Genomic versus Plasmid-Borne Expression of Germinant Receptor Proteins in Bacillus cereus Strain 14579
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmid Construction for Chromosomal Integration
2.2. Construction of Plasmids for IPTG-Inducible Gene Expression
2.3. Electroporation and Growth of B. cereus 14579
2.4. Preparation of IPTG-Induced Vegetative Cells and Dormant Spores
2.5. Extraction of Total Protein and Western Blot Analysis
2.6. Imaging Settings and Analysis
3. Results
3.1. Confirmation of Recombinant Plasmids and the pDG148-Derived B. cereus GerRB-SGFP2 Strain
3.2. Visualization and Detection of the GerRB-SGFP2 Fusion Protein in Vegetative B. cereus Cells
3.3. Analysis of GerRB-SGFP2 Expression in Dormant B. cereus Spores
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Frankland, G.C.; Frankland, P.F. XI. Studies on some new micro-organisms obtained from air. Philos. Trans. R. Soc. Lond. B Biol. Sci. 1887, 178, 257–287. [Google Scholar]
- Farrar, W. Serious infections due to “non-pathogenic” organisms of the genus bacillus. Am. J. Med. 1963, 34, 134–141. [Google Scholar] [CrossRef] [Scilit]
- Miller, R.A.; Beno, S.M.; Kent, D.J.; Carroll, L.M.; Martin, N.H.; Boor, K.J.; Kovac, J. Bacillus wiedmannii sp. nov., a psychrotolerant and cytotoxic Bacillus cereus group species isolated from dairy foods and dairy environments. Int. J. Syst. Evol. Microbiol. 2016, 66, 4744–4753. [Google Scholar] [CrossRef] [Scilit]
- Jensen, G.B.; Hansen, B.M.; Eilenberg, J.; Mahillon, J. The hidden lifestyles of Bacillus cereus and relatives. Environ. Microbiol. 2003, 5, 631–640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, M.Y.; Kim, J.-S.; Paek, W.K.; Lim, J.; Lee, H.; Kim, P.I.; Ma, J.Y.; Kim, W.; Chang, Y.-H. Bacillus manliponensis sp. nov., a new member of the Bacillus cereus group isolated from foreshore tidal flat sediment. J. Microbiol. 2011, 49, 1027–1032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, M.Y.; Jung, M.-Y.; Paek, W.K.; Park, I.-S.; Han, J.-R.; Sin, Y.; Paek, J.; Rhee, M.-S.; Kim, H.; Song, H.S.; et al. Bacillus gaemokensis sp. nov., isolated from foreshore tidal flat sediment from the Yellow Sea. J. Microbiol. 2010, 48, 867–871. [Google Scholar] [CrossRef] [Scilit]
- Setlow, P. Spore resistance properties. Microbiol. Spectr. 2014, 2, 201–215. [Google Scholar] [CrossRef] [Scilit]
- Setlow, P. Spore germination. Curr. Opin. Microbiol. 2003, 6, 550–556. [Google Scholar] [CrossRef] [Scilit]
- Warda, A.K.; Xiao, Y.; Boekhorst, J.; Wells-Bennik, M.H.J.; Nierop Groot, M.N.; Abee, T. Analysis of germination capacity and germinant receptor (Sub)clusters of genome-sequenced Bacillus cereus environmental isolates and model strains. Appl. Environ. Microbiol. 2017, 83, e-02490-16. [Google Scholar] [CrossRef] [Scilit]
- Hornstra, L.M.; de Vries, Y.P.; Wells-Bennik, M.H.J.; de Vos, W.M.; Abee, T. Characterization of germination receptors of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol. 2006, 72, 44–53. [Google Scholar] [CrossRef] [Scilit]
- Hornstra, L.M.; de Vries, Y.P.; de Vos, W.M.; Abee, T.; Wells-Bennik, M.H.J. gerR, a novel ger operon involved in L-alanine- and inosine-initiated germination of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol. 2005, 71, 774–781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christie, G.; Setlow, P. Bacillus spore germination: Knowns, unknowns and what we need to learn. Cell. Signal. 2020, 74, 109729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; de Boer, R.; Vischer, N.; van Haastrecht, P.; Setlow, P.; Brul, S. Visualization of germination proteins in putative Bacillus cereus germinosomes. Int. J. Mol. Sci. 2020, 21, 5198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Breedijk, R.M.P.; Hink, M.A.; Bults, L.; Vischer, N.O.E.; Setlow, P.; Brul, S. Dynamics of germinosome formation and FRET-based analysis of interactions between GerD and germinant receptor subunits in Bacillus cereus spores. Int. J. Mol. Sci. 2021, 22, 11230. [Google Scholar] [CrossRef] [Scilit]
- Mirończuk, A.M.; Kovács, Á.T.; Kuipers, O.P. Induction of natural competence in Bacillus cereus ATCC14579. Microb. Biotechnol. 2008, 1, 226–235. [Google Scholar] [CrossRef] [Scilit]
- Mirończuk, A.M.; Maňu, A.; Kuipers, O.P.; Kovács, A.T. Distinct roles of ComK1 and ComK2 in gene regulation in Bacillus cereus. PLoS ONE 2011, 6, e21859. [Google Scholar] [CrossRef] [Scilit]
- Eijlander, R.T.; Kuipers, O.P. Live-cell imaging tool optimization to study gene expression levels and dynamics in single cells of Bacillus cereus. Appl. Environ. Microbiol. 2013, 79, 5643–5651. [Google Scholar] [CrossRef] [Scilit]
- Lewis, P.J.; Marston, A.L. GFP vectors for controlled expression and dual labelling of protein fusions in Bacillus subtilis. Gene 1999, 227, 101–109. [Google Scholar] [CrossRef] [Scilit]
- Stragier, P.; Bonamy, C.; Karmazyn-Campelli, C. Processing of a sporulation sigma factor in Bacillus subtilis: How morphological structure could control gene expression. Cell 1988, 52, 697–704. [Google Scholar] [CrossRef] [Scilit]
- Kremers, G.-J.; Goedhart, J.; van den Heuvel, D.J.; Gerritsen, H.C.; Gadella, T.W.J. Improved green and blue fluorescent proteins for expression in bacteria and mammalian cells. Biochemistry 2007, 46, 3775–3783. [Google Scholar] [CrossRef] [Scilit]
- Tang, X.; Nakata, Y.; Li, H.-O.; Zhang, M.; Gao, H.; Fujita, A.; Sakatsume, O.; Ohta, T.; Yokoyama, K. The optimization of preparations of competent cells for transformation of E. coli. Nucleic Acids Res. 1994, 22, 2857–2858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paidhungat, M.; Setlow, P. Localization of a germinant receptor protein (GerBA) to the inner membrane of Bacillus subtilis spores. J. Bacteriol. 2001, 183, 3982–3990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, L.; Abhyankar, W.; Ouwerling, N.; Dekker, H.L.; van Veen, H.; van der Wel, N.N.; Roseboom, W.; de Koning, L.J.; Brul, S.; de Koster, C.G. Bacillus subtilis spore inner membrane proteome. J. Proteome Res. 2016, 15, 585–594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pandey, R.; ter Beek, A.; Vischer, N.O.E.; Smelt, J.P.P.M.; Brul, S.; Manders, E.M.M. Live cell imaging of germination and outgrowth of individual Bacillus subtilis spores; the effect of heat stress quantitatively analyzed with SporeTracker. PLoS ONE 2013, 8, e58972. [Google Scholar]
- Tran, D.T.M.; Phan, T.T.P.; Doan, T.T.N.; Tran, T.L.; Schumann, W.; Nguyen, H.D. Integrative expression vectors with Pgrac promoters for inducer-free overproduction of recombinant proteins in Bacillus subtilis. Biotechnol. Rep. Amst. 2020, 28, e00540. [Google Scholar] [CrossRef] [Scilit]
- Tran, D.T.M.; Phan, T.T.P.; Huynh, T.K.; Dang, N.T.K.; Huynh, P.T.K.; Nguyen, T.M.; Truong, T.T.T.; Tran, T.L.; Schumann, W.; Nguyen, H.D. Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis. Microb. Cell Factories 2017, 16, 130. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, A.; Manton, J.D.; Mustafa, A.R.; Gupta, M.; Ayuso-Garcia, A.; Rees, E.J.; Christie, G. Proteins encoded by the gerP operon are localized to the inner coat in Bacillus cereus spores and are dependent on GerPA and SafA for assembly. Appl. Environ. Microbiol. 2018, 84, e-00760-18. [Google Scholar] [CrossRef] [Scilit]
- Senior, A.; Moir, A. The Bacillus cereus GerN and GerT protein homologs have distinct roles in spore germination and outgrowth, respectively. J. Bacteriol. 2008, 190, 6148–6152. [Google Scholar] [CrossRef] [Scilit]
- Clements, M.O.; Moir, A. Role of the gerI operon of Bacillus cereus 569 in the response of spores to germinants. J. Bacteriol. 1998, 180, 6729–6735. [Google Scholar] [CrossRef] [Scilit]
- Barlass, P.J.; Houston, C.W.; Clements, M.O.; Moir, A. Germination of Bacillus cereus spores in response to L-alanine and to inosine: The roles of gerL and gerQ operons. Microbiol. Read. 2002, 148, 2089–2095. [Google Scholar] [CrossRef] [Scilit]
- Thackray, P.D.; Behravan, J.; Southworth, T.W.; Moir, A. GerN, an antiporter homologue important in germination of Bacillus cereus endospores. J. Bacteriol. 2001, 183, 476–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Beilen, J.; Blohmke, C.J.; Folkerts, H.; de Boer, R.; Zakrzewska, A.; Kulik, W.; Vaz, F.M.; Brul, S.; Beek, A. ter. RodZ and PgsA play intertwined roles in membrane homeostasis of Bacillus subtilis and resistance to weak organic acid stress. Front. Microbiol. 2016, 7, 1633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noirot-Gros, M.-F.; Velten, M.; Yoshimura, M.; McGovern, S.; Morimoto, T.; Ehrlich, S.D.; Ogasawara, N.; Polard, P.; Noirot, P. Functional dissection of YabA, a negative regulator of DNA replication initiation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 2006, 103, 2368–2373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Beilen, J.W.A.; Brul, S. Compartment-specific pH monitoring in Bacillus subtilis using fluorescent sensor proteins: A tool to analyze the antibacterial effect of weak organic acids. Front. Microbiol. 2013, 4, 157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joseph, P.; Fantino, J.R.; Herbaud, M.L.; Denizot, F. Rapid orientated cloning in a shuttle vector allowing modulated gene expression in Bacillus subtilis. FEMS Microbiol. Lett. 2001, 205, 91–97. [Google Scholar] [CrossRef] [PubMed]





| Strains or Plasmids | Description | Sources |
|---|---|---|
| Strains | ||
| B. cereus ATCC 14579 | B. cereus wild type | Lab stock |
| B. cereus pDG148-GerRB-SGFP2 | B. cereus containing plasmid pDG148-gerRB-SGFP2 Kanr | This study |
| Plasmids | ||
| pSGFP2-C1 | Source of the SGFP2 gene Kanr | [20] |
| pSG1151 | Integration vector for B. subtilis Ampr Chlr | [18] |
| pSG1151-0.6 gerR-SGFP2 | 678 base homology arm of gerR fused to SGFP2 Ampr Chlr | This study |
| pSG1151-1.2 gerR-SGFP2 | 1234 base homology arm of gerR fused to SGFP2 Ampr Chlr | This study |
| pSG1164 | Integration vector with xylose inducible promoter in B. subtilis Ampr Chlr | [18] |
| pSG1164-0.6 gerR-SGFP2 | 678 base homology arm of gerR fused to SGFP2 Ampr Chlr | This study |
| pSG1164-1.2 gerR-SGFP2 | 1234 base homology arm of gerR fused to SGFP2 Ampr Chlr | This study |
| pDG148 | IPTG-inducible shuttle vector in E. coli and B. subtilis Ampr Kanr | |
| pDG148-gerRB-SGFP2 | gerRB-SGFP2 fusion gene under control of the Pspac promoter and inducible by IPTG Ampr Kanr | This study |
| Name | Primers (5′-3′) |
|---|---|
| YW_1 | GGGGTACCGGGATATGTTTTTGGGGT |
| YW_2 | CTCGCCCTTGCTCACCATaccagcaccAGGTGTATCGGTTGAAGA * |
| YW_3 | TCTTCAACCGATACACCTggtgctggtATGGTGAGCAAGGGCGAG * |
| YW_4 | GGACTAGTTTACTTGTACAGCTCGTCCAT ** |
| YW_5 | GGGGTACCAGAAGCCATACGAGAAAA ** |
| YW_6 | CCCGTCGACGAGGTGAAATGAGCAATGAA ** |
| YW_7 | CCCGCATGCTTACTTGTACAGCTCGTCCAT ** |
| YW_8 | CAAAGACCCCAACGAGAA |
| YW_9 | AAGTATGTCGAAAGGGGAA |
| YW_10 | CACTATATATCCGTGTCGTT |
| YW_11 | AAGGCGATTAAGTTGGGT |
| YW_12 | CTACATCCAGAACAACCTCTGC |
| YW_13 | TTCGGAAGGAAATGATGACCTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Setlow, P.; Brul, S. Genomic versus Plasmid-Borne Expression of Germinant Receptor Proteins in Bacillus cereus Strain 14579. Microorganisms 2022, 10, 1774. https://doi.org/10.3390/microorganisms10091774
Wang Y, Setlow P, Brul S. Genomic versus Plasmid-Borne Expression of Germinant Receptor Proteins in Bacillus cereus Strain 14579. Microorganisms. 2022; 10(9):1774. https://doi.org/10.3390/microorganisms10091774
Chicago/Turabian StyleWang, Yan, Peter Setlow, and Stanley Brul. 2022. "Genomic versus Plasmid-Borne Expression of Germinant Receptor Proteins in Bacillus cereus Strain 14579" Microorganisms 10, no. 9: 1774. https://doi.org/10.3390/microorganisms10091774
APA StyleWang, Y., Setlow, P., & Brul, S. (2022). Genomic versus Plasmid-Borne Expression of Germinant Receptor Proteins in Bacillus cereus Strain 14579. Microorganisms, 10(9), 1774. https://doi.org/10.3390/microorganisms10091774

