Encystment Induces Down-Regulation of an Acetyltransferase-Like Gene in Acanthamoeba castellanii
Abstract
1. Introduction
2. Results
2.1. The N-Acetyltransferase-Like mRNA Levels Are Down-Regulated during Encystment
2.2. The ACA1_384820 Gene Encodes a Putative N-Acetyltransferase-Like Protein That Presents Homologies with Prokaryotic Sequences
2.3. Overexpression of the ACA1_384820 Gene Affects the Formation of Cysts
3. Discussion
4. Materials and Methods
4.1. Amoeba Strains and Cultural Conditions
4.2. Encystment Assay
4.3. Plasmid Constructions and Cloning
4.4. Transfection of Cells
4.5. Reverse Transcription-Quantitative PCR (RT-qPCR)
4.6. Bioinformatics Analysis of the ACA1_384820 Gene
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Rodriguez-Zaragoza, S. Ecology of Free-Living Amoebae. Crit. Rev. Microbiol. 1994, 20, 225–241. [Google Scholar] [CrossRef] [Scilit]
- Thomas, V.; McDonnell, G.; Denyer, S.P.; Maillard, J.-Y. Free-living amoebae and their intracellular pathogenic microorganisms: Risks for water quality. FEMS Microbiol. Rev. 2010, 34, 231–259. [Google Scholar] [CrossRef] [Scilit]
- Martinez, A.J.; Visvesvara, G.S. Free-living, Amphizoic and opportunistic amebas. Brain Pathol. 1997, 7, 583–598. [Google Scholar] [CrossRef] [Scilit]
- Marciano-Cabral, F.; Cabral, G. Acanthamoeba spp. as Agents of Disease in Humans. Clin. Microbiol. Rev. 2003, 16, 273–307. [Google Scholar] [CrossRef] [Scilit]
- Chawla, A.; Armstrong, M.; Carley, F. Acanthamoeba keratitis—An increasing incidence. Contact Lens Anterior Eye 2014, 37, 120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fouque, E.; Trouilhé, M.-C.; Thomas, V.; Hartemann, P.; Rodier, M.-H.; Héchard, Y. Cellular, Biochemical, and Molecular Changes during Encystment of Free-Living Amoebae. Eukaryot. Cell 2012, 11, 382–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lloyd, D. Encystment in Acanthamoeba castellanii: A review. Exp. Parasitol. 2014, 145, S20–S27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazur, T.; Hadas, E.; Iwanicka, I. The duration of the cyst stage and the viability and virulence of Acanthamoeba isolates. Trop. Med. Parasitol. Off. Organ Dtsch. Trop. Ges. Dtsch. Ges. fur Tech. Zs. (GTZ) 1995, 46, 102–108. [Google Scholar]
- Turner, N.; Russell, A.D.; Furr, J.; Lloyd, D. Resistance, biguanide sorption and biguanide-induced pentose leakage during encystment of Acanthamoeba castellanii. J. Appl. Microbiol. 2004, 96, 1287–1295. [Google Scholar] [CrossRef] [Scilit]
- Greub, G.; Raoult, D. Microorganisms Resistant to Free-Living Amoebae. Clin. Microbiol. Rev. 2004, 17, 413–433. [Google Scholar] [CrossRef] [Scilit]
- Kilvington, S.; Price, J. Survival of Legionella pneumophila within cysts of Acanthamoeba polyphaga following chlorine exposure. J. Appl. Bacteriol. 1990, 68, 519–525. [Google Scholar] [CrossRef] [Scilit]
- Van Der Henst, C.; Scrignari, T.; MacLachlan, C.; Blokesch, M. An intracellular replication niche for Vibrio cholerae in the amoeba Acanthamoeba castellanii. ISME J. 2015, 10, 897–910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Etr, S.H.; Margolis, J.J.; Monack, D.; Robison, R.A.; Cohen, M.; Moore, E.; Rasley, A. Francisella tularensis Type A Strains Cause the Rapid Encystment of Acanthamoeba castellanii and Survive in Amoebal Cysts for Three Weeks Postinfection. Appl. Environ. Microbiol. 2009, 75, 7488–7500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leitsch, D.; Köhsler, M.; Marchetti-Deschmann, M.; Deutsch, A.; Allmaier, G.; König, L.; Sixt, B.S.; Duchêne, M.; Walochnik, J. Proteomic aspects of Parachlamydia acanthamoebae infection in Acanthamoeba spp. ISME J. 2010, 4, 1366–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chelkha, N.; Levasseur, A.; Pontarotti, P.; Raoult, D.; La Scola, B.; Colson, P. A Phylogenomic Study of Acanthamoeba polyphaga Draft Genome Sequences Suggests Genetic Exchanges with Giant Viruses. Front. Microbiol. 2018, 9, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarke, M.; Lohan, A.; Liu, B.; Lagkouvardos, I.; Roy, S.W.; Zafar, N.; Bertelli, C.; Schilde, C.; Kianianmomeni, A.; Bürglin, T.R.; et al. Genome of Acanthamoeba castellanii highlights extensive lateral gene transfer and early evolution of tyrosine kinase signaling. Genome Biol. 2013, 14, R11. [Google Scholar] [CrossRef] [Scilit]
- Vetting, M.W.; De Carvalho, L.P.S.; Yu, M.; Hegde, S.S.; Magnet, S.; Roderick, S.L.; Blanchard, J. Structure and functions of the GNAT superfamily of acetyltransferases. Arch. Biochem. Biophys. 2005, 433, 212–226. [Google Scholar] [CrossRef] [Scilit]
- Favrot, L.; Blanchard, J.; Vergnolle, O. Bacterial GCN5-RelatedN-Acetyltransferases: From Resistance to Regulation. Biochemistry 2016, 55, 989–1002. [Google Scholar] [CrossRef] [Scilit]
- Moon, E.-K.; Hong, Y.; Chung, D.-I.; Goo, Y.-K.; Kong, H.H. Down-Regulation of Cellulose Synthase Inhibits the Formation of Endocysts in Acanthamoeba. Korean J. Parasitol. 2014, 52, 131–135. [Google Scholar] [CrossRef] [Scilit]
- Aurrecoechea, C.; Barreto, A.; Brestelli, J.; Brunk, B.P.; Caler, E.V.; Fischer, S.; Gajria, B.; Gao, X.; Gingle, A.; Grant, G.; et al. AmoebaDB and MicrosporidiaDB: Functional genomic resources for Amoebozoa and Microsporidia species. Nucleic Acids Res. 2010, 39, D612–D619. [Google Scholar] [CrossRef] [Scilit]
- Bateman, E. Expression plasmids and production of EGFP in stably transfected Acanthamoeba. Protein Expr. Purif. 2009, 70, 95–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orfeo, T.; Bateman, E. Transcription by RNA polymerase II during Acanthamoeba differentiation. Biochim. Biophys. Acta (BBA) Gene Struct. Expr. 1998, 1443, 297–304. [Google Scholar] [CrossRef] [Scilit]
- Lopez, A.B.; Şener, K.; Jarroll, E.L.; Van Keulen, H. Transcription regulation is demonstrated for five key enzymes in Giardia intestinalis cyst wall polysaccharide biosynthesis. Mol. Biochem. Parasitol. 2003, 128, 51–57. [Google Scholar] [CrossRef] [Scilit]
- Macechko, P.T.; Steimle, P.A.; Lindmark, D.G.; Erlandsen, S.L.; Jarroll, E.L. Galactosamine-synthesizing enzymes are induced when Giardia encyst. Mol. Biochem. Parasitol. 1992, 56, 301–309. [Google Scholar] [CrossRef] [Scilit]
- Naguleswaran, A.; Elias, E.V.; McClintick, J.; Edenberg, H.J.; Sullivan, W.J. Toxoplasma gondii Lysine Acetyltransferase GCN5-A Functions in the Cellular Response to Alkaline Stress and Expression of Cyst Genes. PLoS Pathog. 2010, 6, 1001232. [Google Scholar] [CrossRef] [Scilit]
- De Jonckheere, J.F. Ecology of Acanthamoeba. Clin. Infect. Dis. 1991, 13, 385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mengue, L.; Régnacq, M.; Aucher, W.; Portier, E.; Héchard, Y.; Samba-Louaka, A. Legionella pneumophila prevents proliferation of its natural host Acanthamoeba castellanii. Sci. Rep. 2016, 6, 36448. [Google Scholar] [CrossRef] [Scilit]
- Moon, E.-K.; Chung, D.-I.; Hong, Y.-C.; Kong, H.H. Autophagy protein 8 mediating autophagosome in encysting Acanthamoeba. Mol. Biochem. Parasitol. 2009, 168, 43–48. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Hunter, S.; Apweiler, R.; Attwood, T.; Bairoch, A.; Bateman, A.; Binns, D.; Bork, P.; Das, U.; Daugherty, L.; Duquenne, L.; et al. InterPro: The integrative protein signature database. Nucleic Acids Res. 2008, 37, D211–D215. [Google Scholar] [CrossRef] [Scilit]
- InterPro; Classification of Protein Families. Available online: https://www.ebi.ac.uk/interpro/ (accessed on 20 April 2020).
- BLAST: Basic Local Alignment Search Tool. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 20 April 2020).
- Multalin Interface Page. Available online: http://multalin.toulouse.inra.fr/multalin/multalin.html (accessed on 20 April 2020).
- Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988, 16, 10881–10890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ExPASy-Translate Tool. Available online: https://web.expasy.org/translate/ (accessed on 20 April 2020).



| Query_ID | Subject_ID | Organisms | % Identity | Length | Start (query) | End (query) | Start (subject) | End (subject) | e-Value | Bitscore |
|---|---|---|---|---|---|---|---|---|---|---|
| ACA1_384820 | NW_004457598.1 | Acanthamoeba castellanii | 100.00 | 1228 | 1 | 1228 | 109079 | 110306 | 0.0 | 2268 |
| CDFJ01209063.1 | Acanthamoeba pearcei | 88.53 | 1247 | 5 | 1228 | 1729 | 497 | 0.0 | 1476 | |
| CDFJ01209064.1 | 88.42 | 1244 | 8 | 1228 | 1726 | 497 | 0.0 | 1465 | ||
| CDFN01057746.1 | Acanthamoeba quina | 88.04 | 1237 | 5 | 1221 | 2781 | 3987 | 0.0 | 1419 | |
| CDFB01039259.1 | Acanthamoeba lugdunensis | 88.04 | 1221 | 18 | 1221 | 1291 | 2478 | 0.0 | 1400 | |
| LQHA01001417.1 | Acanthamoeba polyphaga | 87.66 | 1224 | 23 | 1221 | 1807 | 599 | 0.0 | 1387 | |
| CDFC01048720.1 | Acanthamoeba rhysodes | 86.14 | 1255 | 20 | 1218 | 404 | 1633 | 0.0 | 1279 | |
| CDFC01052420.1 | 87.56 | 595 | 635 | 1218 | 1485 | 2073 | 0.0 | 673 | ||
| CDFC01052420.1 | 85.54 | 415 | 238 | 632 | 992 | 1404 | 1.98e-113 | 414 | ||
| CDFC01052420.1 | 88.54 | 192 | 4 | 195 | 722 | 913 | 5.94e-59 | 233 | ||
| CDFD01054069.1 | Acanthamoeba palestinensis | 79.70 | 1266 | 5 | 1228 | 50106 | 51339 | 0.0 | 846 | |
| CDFE01061388.1 | Acanthamoeba mauritaniensis | 89.29 | 588 | 635 | 1218 | 2725 | 3307 | 0.0 | 728 | |
| CDFE01061388.1 | 83.36 | 667 | 12 | 631 | 2021 | 2676 | 1.85e-158 | 564 | ||
| CDFE01051786.1 | 89.12 | 588 | 635 | 1218 | 1082 | 500 | 0.0 | 723 | ||
| CDFE01051786.1 | 85.78 | 647 | 18 | 631 | 1746 | 1110 | 0.0 | 645 |
| Name of Primer | Sequence 5’ -> 3’ | Use | Source |
|---|---|---|---|
| qACA1_127910_Fwd | GCGCATCTTCTTCATCGAGG | RT-qPCR | This study |
| qACA1_127910_Rev | CTTGTCGTTCGAACCCTTGG | RT-qPCR | This study |
| qACA1_164890_Fwd | TTCTTCATCGAGGAGGAGGC | RT-qPCR | This study |
| qACA1_164890_Rev | CGTCCAGTTTGAGTAGTGCG | RT-qPCR | This study |
| qACA1_350710_Fwd | CATGCTCAACGACATCACCC | RT-qPCR | This study |
| qACA1_350710_Rev | GTACTCCACCACTTCCACCT | RT-qPCR | This study |
| qACA1_383510_Fwd | GAGAATGGCGGCATGAATCC | RT-qPCR | This study |
| qACA1_383510_Rev | GCGCTCTTTCGTGATGTCAA | RT-qPCR | This study |
| qACA1_215610_Fwd | GAAGATGGGGTTCGTGCAGA | RT-qPCR | This study |
| qACA1_215610_Rev | TCGGTTTCTGGAAGGAGAGG | RT-qPCR | This study |
| qACA1_384820_Fwd | TTTCGCCCAGAAGCCCAGAG | RT-qPCR | This study |
| qACA1_384820_Rev | TCGTTCAGGTGGCGTAGCAG | RT-qPCR | This study |
| Cellulose synthase_Fwd | GGTCTCCATGTCCCTCTACG | RT-qPCR | This study |
| Cellulose synthase_Rev | CAGTTGGGGATCTTGAAGCG | RT-qPCR | This study |
| TBPF_Fwd | GCCGGACAAGAAGCGAAGGAAG | RT-qPCR | This study |
| TBPF_Rev | GTCGGTGAAGTAGACGCGGAAG | RT-qPCR | This study |
| Ac18S_Fwd | TCCAATTTTCTGCCACCGAA | RT-qPCR | [28] |
| Ac18S_Rev | ATCATTACCCTAGTCCTCGC | RT-qPCR | [28] |
| ACA1_384820_Fwd_NdeI | TTTTTTCATATGGACTGCACAACAGAC | Cloning | This study |
| ACA1_384820_Rev_XhoI | TTTTTTCTCGAGTCAACTGGGTGCCGC | Cloning | This study |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rolland, S.; Mengue, L.; Noël, C.; Crapart, S.; Mercier, A.; Aucher, W.; Héchard, Y.; Samba-Louaka, A. Encystment Induces Down-Regulation of an Acetyltransferase-Like Gene in Acanthamoeba castellanii. Pathogens 2020, 9, 321. https://doi.org/10.3390/pathogens9050321
Rolland S, Mengue L, Noël C, Crapart S, Mercier A, Aucher W, Héchard Y, Samba-Louaka A. Encystment Induces Down-Regulation of an Acetyltransferase-Like Gene in Acanthamoeba castellanii. Pathogens. 2020; 9(5):321. https://doi.org/10.3390/pathogens9050321
Chicago/Turabian StyleRolland, Steven, Luce Mengue, Cyril Noël, Stéphanie Crapart, Anne Mercier, Willy Aucher, Yann Héchard, and Ascel Samba-Louaka. 2020. "Encystment Induces Down-Regulation of an Acetyltransferase-Like Gene in Acanthamoeba castellanii" Pathogens 9, no. 5: 321. https://doi.org/10.3390/pathogens9050321
APA StyleRolland, S., Mengue, L., Noël, C., Crapart, S., Mercier, A., Aucher, W., Héchard, Y., & Samba-Louaka, A. (2020). Encystment Induces Down-Regulation of an Acetyltransferase-Like Gene in Acanthamoeba castellanii. Pathogens, 9(5), 321. https://doi.org/10.3390/pathogens9050321

