Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018
Abstract
:1. Introduction
2. Results
2.1. Sequence Analysis of The Multidrug Resistance 1 (Pvmdr1) Gene, and The Putative Transporter Protein (Pvcrt-o) Gene
2.2. Sequence Analysis of The Dihydrofolate Reductase (Pvdhfr) Gene
2.3. Sequence Analysis of The Dihydropteroate Synthetase (Pvdhps) Gene
2.4. The Prevalence of Tandem Repeat Variants in the Dihydrofolate Reductase (Pvdhfr) Gene
3. Discussion
4. Materials and Methods
4.1. Ethics Statement and Sample Collection
4.2. Sequencing of The Multidrug Resistance 1(Pvmdr1) Gene, The Putative Transporter Protein (Pvcrt-o) Gene, The Dihydrofolate Reductase (Pvdhfr) Gene and The Dihydropteroate Synthetase (Pvdhps) Gene
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Ethical Statement
References
- Knope, K.E.; Muller, M.; Kurucz, N.; Doggett, S.L.; Feldman, R.; Johansen, C.A.; Hobby, M. 2013–2014: Annual Report of the National Arbovirus and Malaria Advisory Committee. Commun. Dis. Intell. 2016, 40, E401–E436. [Google Scholar]
- Tatem, A.J.; Jia, P.; Ordanovich, D.; Falkner, M.; Huang, Z.; Howes, R.; Hay, S.I.; Gething, P.W.; Smith, D.L. The geography of imported malaria to non-endemic countries: A meta-analysis of nationally reported statistics. Lancet Infect. Dis. 2017, 17, 98–107. [Google Scholar] [CrossRef] [Green Version]
- Lu, F.; Lim, C.S.; Nam, D.-H.; Kim, K.; Lin, K.; Kim, T.-S.; Lee, H.-W.; Chen, J.-H.; Wang, Y.; Sattabongkot, J. Genetic polymorphism in pvmdr1 and pvcrt-o genes in relation to in vitro drug susceptibility of Plasmodium vivax isolates from malaria-endemic countries. Acta Trop. 2011, 117, 69–75. [Google Scholar] [CrossRef]
- Mint Lekweiry, K.; Ould Mohamed Salem Boukhary, A.; Gaillard, T.; Wurtz, N.; Bogreau, H.; Hafid, J.E.; Trape, J.-F.; Bouchiba, H.; Ould Ahmedou Salem, M.S.; Pradines, B. Molecular surveillance of drug-resistant Plasmodium vivax using pvdhfr, pvdhps and pvmdr1 markers in Nouakchott, Mauritania. J. Antimicrob. Chemother. 2011, 67, 367–374. [Google Scholar] [CrossRef] [Green Version]
- Nyunt, M.H.; Han, J.-H.; Wang, B.; Aye, K.M.; Aye, K.H.; Lee, S.-K.; Htut, Y.; Kyaw, M.P.; Han, K.T.; Han, E.-T. Clinical and molecular surveillance of drug resistant vivax malaria in Myanmar (2009–2016). Malar. J. 2017, 16, 117. [Google Scholar] [CrossRef] [Green Version]
- Rungsihirunrat, K.; Muhamad, P.; Chaijaroenkul, W.; Kuesap, J.; Na-Bangchang, K. Plasmodium vivax drug resistance genes; Pvmdr1 and Pvcrt-o polymorphisms in relation to chloroquine sensitivity from a malaria endemic area of Thailand. Korean J. Parasitol. 2015, 53, 43. [Google Scholar] [CrossRef]
- Tantiamornkul, K.; Pumpaibool, T.; Piriyapongsa, J.; Culleton, R.; Lek-Uthai, U. The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014. Int. J. Parasitol. Drugs Drug Resist. 2018, 8, 229–237. [Google Scholar] [CrossRef]
- Rieckmann, K.; Davis, D.; Hutton, D. Plasmodium vivax resistance to chloroquine? Lancet 1989, 334, 1183–1184. [Google Scholar] [CrossRef]
- Lu, F.; Wang, B.; Cao, J.; Sattabongkot, J.; Zhou, H.; Zhu, G.; Kim, K.; Gao, Q.; Han, E.-T. Prevalence of drug resistance-associated gene mutations in Plasmodium vivax in Central China. Korean J. Parasitol. 2012, 50, 379. [Google Scholar] [CrossRef]
- Price, R.N.; Auburn, S.; Marfurt, J.; Cheng, Q. Phenotypic and genotypic characterisation of drug-resistant Plasmodium vivax. Trends Parasitol. 2012, 28, 522–529. [Google Scholar] [CrossRef] [Green Version]
- Parija, S.; Praharaj, I. Drug resistance in malaria. Indian J. Med. Microbiol. 2011, 29, 243. [Google Scholar] [CrossRef]
- Nomura, T.; Carlton, J.M.; Baird, J.K.; Del Portillo, H.A.; Fryauff, D.J.; Rathore, D.; Fidock, D.A.; Su, X.-Z.; Collins, W.E.; McCutchan, T.F. Evidence for different mechanisms of chloroquine resistance in 2 Plasmodium species that cause human malaria. J. Infect. Dis. 2001, 183, 1653–1661. [Google Scholar] [CrossRef] [Green Version]
- Wirjanata, G.; Handayuni, I.; Prayoga, P.; Leonardo, L.; Apriyanti, D.; Trianty, L.; Wandosa, R.; Gobay, B.; Kenangalem, E.; Poespoprodjo, J.R. Plasmodium falciparum and Plasmodium vivax demonstrate contrasting chloroquine resistance reversal phenotypes. Antimicrob. Agents Chemother. 2017, 61, e00355-17. [Google Scholar] [CrossRef] [Green Version]
- World Health Organization. Control and Elimination of Plasmodium Vivax Malaria: A Technical Brief; World Health Organization: Geneva, Switzerland, 2015. [Google Scholar]
- World Health Organization. Global Report on Antimalarial Drug Efficacy and Drug Resistance; World Health Organization: Geneva, Switzerland, 2010. [Google Scholar]
- Suwanarusk, R.; Russell, B.; Chavchich, M.; Chalfein, F.; Kenangalem, E.; Kosaisavee, V.; Prasetyorini, B.; Piera, K.A.; Barends, M.; Brockman, A. Chloroquine resistant Plasmodium vivax: In vitro characterisation and association with molecular polymorphisms. PLoS ONE 2007, 2, e1089. [Google Scholar] [CrossRef]
- Suwanarusk, R.; Chavchich, M.; Russell, B.; Jaidee, A.; Chalfein, F.; Barends, M.; Prasetyorini, B.; Kenangalem, E.; Piera, K.; Lek-Uthai, U. Amplification of pvmdr1 associated with multidrug-resistant Plasmodium vivax. J. Infect. Dis. 2008, 198, 1558–1564. [Google Scholar] [CrossRef] [Green Version]
- Brega, S.; Meslin, B.; De Monbrison, F.; Severini, C.; Gradoni, L.; Udomsangpetch, R.; Sutanto, I.; Peyron, F.; Picot, S. Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity. J. Infect. Dis. 2005, 191, 272–277. [Google Scholar] [CrossRef] [Green Version]
- Ganguly, S.; Saha, P.; Guha, S.K.; Das, S.; Bera, D.K.; Biswas, A.; Kundu, P.K.; Saha, B.; Ray, K.; Maji, A.K. In vivo therapeutic efficacy of chloroquine alone or in combination with primaquine against vivax malaria in Kolkata, West Bengal, India, and polymorphism in pvmdr1 and pvcrt-o genes. Antimicrob. Agents Chemother. 2013, 57, 1246–1251. [Google Scholar] [CrossRef] [Green Version]
- Imwong, M.; Pukrittayakamee, S.; Rénia, L.; Letourneur, F.; Charlieu, J.-P.; Leartsakulpanich, U.; Looareesuwan, S.; White, N.J.; Snounou, G. Novel point mutations in the dihydrofolate reductase gene of Plasmodium vivax: Evidence for sequential selection by drug pressure. Antimicrob. Agents Chemother. 2003, 47, 1514–1521. [Google Scholar] [CrossRef] [Green Version]
- World Health Organization. World Malaria Report 2019; World Health Organization: Geneva, Switzerland, 2019. [Google Scholar]
- Leslie, T.; Mayan, M.I.; Hasan, M.A.; Safi, M.H.; Klinkenberg, E.; Whitty, C.J.; Rowland, M. Sulfadoxine-pyrimethamine, chlorproguanil-dapsone, or chloroquine for the treatment of Plasmodium vivax malaria in Afghanistan and Pakistan: A randomized controlled trial. JAMA 2007, 297, 2201–2209. [Google Scholar] [CrossRef] [Green Version]
- Rungsihirunrat, K.; Sibley, C.H.; Mungthin, M.; Na-Bangchang, K. Geographical distribution of amino acid mutations in Plasmodium vivax DHFR and DHPS from malaria endemic areas of Thailand. Am. J. Trop. Med. Hyg. 2008, 78, 462–467. [Google Scholar] [CrossRef]
- Auliff, A.; Sibley, C.H.; Mungthin, M.; Na-Bangchang, K. Amino acid mutations in Plasmodium vivax DHFR and DHPS from several geographical regions and susceptibility to antifolate drugs. Am. J. Trop. Med. Hyg. 2006, 75, 617–621. [Google Scholar] [CrossRef]
- Ding, S.; Ye, R.; Zhang, D.; Sun, X.; Zhou, H.; McCutchan, T.F.; Pan, W. Anti-folate combination therapies and their effect on the development of drug resistance in Plasmodium vivax. Sci. Rep. 2013, 3, 1008. [Google Scholar] [CrossRef]
- Lu, F.; Lim, C.S.; Nam, D.H.; Kim, K.; Lin, K.; Kim, T.-S.; Lee, H.-W.; Chen, J.-H.; Wang, Y.; Sattabongkot, J. Mutations in the antifolate-resistance-associated genes dihydrofolate reductase and dihydropteroate synthase in Plasmodium vivax isolates from malaria-endemic countries. Am. J. Trop. Med. Hyg. 2010, 83, 474–479. [Google Scholar] [CrossRef] [Green Version]
- de Pécoulas, P.E.; Basco, L.K.; Tahar, R.; Ouatas, T.; Mazabraud, A. Analysis of the Plasmodium vivax dihydrofolate reductase–thymidylate synthase gene sequence. Gene 1998, 211, 177–185. [Google Scholar] [CrossRef]
- Russell, B.M.; Udomsangpetch, R.; Rieckmann, K.H.; Kotecka, B.M.; Coleman, R.E.; Sattabongkot, J. Simple in vitro assay for determining the sensitivity of Plasmodium vivax isolates from fresh human blood to antimalarials in areas where vivax is endemic. Antimicrob. Agents Chemother. 2003, 47, 170–173. [Google Scholar] [CrossRef] [Green Version]
- Singh, G.; Singh, R.; Urhehar, A.D. Simple molecular methods for early detection of chloroquine drug resistance in Plasmodium vivax and Plasmodium falciparum. J. Clin. Diagn. Res. JCDR 2016, 10, DC19. [Google Scholar] [CrossRef]
- Marfurt, J.; de Monbrison, F.; Brega, S.; Barbollat, L.; Müller, I.; Sie, A.; Goroti, M.; Reeder, J.C.; Beck, H.-P.; Picot, S. Molecular markers of in vivo Plasmodium vivax resistance to amodiaquine plus sulfadoxine-pyrimethamine: Mutations in pvdhfr and pvmdr1. J. Infect. Dis. 2008, 198, 409–417. [Google Scholar] [CrossRef] [Green Version]
- Barnadas, C.; Kent, D.; Timinao, L.; Iga, J.; Gray, L.R.; Siba, P.; Mueller, I.; Thomas, P.J.; Zimmerman, P.A. A new high-throughput method for simultaneous detection of drug resistance associated mutations in Plasmodium vivax dhfr, dhps and mdr1 genes. Malar. J. 2011, 10, 282. [Google Scholar] [CrossRef] [Green Version]
- Barnadas, C.; Timinao, L.; Javati, S.; Iga, J.; Malau, E.; Koepfli, C.; Robinson, L.J.; Senn, N.; Kiniboro, B.; Rare, L. Significant geographical differences in prevalence of mutations associated with Plasmodium falciparum and Plasmodium vivax drug resistance in two regions from Papua New Guinea. Malar. J. 2015, 14, 399. [Google Scholar] [CrossRef] [Green Version]
- Chuang, I.; Richie, T.L. World Malaria Report 2010: Documenting progress towards malaria eradication. Expert Rev. Vaccines 2012, 11, 39–41. [Google Scholar] [CrossRef]
- Joy, S.; Mukhi, B.; Ghosh, S.K.; Achur, R.N.; Gowda, D.C.; Surolia, N. Drug resistance genes: Pvcrt-o and pvmdr-1 polymorphism in patients from malaria endemic South Western Coastal Region of India. Malar. J. 2018, 17, 40. [Google Scholar] [CrossRef] [Green Version]
- Khattak, A.A.; Venkatesan, M.; Khatoon, L.; Ouattara, A.; Kenefic, L.J.; Nadeem, M.F.; Nighat, F.; Malik, S.A.; Plowe, C.V. Prevalence and patterns of antifolate and chloroquine drug resistance markers in Plasmodium vivax across Pakistan. Malar. J. 2013, 12, 310. [Google Scholar] [CrossRef] [Green Version]
- Orjuela-Sánchez, P.; de Santana Filho, F.S.; Machado-Lima, A.; Chehuan, Y.F.; Costa, M.R.F.; Alecrim, M.d.G.C.; del Portillo, H.A. Analysis of single-nucleotide polymorphisms in the crt-o and mdr1 genes of Plasmodium vivax among chloroquine-resistant isolates from the Brazilian Amazon region. Antimicrob. Agents Chemother. 2009, 53, 3561–3564. [Google Scholar] [CrossRef] [Green Version]
- Imwong, M.; Pukrittayakamee, S.; Pongtavornpinyo, W.; Nakeesathit, S.; Nair, S.; Newton, P.; Nosten, F.; Anderson, T.J.; Dondorp, A. Gene amplification of the multidrug resistance 1 gene of Plasmodium vivax isolates from Thailand, Laos, and Myanmar. Antimicrob. Agents Chemother. 2008, 52, 2657–2659. [Google Scholar] [CrossRef] [Green Version]
- Waheed, A.A.; Ghanchi, N.K.; Rehman, K.A.; Raza, A.; Mahmood, S.F.; Beg, M.A. Vivax malaria and chloroquine resistance: A neglected disease as an emerging threat. Malar. J. 2015, 14, 146. [Google Scholar] [CrossRef] [Green Version]
- World Health Organization. World Malaria Report 2018; World Health Organization: Geneva, Switzerland, 2018. [Google Scholar]
- Rijken, M.J.; Boel, M.E.; Russell, B.; Imwong, M.; Leimanis, M.L.; Phyo, A.P.; Muehlenbachs, A.; Lindegardh, N.; McGready, R.; Rénia, L. Chloroquine resistant vivax malaria in a pregnant woman on the western border of Thailand. Malar. J. 2011, 10, 113. [Google Scholar] [CrossRef]
- Anantabotla, V.; Antony, H.A.; Parija, S.C.; Rajkumari, N.; Kini, J.R.; Manipura, R.; Nag, V.L.; Gadepalli, R.; Chayani, N.; Patro, S. Polymorphisms in genes associated with drug resistance of Plasmodium vivax in India. Parasitol. Int. 2019, 70, 92–97. [Google Scholar] [CrossRef]
- Noisang, C.; Prosser, C.; Meyer, W.; Chemoh, W.; Ellis, J.; Sawangjaroen, N.; Lee, R. Molecular detection of drug resistant malaria in Southern Thailand. Malar. J. 2019, 18, 275. [Google Scholar] [CrossRef] [Green Version]
- Sá, J.M.; Kaslow, S.R.; Barros, R.R.M.; Brazeau, N.F.; Parobek, C.M.; Tao, D.; Salzman, R.E.; Gibson, T.J.; Velmurugan, S.; Krause, M.A. Plasmodium vivax chloroquine resistance links to pvcrt transcription in a genetic cross. Nat. Commun. 2019, 10, 4300. [Google Scholar] [CrossRef]
- Garg, M.; Gopinathan, N.; Bodhe, P.; Kshirsagar, N. Vivax malaria resistant to chloroquine: Case reports from Bombay. Trans. R. Soc. Trop. Med. Hyg. 1995, 89, 656–657. [Google Scholar] [CrossRef]
- Golassa, L.; Erko, B.; Baliraine, F.N.; Aseffa, A.; Swedberg, G. Polymorphisms in chloroquine resistance-associated genes in Plasmodium vivax in Ethiopia. Malar. J. 2015, 14, 164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Health Organization. Guidelines for the Treatment of Malaria; World Health Organization: Geneva, Switzerland, 2015. [Google Scholar]
- Hawkins, V.N.; Joshi, H.; Rungsihirunrat, K.; Na-Bangchang, K.; Sibley, C.H. Antifolates can have a role in the treatment of Plasmodium vivax. Trends Parasitol. 2007, 23, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Hastings, M.D.; Maguire, J.D.; Bangs, M.J.; Zimmerman, P.A.; Reeder, J.C.; Baird, J.K.; Sibley, C.H. Novel Plasmodium vivax dhfr alleles from the Indonesian Archipelago and Papua New Guinea: Association with pyrimethamine resistance determined by a Saccharomyces cerevisiae expression system. Antimicrob. Agents Chemother. 2005, 49, 733–740. [Google Scholar] [CrossRef] [Green Version]
- Hastings, M.D.; Porter, K.M.; Maguire, J.D.; Susanti, I.; Kania, W.; Bangs, M.J.; Sibley, C.H.; Baird, J.K. Dihydrofolate reductase mutations in Plasmodium vivax from Indonesia and therapeutic response to sulfadoxine plus pyrimethamine. J. Infect. Dis. 2004, 189, 744–750. [Google Scholar] [CrossRef] [Green Version]
- Barnadas, C.; Koepfli, C.; Karunajeewa, H.A.; Siba, P.M.; Davis, T.M.; Mueller, I. Characterization of treatment failure in efficacy trials of drugs against Plasmodium vivax by genotyping neutral and drug resistance-associated markers. Antimicrob. Agents Chemother. 2011, 55, 4479–4481. [Google Scholar] [CrossRef] [Green Version]
- Prajapati, S.K.; Joshi, H.; Dev, V.; Dua, V.K. Molecular epidemiology of Plasmodium vivax anti-folate resistance in India. Malar. J. 2011, 10, 102. [Google Scholar] [CrossRef] [Green Version]
- Asih, P.B.; Marantina, S.S.; Nababan, R.; Lobo, N.F.; Rozi, I.E.; Sumarto, W.; Dewi, R.M.; Tuti, S.; Taufik, A.S.; Sauerwein, R.W. Distribution of Plasmodium vivax pvdhfr and pvdhps alleles and their association with sulfadoxine–pyrimethamine treatment outcomes in Indonesia. Malar. J. 2015, 14, 365. [Google Scholar] [CrossRef] [Green Version]
- Marfurt, J.; Müeller, I.; Sie, A.; Maku, P.; Goroti, M.; Reeder, J.C.; Beck, H.-P.; Genton, B. Low efficacy of amodiaquine or chloroquine plus sulfadoxine-pyrimethamine against Plasmodium falciparum and vivax malaria in Papua New Guinea. Am. J. Trop. Med. Hyg. 2007, 77, 947–954. [Google Scholar] [CrossRef]
- Brega, S.; De Monbrison, F.; Severini, C.; Udomsangpetch, R.; Sutanto, I.; Ruckert, P.; Peyron, F.; Picot, S. Real-time PCR for dihydrofolate reductase gene single-nucleotide polymorphisms in Plasmodium vivax isolates. Antimicrob. Agents Chemother. 2004, 48, 2581–2587. [Google Scholar] [CrossRef] [Green Version]
- Das, S.; Banik, A.; Hati, A.K.; Roy, S. Low prevalence of dihydro folate reductase (dhfr) and dihydropteroate synthase (dhps) quadruple and quintuple mutant alleles associated with SP resistance in Plasmodium vivax isolates of West Bengal, India. Malar. J. 2016, 15, 395. [Google Scholar] [CrossRef] [Green Version]
- Yaqoob, A.; Khattak, A.A.; Nadeem, M.F.; Fatima, H.; Mbambo, G.; Ouattara, A.; Adams, M.; Zeeshan, N.; Takala-Harrison, S. Prevalence of molecular markers of sulfadoxine–pyrimethamine and artemisinin resistance in Plasmodium falciparum from Pakistan. Malar. J. 2018, 17, 471. [Google Scholar] [CrossRef] [PubMed]
- de Pécoulas, P.E.; Tahar, R.; Ouatas, T.; Mazabraud, A.; Basco, L.K. Sequence variations in the Plasmodium vivax dihydrofolate reductase-thymidylate synthase gene and their relationship with pyrimethamine resistance. Mol. Biochem. Parasitol. 1998, 92, 265–273. [Google Scholar] [CrossRef]
- Huang, B.; Huang, S.; Su, X.-Z.; Tong, X.; Yan, J.; Li, H.; Lu, F. Molecular surveillance of pvdhfr, pvdhps, and pvmdr-1 mutations in Plasmodium vivax isolates from Yunnan and Anhui provinces of China. Malar. J. 2014, 13, 346. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gresty, K.J.; Gray, K.-A.; Bobogare, A.; Wini, L.; Taleo, G.; Hii, J.; Cheng, Q.; Waters, N.C. Genetic mutations in Plasmodium falciparum and Plasmodium vivax dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) in Vanuatu and Solomon Islands prior to the introduction of artemisinin combination therapy. Malar. J. 2014, 13, 402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imwong, M.; Pukrittayakamee, S.; Cheng, Q.; Moore, C.; Looareesuwan, S.; Snounou, G.; White, N.J.; Day, N.P. Limited polymorphism in the dihydropteroate synthetase gene (dhps) of Plasmodium vivax isolates from Thailand. Antimicrob. Agents Chemother. 2005, 49, 4393–4395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Snounou, G.; Viriyakosol, S.; Jarra, W.; Thaithong, S.; Brown, K.N. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol. Biochem. Parasitol. 1993, 58, 283–292. [Google Scholar] [CrossRef]
- Carlton, J.M.; Adams, J.H.; Silva, J.C.; Bidwell, S.L.; Lorenzi, H.; Caler, E.; Crabtree, J.; Angiuoli, S.V.; Merino, E.F.; Amedeo, P. Comparative genomics of the neglected human malaria parasite Plasmodium vivax. Nature 2008, 455, 757–763. [Google Scholar] [CrossRef]
Gender | Age | Total Number | ||||||
---|---|---|---|---|---|---|---|---|
≥10 | 11–20 | 21–30 | 31–40 | 41–50 | 51–60 | 61≤ | ||
Male | 1 | 9 | 27 | 17 | 7 | 12 | 15 | 88 |
Female | 2 | 0 | 7 | 1 | 1 | 5 | 7 | 23 |
Unknown | 0 | 0 | 2 | 0 | 1 | 1 | 5 | 9 |
Genotype | Mutations | Regions | Total (N = 120) | ||
---|---|---|---|---|---|
SA | SEA | Oceania | |||
n = 73 | n = 10 | n = 37 | |||
Pvmdr1 | |||||
Wildtype | 9 (12%) | 0 | 0 | 9 (7.5%) | |
Y976:F1076 | |||||
Single Mutation | 7 (9.5%) | 0 | 0 | 7 (5.8%) | |
F976 | |||||
Single Mutation | 50 (68%) | 5 (50%) | 8 (21.6%) | 63 (52.5%) | |
L1076 | |||||
Double Mutations | 2 (2.5%) | 5 (50%) | 23 (62%) | 30 (25%) | |
F976:L1076 | |||||
Pvcrt-o | |||||
Wildtype | 49 (67%) | 6 (60%) | 22 (59%) | 77 (64%) | |
K10 Insertion | 9 (12%) | 2 (20%) | 0 | 11 (9%) |
Genotype | Mutations | Regions | Total (N = 120) | ||
---|---|---|---|---|---|
SA | SEA | Oceania | |||
n = 73 | n = 10 | n = 37 | |||
Pvdhfr | |||||
Wildtype | 43 (59%) | 3 (30%) | 7 (19%) | 53 (44%) | |
F57:S58:T61:S117:I173 | |||||
Single Mutation | 3 (4%) | 1 (10%) | 1 (10%) | 5 (4%) | |
N117 | |||||
Double Mutations | 18 (24.5%) | 2 (20%) | 1 (2.7%) | 21 (17.5%) | |
R58:N117 | |||||
Double Mutations | 1 (1%) | 0 | 5 (13.5%) | 6 (5%) | |
L57:R58 | |||||
Quadruple Mutations | 2 (2.5%) | 4 (40%) | 21 (56.7%) | 27 (22.5%) | |
L/I57:R58:M61:T117 | |||||
Pvdhps | |||||
Wildtype | 62 (84.9%) | 5 (50%) | 35 (94.5%) | 102 (85%) | |
S382:A383:K512:A553:V585 | |||||
Single Mutation | 2 (2.7%) | 1 (10%) | 0 | 3 (2.5%) | |
G383 | |||||
Single Mutation | 1 (1%) | 1 (10%) | 0 | 2 (1.6%) | |
G553 | |||||
Double Mutations | 6 (8%) | 2 (20%) | 1 (2.7%) | 9 (7.5%) | |
G383:G553 |
Countries | Pvdhfr gene | ||
---|---|---|---|
Type 1 | Type 2 | Type 3 | |
SA (n = 73) | 55 (75%) | 9 (12%) | 4 (5%) |
SEA (n = 10) | 6 (60%) | 3 (30%) | 1 (10%) |
Oceania (n = 37) | 16 (43%) | - | 19 (51%) |
Total (N = 120) | 77 (64%) | 12 (10%) | 24 (20%) |
Name | Sequences 5’–3’ | Gene Targets | Product Size | Tm. (°C) | References |
---|---|---|---|---|---|
Pvdhfr (outer) F Pvdhfr (outer) R | CACCGCACCAGTTGATTCCT CCTCGGCGTTGTTCTTCT | Pvdhfr | 979 | 67.3 63.0 | [25] |
Pvdhfr (nested) F Pvdhfr (nested) R | CCCCACCACATAACGAAG CCCCACCTTGCTGTAAACC | Pvdhfr | 755 | 61.5 64.2 | [25] |
Pvdhps (outer) F Pvdhps (outer) R | GATGGCGGTTTATTTGTCG GCTGATCTTTGTCTTGACG | Pvdhps | 1009 | 62.8 58.5 | [25] |
Pvdhps (nested) F Pvdhps (nested) R | GCTGTGGAGAGGATGTTC CCGCTCATCAGTCTGCAC | Pvdhps | 731 | 58.2 63.5 | [25] |
Pvcrt-o F Pvcrt-o R | CAGTGAGAAGCCCCTGTTCG CCGCTCATCAGTCTGCAC | Pvcrt-o | 750 | 67.2 68.5 | * |
Pvmdr F Pvmdr R | GCGAACTCGAATAAGTACTCCCTCTA GGCGTAGCTTCC CGTAAATAAA | Pvmdr1 | 762 | 65.4 64.8 | [4] |
Genes | Nucleotide Position | Nucleotide Change | Amino Acid Position | Amino Acid Change |
---|---|---|---|---|
Pvmdr1 | 2928–2930 | TAC -> TTC | 976 | (Y) Tyrosine -> (F) Phenylalanine |
(g.2929A>T) | (Y976F) | |||
3228–3230 | TTT -> CTT | 1076 | (F) Phenylalanine -> (L) Leucine | |
(g.3228T>C) | (F1076L) | |||
Pvcrt-o | 30 | AAG | 10 | (K) Lysine (Insertion) |
(g.30_31insAAG) | (K10 insertion) |
Genes | Nucleotide Position | Nucleotide Change | Amino acid Position | Amino Acid Change |
---|---|---|---|---|
Pvdhfr | 171–173 | TTC -> TTG, TTA, CTC | 57 | (F) Phenylalanine -> (L) Leucine |
(g.173C>G, g.173C>G, g.173C>A, g.171T>C) | (F57L) | |||
171–173 | TTC -> ATA | 57 | (F) Phenylalanine -> (I) Isoleucine | |
(g.171T>A and 173C>A) | (F57B) | |||
172–174 | AGC -> AGG, AGA | 58 | (S) Serine -> (R) Arginine | |
(g.174C>G, g.174C>G) | (S58R) | |||
183–185 | ACG ->ATG | 61 | (T) Threonine -> (M) Methionine | |
(g.184C>T) | (T61M) | |||
351–353 | AGC -> ACC | 117 | (S) Serine -> (T) Threonine | |
(g.352G>C) | (S117M) | |||
351–353 | AGC -> AAC | 117 | (S) Serine -> (N) Asparagine | |
(g.352G>A) | (S117N) | |||
Pvdhps | 1149–1151 | GCC -> GGC | 383 | (A) Alanine -> (G) Glycine |
(g.1150C>G) | (A383G) | |||
1659–1661 | GCC -> GGC | 553 | (A) Alanine -> (G) Glycine | |
(g.1660C>G) | (A553G) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Noisang, C.; Meyer, W.; Sawangjaroen, N.; Ellis, J.; Lee, R. Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018. Pathogens 2020, 9, 101. https://doi.org/10.3390/pathogens9020101
Noisang C, Meyer W, Sawangjaroen N, Ellis J, Lee R. Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018. Pathogens. 2020; 9(2):101. https://doi.org/10.3390/pathogens9020101
Chicago/Turabian StyleNoisang, Chaturong, Wieland Meyer, Nongyao Sawangjaroen, John Ellis, and Rogan Lee. 2020. "Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018" Pathogens 9, no. 2: 101. https://doi.org/10.3390/pathogens9020101
APA StyleNoisang, C., Meyer, W., Sawangjaroen, N., Ellis, J., & Lee, R. (2020). Molecular Detection of Antimalarial Drug Resistance in Plasmodium vivax from Returned Travellers to NSW, Australia during 2008–2018. Pathogens, 9(2), 101. https://doi.org/10.3390/pathogens9020101