Incidence, Pathotyping, and Antibiotic Susceptibility of Avian Pathogenic Escherichia coli among Diseased Broiler Chicks
Abstract
:1. Introduction
2. Results
2.1. Bacterial Isolation, Identification, and Serogrouping
2.2. Polymerase Chain Reaction (PCR) Using E. coli Species-Specific Gene and Virulence Genes (iss, iutA, and fimH)
2.3. Results of Virulence Assessment in Specific Pathogen-Free (SPF) 1-day-old Chicks and Embryonated Chicken Eggs (SPF ECEs)
2.4. Results of Antibiotic Sensitivity Testing
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Bacteriological Isolation, Identification, and Serotyping
4.3. Polymerase Chain Reaction (PCR) Using E. coli General Gene and Virulence Genes (iss, iutA, and fimH)
4.4. Virulence Testing APEC Isolates
- One-day-old specific pathogen-free (SPF) chick model: Seventy-five 1-day-old SPF chicks, supplied by a SPF farm at Al-fayoum province, Egypt, were divided into 15 groups (n = 5) for {13 isolates, 2 control groups (one sham-challenged subcutaneously with saline and the other non-challenged}. All chicks were reared in separate cages with food and water supplied ad-libitum. According to Wang et al. [17], each chick in every group was inoculated subcutaneously with 0.2 mL of APEC isolate suspension (1 × 108 CFU/mL), calculated according to the McFerland standard [53]. Deaths and clinical signs of illness were recorded four times daily for 7 days post-inoculation (PI). The surviving chicks were killed at 7th day PI and the lesions were recorded. APEC isolates were classified, on the basis of their virulence degree for one day-old chicks, as follows: (a) highly pathogenic isolates—produced mortality or severe lesions including pericarditis, perihepatitis, air sacculitis, and liver necrosis in more than 50% of the challenged chicks, (b) intermediate pathogens—were nonlethal and produced lesions in fewer than 50% of the inoculates, and (c) low pathogens—produced no mortality and only occasional lesions in the air sacs [20].
- Specific pathogen-free (SPF) embryonated chicken eggs (ECEs) model: Fifteen groups of SPF ECEs (n = 10 eggs) for the same 13 isolates and 2 additional control groups (one group inoculated with saline and the other non-inoculated) were used in an embryo lethality test. According to Wooly et al. and Nolan et al. [13,21], 0.2 mL containing 500 CFU of each isolate (calculated according to McFerland standard [53]) was inoculated into 10 SPF ECEs through the allantoic sac (10-day old embryos); thereafter, by daily candling for 7 days PI, the mortality was recorded to classify APEC strains as follows: highly virulent strain resulted in mortality rate of >29% of ECEs, moderately virulent strains reported 10%–29% mortality, and <10% mortality was observed in a virulent strain.
4.5. In Vitro Antibiotic Sensitivity Testing of E. coli Isolates
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Tenaillon, O.; Skurnik, D.; Picard, B.; Denamur, E. The population genetics of commensal Escherichia coli. Nat. Rev. Microbiol. 2010, 8, 207–217. [Google Scholar] [CrossRef]
- Filho, H.K.; Brito, K.; Cavalli, L.; Brito, B. Avian pathogenic Escherichia coli (APEC)—An update on the control. In The Battle Against Microbial Pathogens: Basic Science, Technological Advances and Educational Programs; Méndez-Vilas, A., Ed.; Formatex Research Center: Badajoz, Spain, 2015; pp. 598–618. [Google Scholar]
- Kabir, S.M.L. Avian colibacillosis and salmonellosis: A closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns. Int. J. Environ. Res. Public Health 2010, 7, 89–114. [Google Scholar] [CrossRef] [Green Version]
- Nolan, L.K.; Barnes, H.J.; Vaillancourt, J.P.; Abdul¬Aziz, T.; Logue, C.M. Colibacillosis; Mosby-Wolf Publication Ltd.: London, UK, 2013. [Google Scholar]
- Rahman, M.; Samad, M.; Rahman, M.; Kabir, S. Bacterio-pathological studies on salmonellosis, colibacillosis and pasteurellosis in natural and experimental infections in chickens. Bangladesh J. Vet. Med. 2004, 2, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Jordan, F.T.; Williams, N.J.; Wattret, A.; Jones, T. Observations on salpingitis, peritonitis and salpingoperitonitis in a layer breeder flock. Vet. Rec. 2005, 157, 573–577. [Google Scholar] [CrossRef] [PubMed]
- Markland, S.M.; LeStrange, K.J.; Sharma, M.; Knie, K.E. Old Friends in New Places: Exploring the Role of xtraintestinal E. coli in Intestinal Disease and Foodborne Illness. Zoonoses Public Health 2015. [Google Scholar] [CrossRef] [PubMed]
- Bondoc, I. European Regulation in the Veterinary Sanitary and Food Safety Area, a Component of the European Policies on the Safety of Food Products and the Protection of Consumer Interests: A 2007 Retrospective. Part One: The Role of European Institutions in Laying Down and Passing Laws Specific to the Veterinary Sanitary and Food Safety Area. Universul Juridic, Supliment, 12–15. 2016. Available online: http://revista.universuljuridic.ro/supliment/european-regulation-veterinary-sanitary-food-safety-area-component-european-policies-safety-food-products-protection-consumer-interests-2007-retrospective/ (accessed on 24 July 2019).
- Bondoc, I. European Regulation in the Veterinary Sanitary and Food Safety Area, a Component of the European Policies on the Safety of Food Products and the Protection of Consumer Interests: A 2007 Retrospective. Part Two: Regulations. Universul Juridic, Supliment, 16–19. 2016. Available online: http://revista.universuljuridic.ro/supliment/european-regulation-veterinary-sanitary-food-safety-area-component-european-policies-safety-food-products-protection-consumer-interests-2007-retrospective-2/ (accessed on 24 July 2019).
- Kunert, F.H.; Carvalho, D.; Grassotti, T.; Soares, B.; Rossato, J.; Cunha, A.; Brito, K.; Cavalli, L.; Brito, B. Avian pathogenic Escherichia coli-methods for improved diagnosis. Worlds Poult. Sci. J. 2015, 71, 249–258. [Google Scholar] [CrossRef]
- Schouler, C.; Schaeffer, B.; Brée, A.; Mora, A.; Dahbi, G.; Biet, F.; Oswald, E.; Mainil, J.; Blanco, J.; Moulin-Schouleur, M. Diagnostic strategy for identifying avian pathogenic Escherichia coli based on four patterns of virulence genes. J. Clin. Microbial. 2012, 50, 1673–1678. [Google Scholar] [CrossRef] [Green Version]
- Dziva, F.; Stevens, M.P. Colibacillosis in poultry: Unravelling the molecular basis of virulence of avian pathogenic Escherichia coli in their natural hosts. Avian Pathol. 2008, 37, 355–366. [Google Scholar] [CrossRef] [Green Version]
- Wooley, R.E.; Gibbs, P.S.; Brown, T.P.; Maurer, J.J. Chicken embryo lethality assay for determining the virulence of avian Escherichia coli isolates. Avian Dis. 2000, 44, 318–324. [Google Scholar] [CrossRef]
- Pfaff-Mcdonough, S.J.; Horne, S.M.; Giddings, C.W.; Ebert, J.O.; Doetkott, C.; Smith, M.H.; Nolan, L.K. Complement resistance-related traits among Escherichia coli isolates from apparently healthy birds and birds with colibacillosis. Avian Dis. 2000, 44, 23–33. [Google Scholar] [CrossRef]
- Johnson, T.J.; Siek, K.E.; Johnson, S.J.; Nolan, L.K. DNA Sequence of a colv Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Strains. J. Bacteriol. 2006, 188, 745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mellata, M.; Touchman, J.W.; Curtiss, R. Full sequence and comparative analysis of the plasmid papec-1 of avian pathogenic E. coli chi7122 (O78:K80:H9). PLoS ONE 2009, 4, 4232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Tang, P.; Tan, D.; Wang, L.; Zhang, S.; Qiu, Y.; Dong, R.; Liu, W.; Huang, J.; Chen, T.; et al. The pathogenicity of chicken pathogenic Escherichia coli is associated with the numbers and combination patterns of virulence-associated genes. Open J. Vet. Med. 2015, 5, 243–254. [Google Scholar] [CrossRef] [Green Version]
- Vandekerchove, D.; Vandemaele, F.; Adriaensen, C.; Zaleska, M.; Hernalsteens, J.P.; De Baets, L.; Butaye, P.; Van Immerseel, F.; Wattiau, P.; Laevens, H.; et al. Virulence-associated traits in avian Escherichia coli: Comparison between isolates from colibacillosis-affected and clinically healthy layer flocks. Vet. Microbiol. 2005, 108, 75–87. [Google Scholar] [CrossRef]
- Delicato, E.R.; De Brito, B.G.; Gaziri, L.C.; Vidotto, M.C. Virulence-associated genes in Escherichia coli isolates from poultry with colibacillosis. Vet. Microbiol. 2003, 94, 97–103. [Google Scholar] [CrossRef]
- Rosenberger, J.; Fries, P.; Cloud, S.; Wilson, R. In vitro and in vivo characterization of avian Escherichia coli. II. Factors associated with pathogenicity. Avian Dis. 1985, 29, 1094–1107. [Google Scholar] [CrossRef]
- Nolan, L.K.; Wooley, R.E.; Brown, J.; Spears, K.R.; Dickerson, H.W.; Dekich, M. Comparison of a complement resistance test, a chicken embryo lethality test, and the chicken lethality test for determining virulence of avian Escherichia coli. Avian Dis. 1992, 36, 395–397. [Google Scholar] [CrossRef]
- ClSI (Clinical Laboratory Standards Institute). Performance Standards for Antimicrobial Susceptibility Testing: Twenty-third Informational Supplement M100-S23; ClSI (Clinical Laboratory Standards Institute): Wayne, PA, USA, 2013. [Google Scholar]
- Galani, I.; Kontopidou, F.; Souli, M.; Rekatsina, P.D.; Koratzanis, E.; Deliolanis, J.; Giamarellou, H. Colistin susceptibility testing by E test and disk diffusion methods. Int. J. Antimicrob. Agent 2008, 31, 434–439. [Google Scholar] [CrossRef]
- Abdeltawab, A.; Maarouf, A.A.; Abd El Al, S.; El-Hofy, F.A.; El Mougy, E. Detection of some virulence genes of avian pathogenic E. coli by polymerase chain reaction. Benha Vet. Med. J. 2014, 26, 159–176. [Google Scholar]
- Abd El-Haleem, Y.F. Some Epidemiological Studies on Escherichia coli in Poultry Farms. Master’s Thesis, Faculty of Veterinary Medicine, Zagazig University, Zagazig City, Egypt, 2000. [Google Scholar]
- Roshdy, H.; El-Aziz, S.A.; Refai, M. Incidence of E. coli in chickens and ducks in different governorates in Egypt. In Proceedings of the 1st Conference of Animal Health Research Institute Association. 2012. Available online: https://scholar.cu.edu.eg/?q=hanem/files/publication49_1_9.pdf (accessed on 19 December 2019).
- Ozaki, H.; Murase, T. Multiple routes of entry for Escherichia coli causing colibacillosis in commercial layer chickens. J. Vet. Med. Sci. 2009, 71, 1685–1689. [Google Scholar] [CrossRef] [Green Version]
- Eid, H.I.; Algammal, A.M.; Nasef, S.A.; Elfeil, W.K.; Mansour, G.H. Genetic variation among avian pathogenic E. coli strains isolated from broiler chickens. Asian J. Anim. Vet. Adv. 2016, 11, 350–356. [Google Scholar]
- Holland, J.L.; Louie, L.; Simor, A.E.; Louie, M. PCR detection of Escherichia coli O157:H7 directly from stools: Evaluation of commercial extraction methods for purifying fecal DNA. J. Clin. Microbial. 2000, 38, 4108–4113. [Google Scholar] [CrossRef] [Green Version]
- Chui, L.; Couturier, M.R.; Chiu, T.; Wang, G.; Olson, A.B.; Mcdonald, R.R.; Antonishyn, N.A.; Horsman, G.; Gilmour, M.W. Comparison of Shiga toxin-producing Escherichia coli detection methods using clinical stool samples. J. Mol. Diagnost. 2010, 12, 469–475. [Google Scholar] [CrossRef]
- Paixao, A.C.; Ferreira, A.C.; Fontes, M.; Themudo, P.; Albuquerque, T.; Soares, M.C.; Fevereiro, M.; Martins, L.; Corrêa de Sá, M.I. Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates. Poult. Sci. 2016, 95, 1646–1652. [Google Scholar] [CrossRef]
- Subedi, M.; Luitel, H.; Devkota, B.; Bhattarai, R.K.; Phuyal, S.; Panthi, P.; Shrestha, A.; Chaudhary, D.K. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet. Res. 2018, 14, 113. [Google Scholar] [CrossRef]
- Mbanga, J.; Nyararai, Y.O. Virulence gene profiles of avian pathogenic Escherichia coli isolated from chickens with colibacillosis in Bulawayo, Zimbabwe. Onderstepoort J. Vet. Res. 2015, 82, e1–e8. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Siek, K.E.; Giddings, C.W.; Doetkott, C.; Johnson, T.J.; Fakhr, M.K.; Nolan, L.K. Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology 2005, 151, 2097–2110. [Google Scholar] [CrossRef] [Green Version]
- Rocha, A.C.; Rocha, S.L.; Lima-Rosa, C.A.; Souza, G.F.; Moraes, H.L.; Salle, F.O.; Moraes, L.B.; Salle, C.T. Genes associated with pathogenicity of avian Escherichia coli (APEC) isolated from respiratory cases of poultry. Pesq. Vet. Bras. 2008, 28, 183–186. [Google Scholar] [CrossRef] [Green Version]
- Nakazato, G.; Campos, T.A.D.; Stehling, E.G.; Brocchi, M.; Silveira, W.D.D. Virulence factors of avian pathogenic Escherichia coli (APEC). Pesq. Vet. Bras. 2015, 29, 479–486. [Google Scholar] [CrossRef] [Green Version]
- Van Den Bosch, J.F.; Hendriks, J.H.; Gladigau, I.; Willems, H.M.; Storm, P.K.; De Graaf, F.K. Identification of F11 fimbriae on chicken Escherichia coli strains. Infect. Immun. 1993, 61, 800. [Google Scholar] [CrossRef] [Green Version]
- Gibbs, P.S.; Petermann, S.R.; Wooley, R.E. Comparison of several challenge models for studies in avian colibacillosis. Avian Dis. 2004, 48, 751–758. [Google Scholar] [CrossRef] [PubMed]
- Dho, M.; Lafont, J.P. Escherichia coli colonization of the trachea in poultry: Comparison of virulent and avirulent strains in gnotoxenic chickens. Avian Dis. 1982, 26, 787–797. [Google Scholar] [CrossRef] [PubMed]
- Gibbs, P.S.; Wooley, R.E. Comparison of the intravenous chicken challenge method with the embryo lethality assay for studies in avian colibacillosis. Avian Dis. 2003, 47, 672–680. [Google Scholar] [CrossRef] [PubMed]
- Ewers, C.; Antão, E.-M.; Diehl, I.; Philipp, H.C.; Wieler, L.H. Intestine and Environment of the Chicken as Reservoirs for Extraintestinal Pathogenic Escherichia coli Strains with Zoonotic Potential. Appl. Environ. Microbiol. 2009, 75, 184–192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miles, T.D.; Mclaughlin, W.; Brown, P.D. Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet. Res. 2006, 2, 7. [Google Scholar] [CrossRef] [Green Version]
- Sepehri, G.; Abbass-Zadeh, H. Prevalence of bacterial resistance to commonly used antimicrobials among Escherichia coli isolated from chickens in Kerman Province of Iran. J. Med. Sci. 2006, 6, 99–102. [Google Scholar]
- Ozawa, M.; Harada, K.; Kojima, A.; ASAI, T.; Sameshima, T. Antimicrobial susceptibilities, serogroups, and molecular characterization of avian pathogenic Escherichia coli isolates in Japan. Avian Dis. 2008, 52, 392–397. [Google Scholar] [CrossRef]
- Singer, R.S.; Hofacre, C.L. Potential impacts of antibiotic use in poultry production. Avian Dis. 2006, 50, 16–172. [Google Scholar] [CrossRef]
- Aidara-Kane, A.; Angulo, F.J.; Conly, J.M.; Minato, Y.; Silbergeld, E.K.; Mcewen, S.A.; Collignon, P.J. World Health Organization (WHO) guidelines on use of medically important antimicrobials in food-producing animals. Antimicrob. Resist. Infect. Cont. 2018, 7, 7. [Google Scholar] [CrossRef] [Green Version]
- Lee, G.Y.; Jang, H.I.; Hwang, I.G.; Rhee, M.S. Prevalence and classification of pathogenic Escherichia coli isolated from fresh beef, poultry, and pork in Korea. Int. J. Food Microbiol. 2009, 134, 196–200. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Hu, Q.; Tu, J.; Han, X.; Zhu, Y.; Ding, C.; Yu, S. Development of multiplex PCR assay for rapid detection of Riemerella anatipestifer, Escherichia coli, and Salmonella enterica simultaneously from ducks. J. Microbiol. Method. 2011, 87, 64–69. [Google Scholar] [CrossRef] [PubMed]
- Yaguchi, K.; Ogitani, T.; Osawa, R.; Kawano, M.; Kokumai, N.; Kaneshige, T.; Noro, T.; Masubuchi, K.; Shimizu, Y. Virulence factors of avian pathogenic Escherichia coli strains isolated from chickens with colisepticemia in Japan. Avian Dis. 2007, 51, 656–662. [Google Scholar] [CrossRef]
- Moulin-Schouleur, M.; Schouler, C.; Tailliez, P.; Kao, M.R.; Bree, A.; Germon, P.; Oswald, E.; Mainil, J.; Blanco, M.; Blanco, J. Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. J. Clin. Microbiol. 2006, 44, 3484–3492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tiba, M.R.; Yano, T.; Leite Dda, S. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev. Inst. Med. Trop. Sao Paulo 2008, 50, 255–260. [Google Scholar] [CrossRef] [Green Version]
- Mcfarland, J. The nephelometer: An instrument for media used for estimating the number of bacteria in suspensions used for calculating the opsonic index and for vaccines. J. Am. Med. Assoc. 1907, 14, 1176–1178. [Google Scholar] [CrossRef] [Green Version]
- Finegold, S.M.; Martin, S. Diagnostic Microbiology 6th ed the C.V. Mosby Company, St. Louis Tranto, London. Wiener Tierarstilichmschr. 1982, 6, 233. [Google Scholar]
Serial No. | Isolate Code No. | Serotype | Virulence Gene Content | In Vivo Virulence Assays | |
---|---|---|---|---|---|
SPF 1-day-old Chicks a | SPF ECEs b | ||||
1 | 9 | O115 | iss | L | H |
2 | 16 | O115 | iss + iutA | L | H |
3 | 41 | O158 | iss + fimH | M | H |
4 | 50 | O158 | iss + fimH + iutA | L | H |
5 | 28 | O114 | iss + iutA | M | H |
6 | 54 | O114 | iutA | L | H |
7 | 5 | O125 | iss | H | H |
8 | 2 | O27 | iss | M | H |
9 | 7 | O55 | iss + fimH | L | H |
10 | 39 | O55 | iss + iutA | H | H |
11 | 15 | O20 | iss + iutA | L | H |
12 | 32 | O142 | iss + iutA | L | H |
13 | 49 | O15 | iss | L | H |
14 | Control c | - | - | - | - |
15 | Control negative d | - | - | - | - |
Antibiotic a | APEC Isolates (Code No.) | % of Isolatesb | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
9 | 16 | 41 | 50 | 28 | 54 | 5 | 2 | 7 | 39 | 15 | 32 | 49 | R | I | S | |
Ampicillin | R | R | R | R | R | R | R | R | R | R | R | R | R | 100 | 0 | 0 |
Amoxycillin–clavulanic acid | R | R | R | R | R | R | R | R | R | R | R | R | R | 100 | 0 | 0 |
Cefotaxime | R | I | I | R | R | R | R | R | I | R | S | R | I | 61.54 | 30.77 | 7.69 |
Colistin | R | R | R | R | R | R | R | R | R | R | S | R | R | 92.31 | * | 7.69 |
Tetracyclines | R | R | R | R | R | R | R | R | R | R | R | R | R | 100 | 0 | 0 |
Doxycycline | S | R | R | R | R | R | R | I | R | R | R | R | R | 84.62 | 7.69 | 7.69 |
Gentamicin | R | S | R | R | S | S | S | R | R | S | S | R | R | 53.85 | 0 | 46.15 |
Neomycin | R | I | R | I | S | R | I | I | R | I | I | R | I | 38.46 | 53.85 | 7.69 |
Spiramycin | R | R | I | R | R | R | I | R | R | R | R | R | R | 84.62 | 15.38 | 0 |
Florfenicol | R | I | R | R | R | R | S | S | R | S | R | R | R | 69.23 | 7.69 | 23.7 |
Ofloxacin | I | S | S | R | I | S | R | R | R | S | S | S | S | 30.77 | 15.38 | 53.85 |
Enrofloxacin | R | S | S | R | R | S | R | R | R | S | S | S | S | 46.15 | 0 | 53.85 |
Ciprofloxacin | R | I | S | R | R | I | R | R | R | S | S | I | R | 53.84 | 23.08 | 23.08 |
Code No. | Location | Total Bird No. | Age (days) | Breed | PM Lesions | Antibiotics during Last 3 days |
---|---|---|---|---|---|---|
1 | Beheira | 2000 | 14 | Balady | Air sacculitis, unabsorbed yolk sac, and precipitation of urates on ureters | Florfenicol |
2 | Beheira | 4000 | 12 | Arbo Acres | Air sacculitis and fibrinous pericarditis and perihepatitis | Tylosin and colistin |
3 | Beheira | 6000 | 11 | Ross | Air sacculitis, pneumonia, fibrinous pericarditis, and perihepatitis and unabsorbed yolk sac | Tylosin and florfenicol |
4 | Beheira | 6000 | 9 | Balady | Unabsorbed yolk sac | Ciprofloxacin and florfenicol |
5 | Beheira | 5000 | 9 | Arbo Acres | Air sacculitis and whitish diarrhea | Sulphadiazine sodium plus trimethoprim and ciprofloxacin |
6 | Beheira | 26,000 | 6 | Cobb | Air sacculitis and unabosorbed yolk sac | Tiamulin and colistin |
7 | Beheira | 6000 | 12 | Ross | Air sacculitis and fibrinous pericarditis and perihepatitis, unabsorbed yolk sac | Ciprofloxacin and colistin |
8 | Beheira | 6000 | 14 | Cobb | Caseated blug at tracheal bifurcation and pneumonia | Florfenicol |
9 | Beheira | 2500 | 12 | Cobb | Ricketts and unabsorbed yolk sac | Florfenicol |
10 | Beheira | 100 | 4 | Cobb | Air sacculitis, fibrinous pericarditis and perihepatitis, unabsorbed yolk sac | Colistin |
11 | Beheira | 9000 | 14 | Cobb | Air sacculitis, septicemia, and unabsorbed | Tilmicosin and colistin |
12 | Beheira | 1000 | 10 | Ross | Unabsorbed yolk sac, air sacculitis | Tilmicosin and colistin |
13 | Beheira | 1000 | 7 | Cobb | Air sacculitis and pneumonia | Cefotaxim injection |
14 | Beheira | 6000 | 6 | Ross | Omphalitis, air sacculitis | Florfenicol |
15 | Beheira | 100 | 7 | Cobb | Pneumonia, air sacculitis, and omphalitis | Colistin |
16 | Beheira | 10,000 | 12 | Cobb | Enteritis and air sacculitis | Tylosin and colistin |
17 | Beheira | 450 | 11 | Cobb | Enteritis and air sacculitis | Colistin and doxy |
18 | Beheira | 1000 | 15 | Hybrid | Precipitation of urates on ureters | Sulphadiazine sodium plus trimethoprim |
19 | Beheira | 5000 | 9 | Ross | Air sacculitis, pneumonia, fibrinous pericarditis and perihepatitis and precipitation of urates on ureters | Sulphadiazine sodium plus trimethoprim |
20 | Beheira | 4000 | 7 | Ross | Air sacculitis and enteritis | Sulphadiazine sodium plus trimethoprim |
21 | Beheira | 10 | Cobb | Enteritis | Sulphadiazine sodium plus trimethoprim | |
22 | Beheira | 2700 | 15 | Ross | Pneumonia and airsacculitis | Florfenicol |
23 | Beheira | 3400 | 14 | Ross | Air sacculitis, fibrinous pericarditis and perihepatitis | Florfenicol |
24 | Beheira | 2000 | 15 | Cobb | Enteritis | Colistin and doxycycline |
25 | Beheira | 1500 | 14 | Ross | Enteritis | Colistin and tylosin |
26 | Beheira | 1000 | 13 | Cobb | Enteritis | Colistin and doxycycline |
27 | Beheira | 4500 | 15 | Cobb | Mycotoxicosis, air sacculitis, fibrinous pericarditis, and perihepatitis | Sulphadiazine sodium plus trimethoprim and cefotaxime |
28 | Alexanderia | 9000 | 15 | Cobb | Lesions of Gumboro disease and enteritis | Florfenicol |
29 | Beheira | 10,000 | 5 | Ross | Enteritis | Florfenicol and tylosin |
30 | Alexanderia | 8000 | 15 | Cobb | Necrotic enteritis | Florfenicol |
31 | Beheira | 7000 | 9 | Ross | Enteritis | Florfenicol |
32 | Beheira | 10,000 | 10 | Cobb | Enteritis | Tylosin and colistin |
33 | Beheira | 10,000 | 15 | Ross | Lesions of NewCastle and omphalitis | Doxycycline and colistin |
34 | Beheira | 1000 | 15 | Cobb | Enteritis | Doxycycline and colistin |
35 | Beheira | 1000 | 14 | Cobb | Air sacculitis | Florfenicol and doxycycline |
36 | Beheira | 2700 | 15 | Ross | NewCastle and Gumboro diseases IBD | Florfenicol |
37 | Beheira | 1000 | 6 | Cobb | Omphalitis, airsacculitis | Colistin and tylosin |
38 | Beheira | 6000 | 15 | Cobb | Air sacculitis, fibrinous pericarditis and perihepatitis | Florfenicol |
39 | Beheira | 5000 | 6 | Arbo Acres | Air sacculitis | Florfenicol and doxycycline |
40 | Beheira | 5000 | 6 | Arbo Acres | Air sacculitis | Ciprofloxacin and florfenicol |
41 | Beheira | 4000 | 3 | Ross | Omphalitis | Doxycycline and colistin |
42 | Beheira | 2000 | 4 | Ross | Omphalitis | Florfenicol |
43 | Beheira | 600 | 13 | Arbo Acres | Pneumonia, air sacculitis, fibrinous pericarditis and perihepatitis | Florfenicol |
44 | Beheira | 4000 | 4 | Ross | Enteritis | Tylosin and colistin |
45 | Beheira | 8500 | 14 | Cobb | Airsacculitis | Doxycycline and colistin |
46 | Beheira | 10 | Arbo Acres | Air sacculitis, fibrinous pericarditis, perihepatitisand omphalitis | Ciprofloxacin and florfenicol | |
47 | Beheira | 9000 | 2 | Arbo Acres | Omphalitis | Florfenicol and doxycycline |
48 | Beheira | 5000 | 3 | Cobb | Pneumonia, air sacculitis, fibrinous pericarditis, and perihepatitis | Tylosin and colistin |
49 | Beheira | 3000 | 6 | Cobb | Air sacculitis, fibrinous pericarditis, perihepatitisand unabsorbed yolk sac | Tylosin and colistin |
50 | Beheira | 5000 | 10 | Cobb | Air sacculitis and omphalitis | Doxycycline and colistin |
51 | Beheira | 1000 | 15 | Arbo Acres | Necrotic enteritis and air sacculitis | Ciprofloxacin and florfenicol |
52 | Beheira | 10,000 | 10 | Cobb | Air sacculitis | Doxycycline and colistin |
53 | Beheira | 1000 | 15 | Cobb | Air sacculitis | Florfenicol |
54 | Beheira | 9000 | 15 | Arbo Acres | Enteritis and slight airsacculitis | Doxycycline and colistin |
Polyvalent Sera | Monovalent Sera | ||||||
---|---|---|---|---|---|---|---|
Polyvalent 1 | O1 | O26 | O86 | O111 | O119 | O127 | O128 |
Polyvalent 2 | O44 | O55 | O125 | O126 | O146 | O166 | |
Polyvalent 3 | O18 | O114 | O142 | O151 | O157 | O158 | |
Polyvalent 4 | O6 | O27 | O78 | O148 | O159 | O168 | |
Polyvalent 5 | O20 | O25 | O63 | O153 | O167 | ||
Polyvalent 6 | O8 | O15 | O115 | O169 | |||
Polyvalent 7 | O28 | O112 | O124 | O136 | O144 | ||
Polyvalent 8 | O29 | O143 | O152 | O164 |
Gene | Primer Sequence (5′-3′) | Amplified Product (bp) | Reference | |
---|---|---|---|---|
Species-specific | phoA | CGATTCTGGAAATGGCAAAAG CGTGATCAGCGGTGACTATGAC | 720 bp | [49] |
Virulence | iss | ATG TTA TTT TCT GCC GCT CTG CTA TTG TGA GCA ATA TAC CC | 266 bp | [50] |
iutA | ATGAGCATATCTCCGGACG CAGGTCGAAGAACATCTGG | 587 bp | [51] | |
fimH | TGCAGAACGGATAAGCCGTGG GCAGTCACCTGCCCTCCGGTA | 508 bp | [52] |
Gene | Initial Denaturation | Denaturation | Annealing | Extension | Number of Cycles | Final Extension | |
---|---|---|---|---|---|---|---|
Species-specific | phoA | 94 °C 5 min | 94 °C 30 s | 58 °C 45 s | 72 °C 45 s | 35 | 72 °C 10 min |
Virulence | Iss | 94 °C 5 min | 94 °C 30 s | 58 °C 45 s | 72 °C 45 s | 35 | 72 °C 10 min |
fimH | 95 °C 2 min | 94 °C 30 s | 58 °C 30 s | 72 °C 1 min | 33 | 72 °C 7 min | |
iutA | 94 °C 3 min | 94 °C 1 min | 55 °C 1 min | 72 °C 30 s | 30 | 72 °C 7 min |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Awad, A.M.; El-Shall, N.A.; Khalil, D.S.; El-Hack, M.E.A.; Swelum, A.A.; Mahmoud, A.H.; Ebaid, H.; Komany, A.; Sammour, R.H.; Sedeik, M.E. Incidence, Pathotyping, and Antibiotic Susceptibility of Avian Pathogenic Escherichia coli among Diseased Broiler Chicks. Pathogens 2020, 9, 114. https://doi.org/10.3390/pathogens9020114
Awad AM, El-Shall NA, Khalil DS, El-Hack MEA, Swelum AA, Mahmoud AH, Ebaid H, Komany A, Sammour RH, Sedeik ME. Incidence, Pathotyping, and Antibiotic Susceptibility of Avian Pathogenic Escherichia coli among Diseased Broiler Chicks. Pathogens. 2020; 9(2):114. https://doi.org/10.3390/pathogens9020114
Chicago/Turabian StyleAwad, Ashraf M., Nahed A. El-Shall, Doha S. Khalil, Mohamed E. Abd El-Hack, Ayman A. Swelum, Ahmed H. Mahmoud, Hossam Ebaid, Ahmed Komany, Reda H. Sammour, and Mahmoud E. Sedeik. 2020. "Incidence, Pathotyping, and Antibiotic Susceptibility of Avian Pathogenic Escherichia coli among Diseased Broiler Chicks" Pathogens 9, no. 2: 114. https://doi.org/10.3390/pathogens9020114
APA StyleAwad, A. M., El-Shall, N. A., Khalil, D. S., El-Hack, M. E. A., Swelum, A. A., Mahmoud, A. H., Ebaid, H., Komany, A., Sammour, R. H., & Sedeik, M. E. (2020). Incidence, Pathotyping, and Antibiotic Susceptibility of Avian Pathogenic Escherichia coli among Diseased Broiler Chicks. Pathogens, 9(2), 114. https://doi.org/10.3390/pathogens9020114