developing Microbial Electrochemistry at Microscale Level. Energies 2015, 8, 13211–13221. [Google Scholar] [CrossRef] [Scilit]
- Raphael, A.L.; Gray, H.B. Axial Ligand Replacement in Horse Heart Cytochromec by Semisynthesis. Proteins Struct. Funct. Genet. 1989, 6, 338–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Louro, R.O.; Correia, I.J.; Brennan, L.; Coutinho, I.B.; Xavier, A.V.; Turner, D.L. Electronic Structure of Low-Spin Ferric Porphyrins: 13C NMR Studies of the Influence of Axial Ligand Orientation. J. Am. Chem. Soc. 1998, 120, 13240–13247. [Google Scholar] [CrossRef] [Scilit]
- Goodhew, C.F.; Brown, K.R.; Pettigrew, G.W. Haem Staining in Gels, a Useful Tool in the Study of Bacterial c-Type Cytochromes. BBA-Bioenerg. 1986, 852, 288–294. [Google Scholar] [CrossRef] [Scilit]
- Bodemer, G.J.; Antholine, W.A.; Basova, L.V.; Saffarini, D.; Pacheco, A.A. The Effect of Detergents and Lipids on the Properties of the Outer-Membrane Protein OmcA from Shewanella oneidensis. J. Biol. Inorg. Chem. 2010, 15, 749–758. [Google Scholar] [CrossRef] [Scilit]
- Alves, M.N.; Fernandes, A.P.; Salgueiro, C.A.; Paquete, C.M. Unraveling the Electron Transfer Processes of a Nanowire Protein from Geobacter sulfurreducens. BBA-Bioenerg. 2016, 1857, 7–13. [Google Scholar] [CrossRef] [Scilit]
- Paquete, C.M.; Louro, R.O. Unveiling the Details of Electron Transfer in Multicenter Redox Proteins. Acc. Chem. Res. 2014, 47, 56–65. [Google Scholar] [CrossRef] [Scilit]
- Ubbink, M. The Courtship of Proteins: Understanding the Encounter Complex. FEBS Lett. 2009, 583, 1060–1066. [Google Scholar] [CrossRef] [Scilit]
- Cai, P.; Xiao, X.; He, Y.; Li, W.; Chu, J.; Wu, C. Anaerobic Biodecolorization Mechanism of Methyl Orange by Shewanella oneidensis MR-1. Appl. Microbiol. Biotechnol. 2012, 93, 1769–1776. [Google Scholar] [CrossRef] [Scilit]
- Cao, D.M.; Xiao, X.; Wu, Y.M.; Ma, X.B.; Wang, M.N.; Wu, Y.Y.; Du, D.L. Role of Electricity Production in the Anaerobic Decolorization of Dye Mixture by Exoelectrogenic Bacterium Shewanella oneidensis MR-1. Bioresour. Technol. 2013, 136, 176–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Primer | Sequence (5′->3′) |
|---|---|
| pBBR_OmcA_Forw | GTATCGATAAGCTTGATATCGAAGGAGATATACATACCC |
| pBBR_OmcA_Rev | CTCTAGAACTAGTGGATCCTTAGTTACCGTGTG |
| pBBR_OmcA_H9_Rev | CTAGTGGATCCTTAGTTACCCATTGCTTCCATCAATTGCGATG |
| OmcA_H1_Forw | TACTTATATGATCCATGCTATCCATAAAGGTGGCGAGCGTCA |
| OmcA_H1_Rev | GAAGGTATGACGCTCGCCACCTTTCATGATAGCATGGATCATATAAGTAAA |
| OmcA_H3_Forw | TTTACTTATATGATCATGGCTATCCATAAAGGTGGCG |
| OmcA_H3_Rev | CGCCACCTTTATGGATAGCCATGATCATATAAGTAAA |
| OmcA_H4_Forw | GGTACGGGAAGTGCAGCTAAACGTCATGGCGATGTAATGAAAG |
| OmcA_H4_Rev | CTTTCATTACATCGCCATGACGTTTAGCTGCACTTCCCGTACC |
| OmcA_H6_Forw | CCACGAAAGTGAAGGCATGTATCTGAAATA |
| OmcA_H6_Rev | TATTTCAGATACATGCCTTCACTTTCGTGG |
| OmcA_H8_Forw | GCGTGGAAAGCCATGGAAAGTGAAGGCCAT |
| OmcA_H8_Rev | ATGGCCTTCACTTTCCATGGCTTTCCACGC |
| Plasmid Name | Gene Variant | Reference |
|---|---|---|
| Plasmid pBBR1MCS-2 [32] | Cell-anchored version | |
| pBBR_OmcA | Native OmcA | This study |
| pBBR_empty | (no gene) | This study |
| pBBR_OmcA_H1 | OmcA H277M | This study |
| pBBR_OmcA_H2 | OmcA H240M | This study |
| pBBR_OmcA_H3 | OmcA H274M | This study |
| pBBR_OmcA_H4 | OmcA H384M | This study |
| pBBR_OmcA_H5 | OmcA H359M | This study |
| pBBR_OmcA_H6 | OmcA H618M | This study |
| pBBR_OmcA_H7 | OmcA H576M | This study |
| pBBR_OmcA_H8 | OmcA H613M | This study |
| pBBR_OmcA_H9 | OmcA H733M | This study |
| pBBR_OmcA_H10 | OmcA H696M | This study |
| Plasmid pBAD202/D-TOPO | Soluble version as in [24] | |
| pBAD_OmcA | Native OmcA | This study |
| pBAD_OmcA_H1 | OmcA H277M | This study |
| pBAD_OmcA_H2 | OmcA H240M | [29] |
| pBAD_OmcA_H3 | OmcA H274M | This study |
| pBAD_OmcA_H4 | OmcA H384M | This study |
| pBAD_OmcA_H5 | OmcA H359M | [29] |
| pBAD_OmcA_H6 | OmcA H618M | This study |
| pBAD_OmcA_H7 | OmcA H576M | [29] |
| pBAD_OmcA_H8 | OmcA H613M | This study |
| pBAD_OmcA_H9 | OmcA H733M | [29] |
| pBAD_OmcA_H10 | OmcA H696M | [29] |
| βd (μM) | n | Reference or Source | |
|---|---|---|---|
| OmcA | 29 (11) | 2 | [27] |
| OmcA_H2 | 45 (5) | 2 | [29] |
| OmcA_H4 | 116 (6) | 2 | This work |
| OmcA_H5 | 169 (22) | 2 | This work |
| OmcA_H6 | 135 (22) | 2 | This work |
| OmcA_H7 | 137 (26) | 2 | [29] |
| OmcA_H8 | 253 (15) | 2 | This work |
| OmcA_H9 | 64 (9) | 2 | This work |
| OmcA_H10 | 62 (8) | 2 | This work |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Louro, R.O.; Rusconi, G.; Fonseca, B.M.; Paquete, C.M. Deciphering Molecular Factors That Affect Electron Transfer at the Cell Surface of Electroactive Bacteria: The Case of OmcA from Shewanella oneidensis MR-1. Microorganisms 2023, 11, 79. https://doi.org/10.3390/microorganisms11010079
Louro RO, Rusconi G, Fonseca BM, Paquete CM. Deciphering Molecular Factors That Affect Electron Transfer at the Cell Surface of Electroactive Bacteria: The Case of OmcA from Shewanella oneidensis MR-1. Microorganisms. 2023; 11(1):79. https://doi.org/10.3390/microorganisms11010079
Chicago/Turabian StyleLouro, Ricardo O., Giovanni Rusconi, Bruno M. Fonseca, and Catarina M. Paquete. 2023. "Deciphering Molecular Factors That Affect Electron Transfer at the Cell Surface of Electroactive Bacteria: The Case of OmcA from Shewanella oneidensis MR-1" Microorganisms 11, no. 1: 79. https://doi.org/10.3390/microorganisms11010079
APA StyleLouro, R. O., Rusconi, G., Fonseca, B. M., & Paquete, C. M. (2023). Deciphering Molecular Factors That Affect Electron Transfer at the Cell Surface of Electroactive Bacteria: The Case of OmcA from Shewanella oneidensis MR-1. Microorganisms, 11(1), 79. https://doi.org/10.3390/microorganisms11010079

