Prevalence of Bacterial and Protozoan Pathogens in Ticks Collected from Birds in the Republic of Moldova
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling Sites
2.2. Sampling Strategy
2.3. Nucleic Acid Extraction
2.4. Applied Molecular Pathogen Detection and Differentiation Approaches
2.5. Statistical Analysis
2.6. Ethical Clearance
3. Results
3.1. Detection of Ticks on Caught Birds
3.2. Detection of Pathogen DNA in Collected Ticks and Coinfections
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Organism | Gene | Primers 5′ → 3′ | Controls | Bp | Reference | |
---|---|---|---|---|---|---|
Borrelia spp. | 5S-23 spacer | rrf rrl | CtgcgAGTTCGCGGGAGAG AAgCTCCTAGGCATTCACCATA | Four negative controls were used: one containing water and PCR mix; second with water PCR mix and primers; and last two with positive DNA and PCR mix but without primers. As amplification control, we used B. afzelii DNA. | 198 | Richter [35] |
Rickettsia spp. | gltA region | CS1d CS2d | ATGACCAATGAAAATAATAAT CTTATACTCTCTATgTACA | Four negative controls were used, two containing water and PCR mix, two with DNA and PCR mix but without primers, As positive controls, plasmids with concentration from 104 to 1010 for Rickettsia spp. were used. | 1254 | Mediannikov [40] |
OMPB | 120-M59 120-807 | CCgCAGGGTTGGTAACTGC CCTTTTAGATTACCGCCTAA | 764 | Roux and Raoult [39] | ||
gltA region | CS-F CS-R CS-P | TCGCAAATGTTCACGGTACTTT TCGTGCATTTCTTTCCATTGTG FAM-TGCAATAGCAAGAACCGTAGGCTGGATG-BHQ | 74 | Stenos [38] | ||
Borrelia RF | glpQ | RF23sF RF23sR RF23sP | CGGTACTCTTCACTATCGGTAGCTT TGGAAAAGTTAGCCARAGAAGG 6FAM-TCCCGTCCTAC TTAGGAACATC-TAMRA | As negative control, molecular grade water and a positive control DNA of B. miyamotoi isolated from I. ricinus, confirmed by sequencing. | Subramanian [36] | |
Flagelin pr. B | flaB-BO R1 flaB-BOR2 | TAATACGTCAGCCATAAATGC gCTCTTTGATCAGTTATCATTdC | 750 | Assous [37] | ||
Anaplasma phagocytophilum | MRP2 | ApMsp2f ApMsp2r ApMSP2p-HEX | TGGAAGGTAGTGTTGGTTATGGTATT TTGGTCTTGAAGCGCTCGTA TGGTGCCAGGGTTGAGCTTGAGATTG | Two negative controls were used (one with clear water; second with water, PCR mix and primers). For positive controls, we used DNA samples of A. phagocytophilum earlier confirmed by sequencing. | 77 | Courtney [41] |
16S rRNA (nested) | 1st amp ge3a ge10r 2nd amp. ge9f ge2 | CACATGCAAGTCGAACGGATTATTC TTCCGTTAAGAAGGATCTAATCTCC AACGGATTATTCTTTATAGCTTGCT GGCAGTATTAAAAGCAGCTCCAGG | 932 546 | Massung and Slater [42] | ||
Babesia spp. | 18S rRNA part | BJ1 BN2 | GTCTTGTAATTGGAATGATGG TAGTTTATGGTTAGGACTACG | Two negative controls were used (one with clear water; second with water, PCR mix and primers). For positive controls, we used samples of B. microti confirmed by sequencing. | 424 | Casati [43] |
Neoehrlichia mikurensis | GroEL | NMikGroEL F2 NMikGroEL rev1 NMikGroEL rev2 probe NMikGroEL-P2a | CCTTGAAAATATAGCAAGATCAGGTAG CCACCACGTAACTTATTTAGTACTAAAG FAM-CCTCTACTAATTATTGCTGAAGATGTAGAAGGTGAAGC-BHQ1- | As negative control—molecular grade water. As positive control—DNA of N. mikurensis isolated from I. ricinus, confirmed by sequencing. | 968 | Silaghi [44] |
Coxiella burnetii | icd | forward, icd-439F reverse, icd-514R icd-464TM | CGTTATTTTACGGGTGTGCCA CAGAATTTTCGCGGAAAATCA FAM-CATATTCACCTTTTCAGGCGTTTTGACCGT-TAMRA-T | Four negative controls were used, two containing water and PCR mix, two with DNA and PCR mix but without primers, As positive controls, IS1111 plasmids with concentration from 100 to 105 were used. | 76 | Klee [45] |
References
- Madison-Antenucci, S.; Kramer, L.D.; Gebhardt, L.L.; Kauffman, E. Emerging Tick-Borne Diseases. Clin. Microbiol. Rev. 2020, 33, e00083-18. [Google Scholar] [CrossRef] [PubMed]
- Lippi, C.A.; Ryan, S.J.; White, A.L.; Gaff, H.D.; Carlson, C.J. Trends and Opportunities in Tick-Borne Disease Geography. J. Med. Entomol. 2021, 58, 2021–2029. [Google Scholar] [CrossRef] [PubMed]
- Thomas, R.J.; Dumler, J.S.; Carlyon, J.A. Current management of human granulocytic anaplasmosis, human monocytic ehrlichiosis and Ehrlichia ewingii ehrlichiosis. Expert Rev. Anti Infect. Ther. 2009, 7, 709–722. [Google Scholar] [CrossRef] [Green Version]
- Brouqui, P.; Bacellar, F.; Baranton, G.; Birtles, R.J.; Bjoërsdorff, A.; Blanco, J.R.; Caruso, G.; Cinco, M.; Fournier, P.E.; Francavilla, E.; et al. Guidelines for the diagnosis of tick-borne bacterial diseases in Europe. Clin. Microbiol. Infect. 2004, 10, 1108–1132. [Google Scholar] [CrossRef]
- Karlsson, U.; Bjöersdorff, A.; Massung, R.F.; Christensson, B. Human granulocytic ehrlichiosis—A clinical case in Scandinavia. Scand. J. Infect. Dis. 2001, 33, 73–74. [Google Scholar] [PubMed]
- Nordberg, M.; Forsberg, P.; Berglund, J.; Bjoersdorff, A.; Ernerudh, J.; Garpmo, U.; Haglund, M.; Nilsson, K.; Eliasson, I. Aetiology of tick-borne infections in an adult Swedish population—Are co-infections with multiple agents common? Open J. Clin. Diagn. 2014, 4, 31–40. [Google Scholar] [CrossRef] [Green Version]
- Lotrič-Furlan, S.; Rojko, T.; Jelovšek, M.; Petrovec, M.; Avšič-Županc, T.; Lusa, L.; Strle, F. Comparison of clinical and laboratory characteristics of patients fulfilling criteria for proven and probable human granulocytic anaplasmosis. Microbes Infect. 2015, 17, 829–833. [Google Scholar] [CrossRef]
- Gillespie, J.J.; Williams, K.; Shukla, M.; Snyder, E.E.; Nordberg, E.K.; Ceraul, S.M.; Dharmanolla, C.; Rainey, D.; Soneja, J.; Shallom, J.M.; et al. Rickettsia phylogenomics: Unwinding the intricacies of obligate intracellular life. PLoS ONE 2008, 3, e2018. [Google Scholar] [CrossRef] [Green Version]
- Oteo, J.A.; Portillo, A. Tick-borne rickettsioses in Europe. Ticks Tick-Borne Dis. 2012, 3, 271–278. [Google Scholar] [CrossRef]
- Young, K.M.; Corrin, T.; Wilhelm, B.; Uhland, C.; Greig, J.; Mascarenhas, M.; Waddell, L.A. Zoonotic Babesia: A scoping review of the global evidence. PLoS ONE 2019, 14, e0226781. [Google Scholar] [CrossRef] [Green Version]
- Onyiche, T.E.; Răileanu, C.; Fischer, S.; Silaghi, C. Global distribution of Babesia species in questing ticks: A systematic review and meta-analysis based on published literature. Pathogens 2021, 10, 230. [Google Scholar] [CrossRef] [PubMed]
- Ebani, V.V.; Mancianti, F. Potential Role of Avian Populations in the Epidemiology of Rickettsia spp. and Babesia spp. Vet. Sci. 2021, 8, 334. [Google Scholar] [CrossRef] [PubMed]
- Krause, P.J.; Fish, D.; Narasimhan, S.; Barbour, A.G. Borrelia miyamotoi infection in nature and in humans. Clin. Microbiol. Infect. 2015, 21, 631–639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chowdri, H.R.; Gugliotta, J.L.; Berardi, V.P.; Goethert, H.K.; Molloy, P.J.; Sterling, S.L.; Telford, S.R. Borrelia miyamotoi infection presenting as human granulocytic anaplasmosis: A case report. Ann. Intern. Med. 2013, 159, 21–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Platonov, A.E.; Karan, L.S.; Kolyasnikova, N.M.; Makhneva, N.A.; Toporkova, M.G.; Maleev, V.V.; Fish, D.; Krause, P.J. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg. Infect. Dis. 2011, 17, 1816–1823. [Google Scholar] [CrossRef]
- Hamer, S.A.; Hickling, G.J.; Keith, R.; Sidge, J.L.; Walker, E.D.; Tsao, J.I. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, USA. Parasit. Vectors 2012, 5, 231. [Google Scholar] [CrossRef] [Green Version]
- Cochez, C.; Heyman, P.; Heylen, D.; Fonville, M.; Hengeveld, P.; Takken, W.; Simons, L.; Sprong, H. The Presence of Borrelia miyamotoi, A Relapsing Fever Spirochaete, in Questing Ixodes ricinus in Belgium and in The Netherlands. Zoonoses Public Health 2015, 62, 331–333. [Google Scholar] [CrossRef]
- Taylor, K.R.; Takano, A.; Konnai, S.; Shimozuru, M.; Kawabata, H.; Tsubota, T. Borrelia miyamotoi infections among wild rodents show age and month independence and correlation with Ixodes persulcatus larval attachment in Hokkaido, Japan. Vector Borne Zoonotic Dis. 2013, 13, 92–97. [Google Scholar] [CrossRef] [Green Version]
- Grankvist, A.; Andersson, P.O.; Mattsson, M.; Sender, M.; Vaht, K.; Höper, L.; Sakiniene, E.; Trysberg, E.; Stenson, M.; Fehr, J.; et al. Infections with the tick-borne bacterium “Candidatus Neoehrlichia mikurensis” mimic noninfectious conditions in patients with B cell malignancies or autoimmune diseases. Clin. Infect. Dis. 2014, 58, 1716–1722. [Google Scholar] [CrossRef]
- von Loewenich, F.D.; Geissdörfer, W.; Disqué, C.; Matten, J.; Schett, G.; Sakka, S.G.; Bogdan, C. Detection of “Candidatus Neoehrlichia mikurensis” in two patients with severe febrile illnesses: Evidence for a European sequence variant. J. Clin. Microbiol. 2010, 48, 2630–2635. [Google Scholar] [CrossRef] [Green Version]
- Portillo, A.; Santibáñez, P.; Palomar, A.M.; Santibáñez, S.; Oteo, J.A. ‘Candidatus Neoehrlichia mikurensis’ in Europe. New Microbes New Infect. 2018, 22, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Hasle, G.; Bjune, G.; Edvardsen, E.; Jakobsen, C.; Linnehol, B.; Røer, J.E.; Mehl, R.; Røed, K.H.; Pedersen, J.; Leinaas, H.P. Transport of ticks by migratory passerine birds to Norway. J. Parasitol. 2009, 95, 1342–1351. [Google Scholar] [CrossRef] [PubMed]
- Jameson, L.J.; Morgan, P.J.; Medlock, J.M.; Watola, G.; Vaux, A.G. Importation of Hyalomma marginatum, vector of Crimean-Congo haemorrhagic fever virus, into the United Kingdom by migratory birds. Ticks Tick Borne Dis. 2012, 3, 95–99. [Google Scholar] [CrossRef] [PubMed]
- Movila, A.; Reye, A.L.; Dubinina, H.V.; Tolstenkov, O.O.; Toderas, I.; Hübschen, J.M.; Muller, C.P.; Alekseev, A.N. Detection of Babesia Sp. EU1 and members of spotted fever group rickettsiae in ticks collected from migratory birds at Curonian Spit, North-Western Russia. Vector Borne Zoonotic Dis. 2011, 11, 89–91. [Google Scholar] [CrossRef] [PubMed]
- Mărcuţan, I.D.; Kalmár, Z.; Ionică, A.M.; D’Amico, G.; Mihalca, A.D.; Vasile, C.; Sándor, A.D. Spotted fever group rickettsiae in ticks of migratory birds in Romania. Parasit. Vectors 2016, 9, 294. [Google Scholar] [CrossRef] [Green Version]
- Failloux, A.B.; Bouattour, A.; Faraj, C.; Gunay, F.; Haddad, N.; Harrat, Z.; Jancheska, E.; Kanani, K.; Kenawy, M.A.; Kota, M.; et al. Surveillance of Arthropod-Borne Viruses and Their Vectors in the Mediterranean and Black Sea Regions Within the MediLabSecure Network. Curr. Trop. Med. Rep. 2017, 4, 27–39. [Google Scholar] [CrossRef] [Green Version]
- Sándor, A.D.; Mărcuţan, D.I.; D’Amico, G.; Gherman, C.M.; Dumitrache, M.O.; Mihalca, A.D. Do the ticks of birds at an important migratory hotspot reflect the seasonal dynamics of Ixodes ricinus at the migration initiation site? A case study in the Danube Delta. PLoS ONE 2014, 9, e89378. [Google Scholar]
- Movila, A.; Toderas, I.; Uspenskaia, I.; Conovalov, J. Molecular detection of tick-borne pathogens in Ixodes ricinus from Moldova collected in 1960. Ticks Tick Borne Dis. 2013, 4, 359–361. [Google Scholar] [CrossRef]
- Didyk, Y.M.; Blaňárová, L.; Pogrebnyak, S.; Akimov, I.; Peťko, B.; Víchová, B. Emergence of tick-borne pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Ricketsia raoultii and Babesia microti) in the Kyiv urban parks, Ukraine. Ticks Tick Borne Dis. 2017, 8, 219–225. [Google Scholar] [CrossRef]
- Akimov, I.A.; Nebogatkin, I.V. Ticks of the Genus Rhipicephalus (Acari, Ixodidae) and their distribution in Ukraine. Vestnik Zoologii 2013, 47, 28–34. [Google Scholar] [CrossRef] [Green Version]
- Cramp, S.; Brooks, D.J. Handbook of the Birds of Europe, the Middle East and North Africa. The Birds of the Western Palearctic, Volume VI Warbler; Oxford University Press: Oxford, UK, 1992; pp. 396–405. [Google Scholar]
- Apanaskevich, D.A.; Filippova, N.A.; Horak, I.G. The genus Hyalomma Koch, 1844. x. redescription of all parasitic stages of H. (Euhyalomma) scupense Schulze, 1919 (= H. detritum Schulze) (Acari: Ixodidae) and notes on its biology. Folia Parasitol. (Praha) 2010, 57, 69–78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Filippova, N.A. Arachnida Class: Ixodid Ticks of the Subfamily Ixodinae. Fauna SSSR Paukoobraznye; Nauka: Leningrad, Russia, 1977; pp. 113–123. [Google Scholar]
- Nosek, J.; Sixl, W. Central-European Ticks (Ixodoidea); Mitt Abt Zool Landesmus Joanneum: Graz, Austria, 1972; pp. 61–92. [Google Scholar]
- Richter, D.; Postic, D.; Sertour, N.; Livey, I.; Matuschka, F.R.; Baranton, G. Delineation of Borrelia burgdorferi sensu lato species by multilocus sequence analysis and confirmation of the delineation of Borrelia spielmanii sp. nov. Int. J. Syst. Evol. Microbiol. 2006, 56 Pt 4, 873–881. [Google Scholar] [CrossRef]
- Subramanian, G.; Sekeyova, Z.; Raoult, D.; Mediannikov, O. Multiple tick-associated bacteria in Ixodes ricinus from Slovakia. Ticks Tick Borne Dis. 2012, 3, 406–410. [Google Scholar] [CrossRef]
- Assous, M.V.; Wilamowski, A.; Bercovier, H.; Marva, E. Molecular characterization of tickborne relapsing fever Borrelia, Israel. Emerg. Infect. Dis. 2006, 12, 1740–1743. [Google Scholar] [CrossRef] [PubMed]
- Stenos, J.; Graves, S.R.; Unsworth, N.B. A highly sensitive and specific real-time PCR assay for the detection of spotted fever and typhus group rickettsiae. Am. J. Trop. Med. Hyg. 2005, 73, 1083–1085. [Google Scholar] [CrossRef] [PubMed]
- Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50 Pt 4, 1449–1455. [Google Scholar] [CrossRef] [Green Version]
- Mediannikov, O.; Sidelnikov, Y.; Ivanov, L.; Fournier, P.E.; Tarasevich, I.; Raoult, D. Far eastern tick-borne rickettsiosis: Identification of two new cases and tick vector. Ann. N. Y. Acad. Sci. 2006, 1078, 80–88. [Google Scholar] [CrossRef]
- Courtney, J.W.; Kostelnik, L.M.; Zeidner, N.S.; Massung, R.F. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004, 42, 3164–3168. [Google Scholar] [CrossRef] [Green Version]
- Massung, R.F.; Slater, K.G. Comparison of PCR assays for detection of the agent of human granulocytic ehrlichiosis, Anaplasma phagocytophilum. J. Clin. Microbiol. 2003, 41, 717–722. [Google Scholar] [CrossRef] [Green Version]
- Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.C. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar]
- Silaghi, C.; Woll, D.; Mahling, M.; Pfister, K.; Pfeffer, M. Candidatus Neoehrlichiamikurensis in rodents in an area with sympatric existence of the hard ticks Ixodes ricinus and Dermacentor reticulatus, Germany. Parasit. Vectors 2012, 5, 285. [Google Scholar] [CrossRef] [Green Version]
- Klee, S.R.; Tyczka, J.; Ellerbrok, H.; Franz, T.; Linke, S.; Baljer, G.; Appel, B. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 2006, 6, 2. [Google Scholar] [CrossRef] [Green Version]
- Ginsberg, H.S. Potential effects of mixed infections in ticks on transmission dynamics of pathogens: Comparative analysis of published records. Exp. Appl. Acarol. 2008, 46, 29–41. [Google Scholar] [CrossRef]
- Buczek, A.M.; Buczek, W.; Buczek, A.; Bartosik, K. The Potential Role of Migratory Birds in the Rapid Spread of Ticks and Tick-Borne Pathogens in the Changing Climatic and Environmental Conditions in Europe. Int. J. Environ. Res. Public Health 2020, 17, 2117. [Google Scholar] [CrossRef] [Green Version]
- Hasle, G. Transport of ixodid ticks and tick-borne pathogens by migratory birds. Front. Cell. Infect. Microbiol. 2013, 3, 48. [Google Scholar] [CrossRef] [Green Version]
- Loss, S.R.; Noden, B.H.; Hamer, G.L.; Hamer, S.A. A quantitative synthesis of the role of birds in carrying ticks and tick-borne pathogens in North America. Oecologia 2016, 182, 947–959. [Google Scholar] [CrossRef]
- Sparagano, O.; George, D.; Giangaspero, A.; Špitalská, E. Arthropods and associated arthropod-borne diseases transmitted by migrating birds. The case of ticks and tick-borne pathogens. Vet. Parasitol. 2015, 213, 61–66. [Google Scholar] [CrossRef]
- Elfving, K.; Olsen, B.; Bergström, S.; Waldenström, J.; Lundkvist, A.; Sjöstedt, A.; Mejlon, H.; Nilsson, K. Dissemination of spotted fever rickettsia agents in Europe by migrating birds. PLoS ONE 2010, 5, e8572. [Google Scholar] [CrossRef] [Green Version]
- Jameson, L.J.; Medlock, J.M. Tick surveillance in Great Britain. Vector Borne Zoonotic Dis. 2011, 11, 403–412. [Google Scholar] [CrossRef]
- Klaus, C.; Gethmann, J.; Hoffmann, B.; Ziegler, U.; Heller, M.; Beer, M. Tick infestation in birds and prevalence of pathogens in ticks collected from different places in Germany. Parasitol. Res. 2016, 115, 2729–2740. [Google Scholar] [CrossRef] [Green Version]
- Chumakov, M.P.; Bashkirtsev, V.N.; Golger, E.L.; Dzagurova, T.K.; Zavodov, T.I.; Konovalov, Y.N.; Mart’yanova, I.G.; Uspenskaya, I.G.; Filippsky, A.N. Isolation and identification of Crimean hemorrhagic fever and West Nile fever viruses from ticks collected in Moldavia. Proc. Inst. Polio. Viral Enceph. Acad. Med. Sci. USSR J. 1974, 22, 45–49. [Google Scholar]
- Møller, A.P.; Erritzøe, J.; Saino, N. Seasonal changes in immune response and parasite impact on hosts. Am. Nat. 2003, 161, 657–671. [Google Scholar] [CrossRef] [Green Version]
- Uspenskaya, I. Ixodic Ticks of the Dniester Prut Interfluve; Chisinau Shtiintsa: Chisinau, Moldova, 1987; pp. 14–45. [Google Scholar]
- Movila, A. The prevalence of Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in Ixodes ricinus tick (Acarina, Ixodidae) collected at the foci of Chisinau city, Republic of Moldova. Bull. USAMV-CN Vet. Med. 2006, 63, 355–360. [Google Scholar]
Collecting Point | № | Place of the Bird Collection | Geographical Coordinates | Collection Period (Month, Year) |
---|---|---|---|---|
Urban areas | 1 | Chisinau Botanical Garden | 46°58′23.0″ N 28°53′08.7″ E | III–XI 2012–2015 |
2 | Chisinau, Park Riscani | 47°02′53.4″ N 28°52′32.4″ E | III–XI 2012–2015 | |
3 | Durlesti, outskirts of the city | 47°01′40.4″ N 28°44′36.9″ E | IV–VI 2012–2014 | |
Agrocenoses | 4 | Badragii Vechi village | 48°01′54.4″ N 27°06′40.3″ E | VI 2012, VI 2014 |
5 | Badragii Vechi village | 48°01′51.4″ N 27°06′38.8″ E | VI 2012, VI 2014 | |
6 | Baltsata village | 47°02′53.9″ N 29°02′28.1″ E | V–VI 2014 | |
Reserve zones | 7 | Reserve Yagorlyk | 47°23′03.2″ N 29°10′12.0″ E | III–VI 2012–2015, IX–XI 2012–2015 |
8 | Reserve Yagorlyk | 47°23′01.2″ N 29°10′42.3″ E | III–VI 2012–2015, IX–XI 2012–2015 | |
9 | Reserve Yagorlyk | 47°23′07.1″ N 29°10′28.3" E | III–VI 2012–2015, IX–XI 2012–2015 | |
10 | Reserve Prutul de Jos | 45°35′30.6″ N 28°09′37.9″ E | V 2014, V 2015 | |
11 | Reserve Prutul de Jos | 45°35′25.0″ N 28°09′35.0″ E | IX 2015 | |
12 | Reserve Padurea Domneasca | 47°36′22.1″ N 27°23′41.0″ E | IV 2012, V 2015 | |
13 | Reserve Padurea Domneasca | 47°36′22.1″ N 27°23′41.0″ E | X 2012, IX 2014 | |
14 | Reserve Plaiul Fagului | 47°17′40.6″ N 28°01′50.3″ E | VI 2014 | |
15 | Reserve Plaiul Fagului | 47°18′60.0″ N 28°02′30.8″ E | VI 2015 | |
16 | Reserve Codrii | 47°03′27.1″ N 28°33′36.7″ E | IV–V 2012, IV–V 2014 | |
17 | Reserve Codrii | 47°03′25.7″ N 28°33′37.3″ E | IX–XI 2014, V 2015 |
Collection Places | Iagorîc | Plaiul Fagului | Codrii | Prutul de Jos | Pădurea Domneasca | Mun. Chișinău | Bădragii Vechi | Total |
---|---|---|---|---|---|---|---|---|
Passer domesticus | 15 | 7 | 4 | 5 | 9 | 20 | 18 | 78 |
Turdus merula | 42 | 4 | 6 | 3 | 2 | 15 | 6 | 78 |
Sturnus vulgaris | 9 | 5 | 6 | 7 | 4 | 15 | 20 | 66 |
Erithacus rubecula | 22 | 6 | 9 | 4 | 3 | 5 | 3 | 52 |
Turdus philomelos | 21 | 6 | 3 | 5 | 7 | 9 | 1 | 52 |
Parus major | 13 | 1 | 1 | 2 | 3 | 21 | 3 | 44 |
Coccothraustes coccothraustes | 13 | 6 | 1 | 2 | 1 | 12 | 3 | 38 |
Carduelis chloris | 11 | 3 | 3 | 2 | 2 | 1 | 1 | 23 |
Fringilla coelebs | 6 | 5 | 4 | 6 | 0 | 4 | 1 | 26 |
Luscinia luscinia | 0 | 1 | 0 | 2 | 0 | 13 | 0 | 16 |
Lanius collurio | 2 | 1 | 0 | 0 | 1 | 0 | 10 | 14 |
Passer montanus | 5 | 2 | 0 | 0 | 2 | 3 | 2 | 14 |
Dendrocopos syriacus | 6 | 0 | 1 | 0 | 0 | 4 | 1 | 12 |
Garrulus glandarius | 4 | 0 | 2 | 0 | 1 | 2 | 1 | 10 |
Sylvia atricapilla | 3 | 1 | 0 | 0 | 4 | 2 | 0 | 10 |
Acrocephalus arundinaceus | 0 | 0 | 0 | 8 | 0 | 0 | 0 | 8 |
Cyanistes caeruleus | 6 | 0 | 0 | 2 | 0 | 0 | 0 | 8 |
Lanius minor | 2 | 0 | 1 | 0 | 1 | 1 | 3 | 8 |
Oriolus oriolus | 0 | 1 | 0 | 0 | 1 | 2 | 4 | 8 |
Pica pica | 2 | 0 | 0 | 0 | 0 | 6 | 0 | 8 |
Dendrocopos major | 3 | 0 | 2 | 0 | 0 | 1 | 1 | 7 |
Emberiza citronella | 2 | 0 | 0 | 2 | 1 | 1 | 0 | 6 |
Picus canus | 2 | 0 | 0 | 0 | 1 | 3 | 0 | 6 |
Prunella modularis | 0 | 1 | 2 | 2 | 1 | 0 | 0 | 6 |
Sitta europaea | 2 | 3 | 1 | 0 | 0 | 0 | 0 | 6 |
Anthus trivialis | 2 | 0 | 0 | 0 | 0 | 2 | 0 | 4 |
Hirundo rustica | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 4 |
Phoenicurs ochruros | 2 | 0 | 0 | 0 | 0 | 2 | 0 | 4 |
Accipiter nisus | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
Emberiza schoeniclus | 1 | 0 | 0 | 2 | 0 | 0 | 0 | 3 |
Turdus pilaris | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
Motacilla alba | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 2 |
Accipiter gentilis | 2 | 0 | 1 | 0 | 0 | 0 | 1 | 4 |
Alcedo atthis | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 2 |
Corvus frugilegus | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 2 |
Carduelis spinus | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
Dendrocopos minor | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
Jynx torquilla | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
Phoenicurus phoenicurus | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 |
Phylloscopus trochilus | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
Total | 209 | 53 | 47 | 60 | 44 | 147 | 80 | 640 |
Yagorlyk | Chisinau and suburbs | Plauil Fagului | Codrii | Prutul de Jos | Padurea Domneasca | Vilages (B. vechi and Baltsata) | Total | |
---|---|---|---|---|---|---|---|---|
Birds examined | 209 | 147 | 53 | 47 | 60 | 44 | 80 | 640 |
Infested birds | 40 | 25 | 14 | 7 | 4 | 0 | 3 | 93 |
Ticks collected | 165 | 42 | 19 | 21 | 10 | 0 | 5 | 262 |
Ticks in which DNA of at least one of the pathogenic agents was found | 39 | 28 | 9 | 7 | 2 | 0 | 1 | 86 |
Bird Species (Collected/Infested) | Number of Birds Infested with Ticks (In Brackets—Number of Collected Ticks) | Prevalence (%) | Ticks Collected | Mean Intensity | Mean Abundance | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
I. ricinus | I. frontalis | Hae. punctata | D. marginatus | Hy. marginatum | ||||||||
L | N | N | I♀ | L | N | N | I ♂ | |||||
Turdus merula 78/46 | 44 (164) | 4 (6) | 2 (2) | 2 (2) | 59 | 174 | 3.78 | 2.23 | ||||
Turdus philomelos 52/10 | 4 (4) | 8 (22) | 2 (3) | 1 (1) | 18 | 32 | 3.2 | 0.59 | ||||
Sturnus vulgaris 66/10 | 10 (16) | 15 | 16 | 1.6 | 0.26 | |||||||
Luscinia luscinia 16/8 | 8 (8) | 50 | 8 | 1 | 0.5 | |||||||
Erithacus rubecula 52/4 | 4 (4) | 8 | 4 | 1 | 0.07 | |||||||
Parus major 44/2 | 2 (3) | 2 (9) | 5 | 12 | 6 | 0.27 | ||||||
Anthus trivialis 4/2 | 2 (4) | 50 | 4 | 2 | 1 | |||||||
Corvus frugilegus 2/2 | 2 (2) | 100 | 2 | 1 | 1 | |||||||
Passer domesticus 78/4 | 4 (4) | 5 | 4 | 1 | 0.05 | |||||||
Sylvia atricapilla 10/2 | 2 (2) | 20 | 2 | 1 | 0.2 | |||||||
Dendrocopos syriacus 12/1 | 1 (1) | 1 (1) | 8.4 | 1 | 1 | 0.08 | ||||||
Acrocephalus arundinaceus 8/2 | 2 (2) | 2 (2) | 25 | 2 | 1 | 0.25 | ||||||
Total 422/93 | 22.1 | 262 | 2.81 | 0.62 |
Species of Ticks | Pos/No. Total | The Number of Cases of DNA Detection of the Pathogenic Agents | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
B. microti | N. mikurensis | A. phagocytophilum | B. miyamotoi | R. monacensis | R. slovaca | R.helvetica | B. garinii | B.valaisiana | B. lusitaniae | ||
I. ricinus N | 82/239 | 4 | 4 | 16 | 4 | 19 | 2 | 35 | 2 | 2 | |
I. ricinus L | 3/7 | 2 | 1 | 1 | |||||||
I. frontalis N | 1/9 | 1 |
Tick Species | Site | Number of Ticks Examined | Number of Ticks with Co-Detection (%) | Co-Detection Index | Co-Detection Type | Bird Species |
---|---|---|---|---|---|---|
I. ricinus | Iagorlîc | 165 | 3 (1.8) | +1.37 * | B.g./R.m | T. merula |
B.g./R.m | T. philomelos | |||||
B.g./A.p | T. merula | |||||
mun. Chișinău | 42 | 2 (4.7) | +2.5 * | B.g./R.m | T. merula | |
B.g./A.p | T. merula | |||||
Plaiul fagului | 19 | 1 (5.3) | +12.0 | R.m./A.p | T. merula | |
Codrii | 21 | 1 (4.7) | +17.8 | B.g./R.m | T. merula | |
Prutul de jos | 10 | 0 | ||||
Badragii vechi | 5 | 0 | ||||
Total | 262 | 7 (2.67) | +4.58 * |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morozov, A.; Tischenkov, A.; Silaghi, C.; Proka, A.; Toderas, I.; Movila, A.; Frickmann, H.; Poppert, S. Prevalence of Bacterial and Protozoan Pathogens in Ticks Collected from Birds in the Republic of Moldova. Microorganisms 2022, 10, 1111. https://doi.org/10.3390/microorganisms10061111
Morozov A, Tischenkov A, Silaghi C, Proka A, Toderas I, Movila A, Frickmann H, Poppert S. Prevalence of Bacterial and Protozoan Pathogens in Ticks Collected from Birds in the Republic of Moldova. Microorganisms. 2022; 10(6):1111. https://doi.org/10.3390/microorganisms10061111
Chicago/Turabian StyleMorozov, Alexandr, Alexei Tischenkov, Cornelia Silaghi, Andrei Proka, Ion Toderas, Alexandru Movila, Hagen Frickmann, and Sven Poppert. 2022. "Prevalence of Bacterial and Protozoan Pathogens in Ticks Collected from Birds in the Republic of Moldova" Microorganisms 10, no. 6: 1111. https://doi.org/10.3390/microorganisms10061111