Interaction of the Amino-Terminal Domain of the ISAV Fusion Protein with a Cognate Cell Receptor
Abstract
1. Introduction
2. Results
2.1. Sequence Analysis and Structure Modeling of ISAV F
2.2. Lectin Immunofluorescence on ASK Cells Using rHE and rF
2.3. Lectin-Mediated Blockage of ISAV Cell Infection, In Vitro
2.4. Membrane Fusion Assays
2.4.1. Importance of F1 in the Fusion Mechanism
2.4.2. Influence of HE Esterase over the Fusion Mechanism
3. Discussion
4. Materials and Methods
4.1. Fish Cell and ISAV Cultures
4.2. Spodoptera frugiperda (Sf21) Cells and Baculovirus
4.3. Baculovirus Expression System and Protein Purification
4.4. Lectin Immunofluorescence
4.5. Lectin-Mediated ISAV Infection Inhibition
4.6. Sequence Analysis and Modeling
4.7. Molecular Cloning and Expression Vector Construction
4.8. Cell Transfection
4.9. Heterologous Protein Expression Analysis
4.10. Hemadsorption and Membrane Fusion Assays
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Vike, S.; Duesund, H.; Andersen, L.; Nylund, A. Release and survival of infectious salmon anaemia (ISA) virus during decomposition of Atlantic salmon (Salmo salar L.). Aquaculture 2014, 420–421, 119–125. [Google Scholar] [CrossRef]
- Mullins, J.E.; Groman, D.B.; Wadowska, D. Infectious salmon anaemia in salt water Atlantic salmon (Salmo salar L.) in New Brunswick, Canada. Bull. Eur. Assoc. Fish Pathol. 1998, 18, 110–114. [Google Scholar]
- Thorud, K.; Djupvik, H.O. Infectious anaemia in Atlantic salmon (SALMO SALAR L.). Bull. Eur. Assoc. Fish Pathol. 1988, 8, 109–111. [Google Scholar]
- Rodger, H.D.; Turnbull, T.; Muir, F.; Millar, S.; Richards, R.H. Infectious salmon anaemia (ISA) in the United Kingdom. Bull. Eur. Assoc. Fish Pathol. 1998, 18, 115–116. [Google Scholar]
- Godoy, M.G.; Aedo, A.; Kibenge, M.J.T.; Groman, D.B.; Yason, C.V.; Grothusen, H.; Lisperguer, A.; Calbucura, M.; Avendaño, F.; Imilán, M.; et al. First detection, isolation and molecular characterization of infectious salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) in Chile. BMC Vet. Res. 2008, 4, 28. [Google Scholar] [CrossRef] [PubMed]
- Christiansen, D.H.; Østergaard, P.S.; Snow, M.; Dale, O.B.; Falk, K. A low-pathogenic variant of infectious salmon anemia virus (ISAV-HPR0) is highly prevalent and causes a non-clinical transient infection in farmed Atlantic salmon (Salmo salar L.) in the Faroe Islands. J. Gen. Virol. 2011, 92, 909–918. [Google Scholar] [CrossRef] [PubMed]
- Krossøy, B.; Hordvik, I.; Nilsen, F.; Nylund, A.; Endresen, C. The putative polymerase sequence of infectious salmon anemia virus suggests a new genus within the Orthomyxoviridae. J. Virol. 1999, 73, 2136–2142. [Google Scholar] [CrossRef]
- Clouthier, S.C.; Rector, T.; Brown, N.E.C.; Anderson, E.D. Genomic organization of infectious salmon anaemia virus. J. Gen. Virol. 2002, 83, 421–428. [Google Scholar] [CrossRef]
- Dannevig, B.H.; Falk, K.; Namork, E. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J. Gen. Virol. 1995, 76, 1353–1359. [Google Scholar] [CrossRef]
- Müller, A.; Markussen, T.; Drabløs, F.; Gjøen, T.; Jørgensen, T.T.; Solem, S.T.; Mjaaland, S. Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus. Virus Res. 2010, 151, 131–141. [Google Scholar] [CrossRef]
- Cook, J.D.; Sultana, A.; Lee, J.E. Structure of the infectious salmon anemia virus receptor complex illustrates a unique binding strategy for attachment. Proc. Natl. Acad. Sci. USA 2017. [Google Scholar] [CrossRef] [PubMed]
- Aspehaug, V.; Mikalsen, A.B.; Snow, M.; Biering, E. Characterization of the Infectious Salmon Anemia Virus Fusion Protein. Society 2005, 79, 12544–12553. [Google Scholar] [CrossRef]
- Cook, J.D.; Soto-Montoya, H.; Korpela, M.K.; Lee, J.E. Electrostatic Architecture of the Infectious Salmon Anemia Virus (ISAV) Core Fusion Protein Illustrates a Carboxyl-Carboxylate pH Sensor. J. Biol. Chem. 2015, 290, 18495–18504. [Google Scholar] [CrossRef] [PubMed]
- Godoy, M.G.; Suarez, R.; Lazo, E.S.; Llegues, K.O.; Kibenge, M.J.T.; Wang, Y.; Kibenge, F.S.B. Genetic analysis and comparative virulence of infectious salmon anemia virus (ISAV) types HPR7a and HPR7b from recent field outbreaks in Chile. Virol. J. 2014, 11, 204. [Google Scholar] [CrossRef][Green Version]
- Devold, M.; Karlsen, M.; Nylund, A. Sequence analysis of the fusion protein gene from infectious salmon anemia virus isolates: Evidence of recombination and reassortment. J. Gen. Virol. 2006, 87, 2031–2040. [Google Scholar] [CrossRef]
- Cunningham, C.O.; Gregory, A.; Black, J.; Simpson, I.; Raynard, R.S. A novel variant of the infectious salmon anaemia virus (ISAV) haemagglutinin gene suggests mechanisms for virus diversity. Bull. Eur. Assoc. Fish Pathol. 2002, 22, 366–374. [Google Scholar]
- Lyngstad, T.M.; Kristoffersen, A.B.; Hjortaas, M.J.; Devold, M.; Aspehaug, V.; Larssen, R.B.; Jansen, P.A. Low virulent infectious salmon anaemia virus (ISAV-HPR0) is prevalent and geographically structured in Norwegian salmon farming. Dis. Aquat. Organ. 2012, 101, 197–206. [Google Scholar] [CrossRef] [PubMed]
- McBeath, A.; Fourrier, M.; Munro, E.; Falk, K.; Snow, M. Presence of a full-length highly polymorphic region (HPR) in the ISAV haemagglutinin-esterase does not affect the primary functions of receptor binding and esterase activity. Arch. Virol. 2011, 156, 2285–2289. [Google Scholar] [CrossRef]
- Fourrier, M.; Lester, K.; Thoen, E.; Mikalsen, A.; Evensen, Ø.; Falk, K.; Collet, B.; McBeath, A. Deletions in the highly polymorphic region (HPR) of infectious salmon anaemia virus HPR0 haemagglutinin-esterase enhance viral fusion and influence the interaction with the fusion protein. J. Gen. Virol. 2014, 95, 1015–1024. [Google Scholar] [CrossRef][Green Version]
- Gamblin, S.J.; Skehel, J.J. Influenza Hemagglutinin and Neuraminidase Membrane Glycoproteins. J. Biol. Chem. 2010, 285, 28403–28409. [Google Scholar] [CrossRef]
- Matrosovich, M.N.; Matrosovich, T.Y.; Roberts, N.A.; Klenk, H.-D.; Gray, T. Neuraminidase is important for the initiation of influenza virus infection in human airway epithelium. J. Virol. 2004, 78, 12665–12667. [Google Scholar] [CrossRef] [PubMed]
- Ohuchi, M.; Asaoka, N.; Sakai, T.; Ohuchi, R. Roles of neuraminidase in the initial stage of influenza virus infection. Microbes Infect. 2006, 8, 1287–1293. [Google Scholar] [CrossRef] [PubMed]
- Sorrell, E.M.; Song, H.; Pena, L.; Perez, D.R. A 27-amino-acid deletion in the neuraminidase stalk supports replication of an avian H2N2 influenza A virus in the respiratory tract of chickens. J. Virol. 2010, 84, 11831–11840. [Google Scholar] [CrossRef]
- Stech, O.; Veits, J.; Abdelwhab, E.-S.M.; Wessels, U.; Mettenleiter, T.C.; Stech, J. The Neuraminidase Stalk Deletion Serves as Major Virulence Determinant of H5N1 Highly Pathogenic Avian Influenza Viruses in Chicken. Sci. Rep. 2015, 5, 13493. [Google Scholar] [CrossRef]
- Benton, D.J.; Martin, S.R.; Wharton, S.A.; McCauley, J.W. Biophysical measurement of the balance of influenza a hemagglutinin and neuraminidase activities. J. Biol. Chem. 2015, 290, 6516–6521. [Google Scholar] [CrossRef]
- Niles, W.D.; Cohen, F.S. Single event recording shows that docking onto receptor alters the kinetics of membrane fusion mediated by influenza hemagglutinin. Biophys. J. 1993, 65, 171–176. [Google Scholar] [CrossRef]
- Aamelfot, M.; Dale, O.B.; Weli, S.C.; Koppang, E.O.; Falk, K. Expression of the Infectious Salmon Anemia Virus Receptor on Atlantic Salmon Endothelial Cells Correlates with the Cell Tropism of the Virus. J. Virol. 2012, 86, 10571–10578. [Google Scholar] [CrossRef]
- Hellebø, A.; Vilas, U.; Falk, K.; Vlasak, R. Infectious salmon anemia virus specifically binds to and hydrolyzes 4-O-acetylated sialic acids. J. Virol. 2004, 78, 3055–3062. [Google Scholar] [CrossRef]
- Langereis, M.A.; Bakkers, M.J.G.; Deng, L.; Padler-Karavani, V.; Vervoort, S.J.; Hulswit, R.J.G.; Van Vliet, A.L.W.; Gerwig, G.J.; De Poot, S.A.H.; Boot, W.; et al. Complexity and Diversity of the Mammalian Sialome Revealed by Nidovirus Virolectins. Cell Rep. 2015, 11, 1966–1978. [Google Scholar] [CrossRef]
- Cohen, M.; Varki, A. The sialome-far more than the sum of its parts. Omi. A J. Integr. Biol. 2010, 14, 455–464. [Google Scholar] [CrossRef]
- Fourrier, M.; Lester, K.; Markussen, T.; Falk, K.; Secombes, C.J.; McBeath, A.; Collet, B. Dual mutation events in the haemagglutinin-esterase and fusion protein from an infectious salmon anaemia virus HPR0 genotype promote viral fusion and activation by an ubiquitous host protease. PLoS ONE 2015, 10, e0142020. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Langereis, M.A.; Zeng, Q.; Gerwig, G.J.; Frey, B.; Von Itzstein, M.; Kamerling, J.P.; De Groot, R.J.; Huizinga, E.G. Structural basis for ligand and substrate recognition by torovirus hemagglutinin esterases. Proc. Natl. Acad. Sci. USA 2009, 106, 15897–15902. [Google Scholar] [CrossRef] [PubMed]
- Stencel-Baerenwald, J.E.; Reiss, K.; Reiter, D.M.; Stehle, T.; Dermody, T.S. The sweet spot: Defining virus–sialic acid interactions. Nat. Rev. Microbiol. 2014, 12, 739–749. [Google Scholar] [CrossRef] [PubMed]
- Eswar, N.; Webb, B.; Marti-Renom, M.A.; Madhusudhan, M.S.; Eramian, D.; Shen, M.-Y.; Pieper, U.; Sali, A. Comparative protein structure modeling using Modeller. Curr. Protoc. Bioinformatics 2006, 54, 5.6.1–5.6.37. [Google Scholar] [CrossRef]
- Ojeda, N.; Cardenas, C.; Guzman, F.; Marshall, S.H. Chemical synthesis and in vitro evaluation of a phage display-derived peptide active against infectious salmon anemia virus. Appl. Environ. Microbiol. 2016, 82, 2563–2571. [Google Scholar] [CrossRef]
- Sakai, T.; Nishimura, S.I.; Naito, T.; Saito, M. Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Sci. Rep. 2017. [Google Scholar] [CrossRef]
- Erik Hamming, P.H.; Overeem, N.J.; Huskens, J. Influenza as a molecular walker. Chem. Sci. 2020. [Google Scholar] [CrossRef]
- Christiansen, D.H.; Mcbeath, A.J.A.; Aamelfot, M.; Matejusova, I.; Fourrier, M.; White, P.; Petersen, P.E.; Falk, K. First field evidence of the evolution from a non-virulent HPR0 to a virulent HPR-deleted infectious salmon anaemia virus. J. Gen. Virol. 2017, 98, 595–606. [Google Scholar] [CrossRef]
- Plemper, R.K.; Brindley, M.A.; Iorio, R.M. Structural and mechanistic studies of measles virus illuminate paramyxovirus entry. PLoS Pathog. 2011, 7, e1002058. [Google Scholar] [CrossRef]
- Handel, A.; Akin, V.; Pilyugin, S.S.; Zarnitsyna, V.; Antia, R. How sticky should a virus be? The impact of virus binding and release on transmission fitness using influenza as an example. J. R. Soc. Interface 2014, 11, 20131083. [Google Scholar] [CrossRef]
- De Groot, R.J. Structure, function and evolution of the hemagglutinin-esterase proteins of corona- and toroviruses. Glycoconj. J. 2006, 23, 59–72. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.; Langereis, M.A.; Van Vliet, A.L.W.; Huizinga, E.G.; De Groot, R.J. Structure of coronavirus hemagglutinin-esterase offers insight into corona and influenza virus evolution. Proc. Natl. Acad. Sci. USA 2008, 105, 9065–9069. [Google Scholar] [CrossRef] [PubMed]
- Sauter, N.K.; Hanson, J.E.; Glick, G.D.; Brown, J.H.; Crowther, R.L.; Park, S.J.; Skehel, J.J.; Wiley, D.C. Binding of influenza virus hemagglutinin to analogs of its cell-surface receptor, sialic acid: Analysis by proton nuclear magnetic resonance spectroscopy and X-ray crystallography. Biochemistry 1992, 31, 9609–9621. [Google Scholar] [CrossRef]
- Shental-Bechor, D.; Danieli, T.; Henis, Y.I.; Ben-Tal, N. Long-range effects on the binding of the influenza HA to receptors are mediated by changes in the stability of a metastable HA conformation. Biochim. Biophys. Acta - Biomembr. 2002, 1565, 81–90. [Google Scholar] [CrossRef][Green Version]
- Rosenthal, P.B.; Zhang, X.; Formanowski, F.; Fitz, W.; Wong, C.H.; Meier-Ewert, H.; Skehel, J.J.; Wiley, D.C. Structure of the haemagglutinin-esterase-fusion glycoprotein of influenza C virus. Nature 1998, 396, 92–96. [Google Scholar] [CrossRef]
- Workenhe, S.T.; Wadowska, D.W.; Wright, G.M.; Kibenge, M.J.T.; Kibenge, F.S.B. Demonstration of infectious salmon anaemia virus (ISAV) endocytosis in erythrocytes of Atlantic salmon. Virol. J. 2007, 4, 13. [Google Scholar] [CrossRef]
- Puente-Marin, S.; Thwaite, R.; Mercado, L.; Coll, J.; Roher, N.; Del Mar Ortega-Villaizan, M. Fish red blood cells modulate immune genes in response to bacterial inclusion bodies made of TNFα and a g-VHSV fragment. Front. Immunol. 2019. [Google Scholar] [CrossRef]
- Finstad, O.W.; Dahle, M.K.; Lindholm, T.H.; Nyman, I.B.; Løvoll, M.; Wallace, C.; Olsen, C.M.; Storset, A.K.; Rimstad, E. Piscine orthoreovirus (PRV) infects Atlantic salmon erythrocytes. Vet. Res. 2014, 45, 35. [Google Scholar] [CrossRef]
- Wessel, Ø.; Olsen, C.M.; Rimstad, E.; Dahle, M.K. Piscine orthoreovirus (PRV) replicates in Atlantic salmon (Salmo salar L.) erythrocytes ex vivo. Vet. Res. 2015. [Google Scholar] [CrossRef]
- Rolland, J.B.; Bouchard, D.; Coll, J.; Winton, J.R. Combined use of the ASK and SHK-1 cell lines to enhance the detection of infectious salmon anemia virus. J. Vet. Diagn. Invest. 2005, 17, 151–157. [Google Scholar] [CrossRef]
- Lannan, C.N.; Winton, J.R.; Fryer, J.L. Fish cell lines: Establishment and characterization of nine cell lines from salmonids. In Vitro 1984, 20, 671–676. [Google Scholar] [CrossRef] [PubMed]
- Castillo-Cerda, M.T.; Cottet, L.; Toro-Ascuy, D.; Spencer, E.; Cortez-San Martin, M. Development of plaque assay for Chilean Infectious Salmon Anaemia Virus, application for virus purification and titration in salmon ASK cells. J. Fish Dis. 2014, 37, 989–995. [Google Scholar] [CrossRef] [PubMed]
- Vlasak, R.; Muster, T.; Lauro, A.M.; Powers, J.C.; Palese, P. Influenza C virus esterase: Analysis of catalytic site, inhibition, and possible function. J. Virol. 1989, 63, 2056–2062. [Google Scholar] [CrossRef] [PubMed]
- Snow, M.; McKay, P.; McBeath, A.J.A.; Black, J.; Doig, F.; Kerr, R.; Cunningham, C.O.; Nylund, A.; Devold, M. Development, application and validation of a Taqman real-time RT-PCR assay for the detection of infectious salmon anaemia virus (ISAV) in Atlantic salmon (Salmo salar). Dev. Biol. (Basel). 2006, 126, 133–145. [Google Scholar]
- Moore, L.J.; Somamoto, T.; Lie, K.K.; Dijkstra, J.M.; Hordvik, I. Characterization of salmon and trout CD8alpha and CD8beta. Mol. Immunol. 2005, 42, 1225–1234. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Buchan, D.W.A.; Minneci, F.; Nugent, T.C.O.; Bryson, K.; Jones, D.T. Scalable web services for the PSIPRED Protein Analysis Workbench. Nucleic Acids Res. 2013, 41, W349–W357. [Google Scholar] [CrossRef]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef]
- Higuchi, R.; Krummel, B.; Saiki, R.K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: Study of protein and DNA interactions. Nucleic Acids Res. 1988, 16, 7351–7367. [Google Scholar] [CrossRef]
- Burgess, A.; Vigneron, S.; Brioudes, E.; Labbé, J.-C.; Lorca, T.; Castro, A. Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance. Proc. Natl. Acad. Sci. USA 2010, 107, 12564–12569. [Google Scholar] [CrossRef] [PubMed]
- Bagai, S.; Lamb, R.A. Quantitative measurement of paramyxovirus fusion: Differences in requirements of glycoproteins between simian virus 5 and human parainfluenza virus 3 or Newcastle disease virus. J. Virol. 1995, 69, 6712–6719. [Google Scholar] [CrossRef] [PubMed]
- Chernomordik, L.V.; Frolov, V.A.; Leikina, E.; Bronk, P.; Zimmerberg, J. The pathway of membrane fusion catalyzed by influenza hemagglutinin: Restriction of lipids, hemifusion, and lipidic fusion pore formation. J. Cell Biol. 1998, 140, 1369–1382. [Google Scholar] [CrossRef] [PubMed]






| Construct Name | Description | Comment |
|---|---|---|
| HE3 | HE from HPR3 strain | Influence of HPR length in the fusion process |
| F3 | F from HPR3 strain | |
| HE0 | HE from HPR0 sample | |
| F3_183I | F3 with Phe183Ile mutation | Influence of F1 in the fusion process |
| F3_227I | F3 with Phe227Ile mutations | |
| F3_183I_227I | F3 with double mutation: Phe183Ile and Phe227Ile | |
| HE0∆EST | HE0 with Ser32Ala mutation: inactive esterase | Influence of the HE0 esterase activity in the fusion process |
| Primer Name | Sequence | Observations |
|---|---|---|
| ORF Amplification | ||
| 5HE2F | ATGGCACGATTCATAATTTTATTC | HE ORF amplification |
| 3HE2R | TTAAGCAACAGACAGGCTC | HE ORF amplification |
| 5F2F | ATGGCTTTTCTAACAATTTTAG | F ORF amplification |
| 3F2R | TTATCTCCTAATGCATCCC | F ORF amplification |
| Cloning | ||
| 5HENotF | GCGGCCGCGATGGCACGAT | Adds Not I site to 5′ end of HE ORF |
| 3HEKpnIR | GGTACCGACAGGCTCG | Adds Kpn I site to 3′ end of HE ORF |
| HE3XbaI | TCTAGAAGACAGGCTCG | Adds Xba I site to 3′ end of HE ORF |
| 5FEcoRI | GAATTCTATGGCTTTTCTAAC | Adds Eco RI site to 5′ end of F ORF |
| 3FKpn1R | GGTACCGATCTCCTAATGC | Adds Kpn I site to 3′ end of F ORF |
| GFP5XbaI | TCTAGAATGGTGAGCAAGG | Adds Xba I site to 5′ and of eGFP ORF |
| RGFPBam | GGATCCTTACTTGTACAGCTC | Adds Bam HI site to 3′ end of eGFP ORF |
| cherryKpnF | GGTACCCATGGTGAGCAAGG | Adds Kpn I site to 5′ end of mCherry ORF |
| cherryBamR | GGATCCCTACTTGTACAGCTC | Adds Bam HI site to 3′ end of F ORF |
| Mutations | ||
| HESdAFwd | CCTGGTTAGGTGACGCTCGAAGCG | Ser32Ala mutation in HE |
| HESdARev | TGGACTGATCGCTTCGAGCGTCACC | Ser32Ala mutation in HE |
| 183Fwd | GGAGTGGAAAAAGGCATTAC | Phe183Ile mutation in F |
| 183Rev | AATCCTTTCCGTTGTAATGCC | Phe183Ile mutation in F |
| 227Fwd | TGCAATGAAATTTCAATCAGAG | Phe227Ile mutation in F |
| 227Rev | GAACGGCACTACTCTGATTG | Phe227Ile mutation in F |
| qPCR | ||
| Seg8Fwd | CTACACAGCAGGATGCAGATGT | Viral segment 8 evaluation |
| Seg8Rev | CAGGATGCCGGAAGTCGAT | |
| Seg8Probe | FAM-CATCGTCGCTGCAGTTC-TAMRA | |
| ELF1Fwd | CCCCTCCAGGACGTTTACAAA | Cellular ELF1 evaluation |
| ELF1Rev | CACACGGCCCACAGGTACA | |
| ELF1Probe | FAM-ATCGGTGGTATTGGAAC-TAMRA | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ojeda, N.; Cárdenas, C.; Marshall, S. Interaction of the Amino-Terminal Domain of the ISAV Fusion Protein with a Cognate Cell Receptor. Pathogens 2020, 9, 416. https://doi.org/10.3390/pathogens9060416
Ojeda N, Cárdenas C, Marshall S. Interaction of the Amino-Terminal Domain of the ISAV Fusion Protein with a Cognate Cell Receptor. Pathogens. 2020; 9(6):416. https://doi.org/10.3390/pathogens9060416
Chicago/Turabian StyleOjeda, Nicolás, Constanza Cárdenas, and Sergio Marshall. 2020. "Interaction of the Amino-Terminal Domain of the ISAV Fusion Protein with a Cognate Cell Receptor" Pathogens 9, no. 6: 416. https://doi.org/10.3390/pathogens9060416
APA StyleOjeda, N., Cárdenas, C., & Marshall, S. (2020). Interaction of the Amino-Terminal Domain of the ISAV Fusion Protein with a Cognate Cell Receptor. Pathogens, 9(6), 416. https://doi.org/10.3390/pathogens9060416

