Probiotics Modulate Tilapia Resistance and Immune Response against Tilapia Lake Virus Infection
Abstract
1. Introduction
2. Results
2.1. Bacillus spp. Probiotics Improve Tilapia Survival against TiLV Infection
2.2. Differential Viral Load Assessment
2.3. Differential Modulation of Antiviral Response Markers during TiLV Infection
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Experimental Fish Source and Use
5.2. Experimental Diet and Feeding
5.3. TiLV Source
5.4. TiLV Infection Challenge
5.5. Growth Performances
- WG = [final body weight (g) − initial body weight(g)] ÷ initial body weight(g)
- Feed efficiency (FE) = [weight gain(g) ÷ amount of ingested feed (g)]
- FCR = feed intake ÷ weight gain
- ADG (g) = weight gain ÷ number of days on feed
5.6. Total RNA Extraction and cDNA Synthesis
5.7. Viral Load Quantification
5.8. Gene Expression Analysis by RT-qPCR
5.9. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2020; FAO: Rome, Italy, 2020. [Google Scholar]
- FAO. FAO Global Fishery and Aquaculture Production Statistics (FishStatJ). Available online: www.fao.org/fishery/statistics/software/fishstatj/en (accessed on 6 November 2020).
- Abdel-Latif, H.M.R.; Dawood, M.A.O.; Menanteau-Ledouble, S.; El-Matbouli, M. The nature and consequences of co-infections in tilapia: A review. J. Fish Dis. 2020, 43, 651–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- FAO. Tilapia Lake Virus Expert Knowledge Elicitation Risk Assessment. Available online: http://www.fao.org/3/CA2864EN/ca2864en.pdf (accessed on 2 September 2020).
- OIE. Tilapia Lake Virus Disease (TiLV). Available online: www.oie.int/fileadmin/Home/eng/Internationa_Standard_Setting/docs/pdf/Aquatic_Commission/A_TiLV_disease_card.pdf (accessed on 6 November 2020).
- Bacharach, E.; Mishra, N.; Briese, T.; Zody, M.C.; Kembou Tsofack, J.E.; Zamostiano, R.; Berkowitz, A.; Ng, J.; Nitido, A.; Corvelo, A.; et al. Characterization of a Novel Orthomyxo-like Virus Causing Mass Die-Offs of Tilapia. mBio 2016, 7, e00431-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Surachetpong, W.; Janetanakit, T.; Nonthabenjawan, N.; Tattiyapong, P.; Sirikanchana, K.; Amonsin, A. Outbreaks of Tilapia Lake Virus Infection, Thailand, 2015–2016. Emerg. Infect. Dis. 2017, 23, 1031–1033. [Google Scholar] [CrossRef] [Scilit]
- ICTV. International Committee on Taxonomy of Viruses. In Virus Taxonomy; 2018; Available online: https://talk.ictvonline.org/ (accessed on 6 November 2020).
- Jansen, M.D.; Dong, H.T.; Mohan, C.V. Tilapia lake virus: A threat to the global tilapia industry? Rev. Aquac. 2019, 11, 725–739. [Google Scholar] [CrossRef] [Scilit]
- Surachetpong, W.; Roy, S.R.K.; Nicholson, P. Tilapia lake virus: The story so far. J. Fish Dis. 2020, 43, 1115–1132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Behera, B.K.; Pradhan, P.K.; Swaminathan, T.R.; Sood, N.; Paria, P.; Das, A.; Verma, D.K.; Kumar, R.; Yadav, M.K.; Dev, A.K.; et al. Emergence of Tilapia Lake Virus associated with mortalities of farmed Nile Tilapia Oreochromis niloticus (Linnaeus 1758) in India. Aquaculture 2018, 484, 168–174. [Google Scholar] [CrossRef] [Scilit]
- Nicholson, P.; Mon-on, N.; Jaemwimol, P.; Tattiyapong, P.; Surachetpong, W. Coinfection of tilapia lake virus and Aeromonas hydrophila synergistically increased mortality and worsened the disease severity in tilapia (Oreochromis spp.). Aquaculture 2020, 520, 734746. [Google Scholar] [CrossRef] [Scilit]
- Eyngor, M.; Zamostiano, R.; Kembou Tsofack, J.E.; Berkowitz, A.; Bercovier, H.; Tinman, S.; Lev, M.; Hurvitz, A.; Galeotti, M.; Bacharach, E.; et al. Identification of a novel RNA virus lethal to tilapia. J. Clin. Microbiol. 2014, 52, 4137–4146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamkasem, J.; Tattiyapong, P.; Kamlangdee, A.; Surachetpong, W. Evidence of potential vertical transmission of tilapia lake virus. J. Fish Dis. 2019, 42, 1293–1300. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.T.; Senapin, S.; Gangnonngiw, W.; Nguyen, V.V.; Rodkhum, C.; Debnath, P.P.; Delamare-Deboutteville, J.; Mohan, C.V. Experimental infection reveals transmission of tilapia lake virus (TiLV) from tilapia broodstock to their reproductive organs and fertilized eggs. Aquaculture 2020, 515, 734541. [Google Scholar] [CrossRef] [Scilit]
- Irianto, A.; Austin, B. Probiotics in aquaculture. J. Fish Dis. 2002, 25, 633–642. [Google Scholar] [CrossRef] [Scilit]
- Vine, N.G.; Leukes, W.D.; Kaiser, H. Probiotics in marine larviculture. FEMS Microbiol. Rev. 2006, 30, 404–427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burr, G.; Gatlin Iii, D.; Ricke, S. Microbial Ecology of the Gastrointestinal Tract of Fish and the Potential Application of Prebiotics and Probiotics in Finfish Aquaculture. J. World Aquac. Soc. 2005, 36, 425–436. [Google Scholar] [CrossRef] [Scilit]
- Aly, S.M.; Mohamed, M.F.; John, G. Effect of probiotics on the survival, growth and challenge infection in Tilapia nilotica (Oreochromis niloticus). Aquac. Res. 2008, 39, 647–656. [Google Scholar] [CrossRef] [Scilit]
- Gobi, N.; Malaikozhundan, B.; Sekar, V.; Shanthi, S.; Vaseeharan, B.; Jayakumar, R.; Khudus Nazar, A. GFP tagged Vibrio parahaemolyticus Dahv2 infection and the protective effects of the probiotic Bacillus licheniformis Dahb1 on the growth, immune and antioxidant responses in Pangasius hypophthalmus. Fish Shellfish Immunol. 2016, 52, 230–238. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Tian, Z.; Wang, Y.; Li, W. Effect of treatment with probiotics as water additives on tilapia (Oreochromis niloticus) growth performance and immune response. Fish Physiol. Biochem. 2010, 36, 501–509. [Google Scholar] [CrossRef] [Scilit]
- Ramesh, D.; Souissi, S. Effects of potential probiotic Bacillus subtilis KADR1 and its subcellular components on immune responses and disease resistance in Labeo rohita. Aquac. Res. 2018, 49, 367–377. [Google Scholar] [CrossRef] [Scilit]
- Salinas, I.; Abelli, L.; Bertoni, F.; Picchietti, S.; Roque, A.; Furones, D.; Cuesta, A.; Meseguer, J.; Esteban, M.A. Monospecies and multispecies probiotic formulations produce different systemic and local immunostimulatory effects in the gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 2008, 25, 114–123. [Google Scholar] [CrossRef] [Scilit]
- Abarike, E.D.; Cai, J.; Lu, Y.; Yu, H.; Chen, L.; Jian, J.; Tang, J.; Jun, L.; Kuebutornye, F.K.A. Effects of a commercial probiotic BS containing Bacillus subtilis and Bacillus licheniformis on growth, immune response and disease resistance in Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2018, 82, 229–238. [Google Scholar] [CrossRef] [Scilit]
- Srisapoome, P.; Areechon, N. Efficacy of viable Bacillus pumilus isolated from farmed fish on immune responses and increased disease resistance in Nile tilapia (Oreochromis niloticus): Laboratory and on-farm trials. Fish Shellfish Immunol. 2017, 67, 210. [Google Scholar] [CrossRef] [Scilit]
- Goda, A.M.; Omar, E.A.; Srour, T.M.; Kotiet, A.M.; El-Haroun, E.; Davies, S.J. Effect of diets supplemented with feed additives on growth, feed utilization, survival, body composition and intestinal bacterial load of early weaning European seabass, Dicentrarchus labrax post-larvae. Aquac. Int. 2018, 26, 169–183. [Google Scholar] [CrossRef] [Scilit]
- Harikrishnan, R.; Balasundaram, C.; Heo, M.-S. Effect of probiotics enriched diet on Paralichthys olivaceus infected with lymphocystis disease virus (LCDV). Fish Shellfish Immunol. 2010, 29, 868–874. [Google Scholar] [CrossRef] [Scilit]
- Zhou, S.; Song, D.; Zhou, X.; Mao, X.; Zhou, X.; Wang, S.; Wei, J.; Huang, Y.; Wang, W.; Xiao, S.-M.; et al. Characterization of Bacillus subtilis from gastrointestinal tract of hybrid Hulong grouper (Epinephelus fuscoguttatus × E. lanceolatus) and its effects as probiotic additives. Fish Shellfish Immunol. 2019, 84, 1115–1124. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.-H.; Chiu, C.-H.; Wang, S.-W.; Cheng, W. Dietary administration of the probiotic, Bacillus subtilis E20, enhances the growth, innate immune responses, and disease resistance of the grouper, Epinephelus coioides. Fish Shellfish Immunol. 2012, 33, 699–706. [Google Scholar] [CrossRef] [Scilit]
- Tattiyapong, P.; Dachavichitlead, W.; Surachetpong, W. Experimental infection of Tilapia Lake Virus (TiLV) in Nile tilapia (Oreochromis niloticus) and red tilapia (Oreochromis spp.). Vet. Microbiol. 2017, 207, 170–177. [Google Scholar] [CrossRef] [Scilit]
- Nayak, S.K. Probiotics and immunity: A fish perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef] [Scilit]
- Kechagia, M.; Basoulis, D.; Konstantopoulou, S.; Dimitriadi, D.; Gyftopoulou, K.; Skarmoutsou, N.; Fakiri, E.M. Health benefits of probiotics: A review. ISRN Nutr. 2013, 2013, 481651. [Google Scholar] [CrossRef] [Scilit]
- Merrifield, D.L.; Bradley, G.; Baker, R.T.M.; Davies, S.J. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) II. Effects on growth performance, feed utilization, intestinal microbiota and related health criteria postantibiotic treatment. Aquac. Nutr. 2010, 16, 496–503. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.N.; Li, X.F.; Xu, W.N.; Jiang, G.Z.; Lu, K.L.; Wang, L.N.; Liu, W.B. Combined effects of dietary fructooligosaccharide and Bacillus licheniformis on innate immunity, antioxidant capability and disease resistance of triangular bream (Megalobrama terminalis). Fish Shellfish Immunol. 2013, 35, 1380–1386. [Google Scholar] [CrossRef] [Scilit]
- Lazado, C.C.; Caipang, C.M.A. Mucosal immunity and probiotics in fish. Fish Shellfish Immunol. 2014, 39, 78–89. [Google Scholar] [CrossRef] [Scilit]
- Hai, N.V. Research findings from the use of probiotics in tilapia aquaculture: A review. Fish Shellfish Immunol. 2015, 45, 592–597. [Google Scholar] [CrossRef] [Scilit]
- Kuebutornye, F.K.A.; Abarike, E.D.; Lu, Y. A review on the application of Bacillus as probiotics in aquaculture. Fish Shellfish Immunol. 2019, 87, 820–828. [Google Scholar] [CrossRef] [Scilit]
- Hoseinifar, S.H.; Sun, Y.Z.; Wang, A.; Zhou, Z. Probiotics as Means of Diseases Control in Aquaculture, a Review of Current Knowledge and Future Perspectives. Front. Microbiol. 2018, 9, 2429. [Google Scholar] [CrossRef] [Scilit]
- Chabrillón, M.; Rico, R.M.; Arijo, S.; Díaz-Rosales, P.; Balebona, M.C.; Moriñigo, M.A. Interactions of microorganisms isolated from gilthead sea bream, Sparus aurata L. on Vibrio harveyi, a pathogen of farmed Senegalese sole, Solea senegalensis (Kaup). J. Fish Dis. 2005, 28, 531–537. [Google Scholar] [CrossRef] [Scilit]
- Luis-Villaseñor, I.E.; Macías-Rodríguez, M.E.; Gómez-Gil, B.; Ascencio-Valle, F.; Campa-Córdova, Á.I. Beneficial effects of four Bacillus strains on the larval cultivation of Litopenaeus vannamei. Aquaculture 2011, 321, 136–144. [Google Scholar] [CrossRef] [Scilit]
- Ran, C.; Huang, L.; Liu, Z.; Xu, L.; Yang, Y.; Tacon, P.; Auclair, E.; Zhou, Z. A Comparison of the Beneficial Effects of Live and Heat-Inactivated Baker’s Yeast on Nile Tilapia: Suggestions on the Role and Function of the Secretory Metabolites Released from the Yeast. PLoS ONE 2015, 10, e0145448. [Google Scholar] [CrossRef] [Scilit]
- Irianto, A.; Austin, B. Use of dead probiotic cells to control furunculosis in rainbow trout, Oncorhynchus mykiss (Walbaum). J. Fish Dis. 2003, 26, 59–62. [Google Scholar] [CrossRef] [Scilit]
- Aly, S.M.; Abdel-Galil Ahmed, Y.; Abdel-Aziz Ghareeb, A.; Mohamed, M.F. Studies on Bacillus subtilis and Lactobacillus acidophilus, as potential probiotics, on the immune response and resistance of Tilapia nilotica (Oreochromis niloticus) to challenge infections. Fish Shellfish Immunol. 2008, 25, 128–136. [Google Scholar] [CrossRef] [Scilit]
- Gisbert, E.; Castillo, M.; Skalli, A.; Andree, K.B.; Badiola, I. Bacillus cereus var. toyoi promotes growth, affects the histological organization and microbiota of the intestinal mucosa in rainbow trout fingerlings. J. Anim. Sci. 2013, 91, 2766–2774. [Google Scholar] [CrossRef] [Scilit]
- Qin, L.; Xiang, J.; Xiong, F.; Wang, G.; Zou, H.; Li, W.; Li, M.; Wu, S. Effects of Bacillus licheniformis on the growth, antioxidant capacity, intestinal barrier and disease resistance of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2020, 97, 344–350. [Google Scholar] [CrossRef] [Scilit]
- Sugita, H.; Hirose, Y.; Matsuo, N.; Deguchi, Y. Production of the antibacterial substance by Bacillus sp. strain NM 12, an intestinal bacterium of Japanese coastal fish. Aquaculture 1998, 165, 269–280. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, G.S.; Bolívar, N.C.; Pereira, S.A.; Guertler, C.; Vieira, F.d.N.; Mouriño, J.L.P.; Seiffert, W.Q. Microbial biofloc as source of probiotic bacteria for the culture of Litopenaeus vannamei. Aquaculture 2015, 448, 273–279. [Google Scholar] [CrossRef] [Scilit]
- Ramesh, D.; Vinothkanna, A.; Rai, A.K.; Vignesh, V.S. Isolation of potential probiotic Bacillus spp. and assessment of their subcellular components to induce immune responses in Labeo rohita against Aeromonas hydrophila. Fish Shellfish Immunol. 2015, 45, 268–276. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Tan, B.; Mai, K. Dietary probiotic Bacillus OJ and isomaltooligosaccharides influence the intestine microbial populations, immune responses and resistance to white spot syndrome virus in shrimp (Litopenaeus vannamei). Aquaculture 2009, 291, 35–40. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.F.; Li, Y.; Li, J.R.; Cai, L.Y.; Li, X.X.; Chen, J.R.; Lyu, S.X. Isolation and characterisation of Bacillus spp. antagonistic to Vibrio parahaemolyticus for use as probiotics in aquaculture. World J. Microbiol. Biotechnol. 2015, 31, 795–803. [Google Scholar] [CrossRef] [Scilit]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [Scilit]
- Zou, J.; Gorgoglione, B.; Taylor, N.G.H.; Summathed, T.; Lee, P.-T.; Panigrahi, A.; Genet, C.; Chen, Y.-M.; Chen, T.-Y.; Ul Hassan, M.; et al. Salmonids Have an Extraordinary Complex Type I IFN System: Characterization of the IFN Locus in Rainbow Trout Oncorhynchus mykiss Reveals Two Novel IFN Subgroups. J. Immunol. 2014, 193, 2273. [Google Scholar] [CrossRef] [Scilit]
- Gorgoglione, B.; Zahran, E.; Taylor, N.G.H.; Feist, S.W.; Zou, J.; Secombes, C.J. Comparative study of CXC chemokines modulation in brown trout (Salmo trutta) following infection with a bacterial or viral pathogen. Mol. Immunol. 2016, 71, 64–77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, J.; Secombes, C.J. Teleost fish interferons and their role in immunity. Dev. Comp. Immunol. 2011, 35, 1376–1387. [Google Scholar] [CrossRef] [Scilit]
- Sun, B.; Skjæveland, I.; Svingerud, T.; Zou, J.; Jørgensen, J.; Robertsen, B. Antiviral Activity of Salmonid Gamma Interferon against Infectious Pancreatic Necrosis Virus and Salmonid Alphavirus and Its Dependency on Type I Interferon. J. Virol. 2011, 85, 9188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tafalla, C.; Coll, J.; Secombes, C.J. Expression of genes related to the early immune response in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagic septicemia virus (VHSV) infection. Dev. Comp. Immunol. 2005, 29, 615–626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gan, Z.; Cheng, J.; Xia, L.; Kwok, K.W.; Lu, Y.; Nie, P. Unique duplication of IFNh genes in Nile tilapia (Oreochromis niloticus) reveals lineage-specific evolution of IFNh in perciform fishes. Fish Shellfish Immunol. 2020, 107, 36–42. [Google Scholar] [CrossRef] [Scilit]
- Castro, R.; Martin, S.A.M.; Zou, J.; Secombes, C.J. Establishment of an IFN-γ specific reporter cell line in fish. Fish Shellfish Immunol. 2010, 28, 312–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Avila, L.F.; de Leon, P.M.; de Moura, M.Q.; Berne, M.E.; Scaini, C.J.; Leivas Leite, F.P. Modulation of IL-12 and IFNγ by probiotic supplementation promotes protection against Toxocara canis infection in mice. Parasite Immunol. 2016, 38, 326–330. [Google Scholar] [CrossRef] [Scilit]
- Mukaida, N.; Harada, A.; Matsushima, K. Interleukin-8 (IL-8) and monocyte chemotactic and activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and immune reactions. Cytokine Growth Factor Rev. 1998, 9, 9–23. [Google Scholar] [CrossRef] [Scilit]
- Jimenez, N.; Coll, J.; Salguero, F.J.; Tafalla, C. Co-injection of interleukin 8 with the glycoprotein gene from viral haemorrhagic septicemia virus (VHSV) modulates the cytokine response in rainbow trout (Oncorhynchus mykiss). Vaccine 2006, 24, 5615–5626. [Google Scholar] [CrossRef] [Scilit]
- Covello, J.M.; Bird, S.; Morrison, R.N.; Battaglene, S.C.; Secombes, C.J.; Nowak, B.F. Cloning and expression analysis of three striped trumpeter (Latris lineata) pro-inflammatory cytokines, TNF-α, IL-1β and IL-8, in response to infection by the ectoparasitic, Chondracanthus goldsmidi. Fish Shellfish Immunol. 2009, 26, 773–786. [Google Scholar] [CrossRef] [Scilit]
- Laing, K.J.; Secombes, C.J. Chemokines. Dev. Comp. Immunol. 2004, 28, 443–460. [Google Scholar] [CrossRef] [Scilit]
- Yi, Y.; Zhang, Z.; Zhao, F.; Liu, H.; Yu, L.; Zha, J.; Wang, G. Probiotic potential of Bacillus velezensis JW: Antimicrobial activity against fish pathogenic bacteria and immune enhancement effects on Carassius auratus. Fish Shellfish Immunol. 2018, 78, 322–330. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Beck, B.R.; Heo, S.-B.; Kim, J.; Kim, H.D.; Lee, S.-M.; Kim, Y.; Oh, S.Y.; Lee, K.; Do, H.; et al. Lactococcus lactis BFE920 activates the innate immune system of olive flounder (Paralichthys olivaceus), resulting in protection against Streptococcus iniae infection and enhancing feed efficiency and weight gain in large-scale field studies. Fish Shellfish Immunol. 2013, 35, 1585–1590. [Google Scholar] [CrossRef] [Scilit]
- Holland, J.W.; Bird, S.; Williamson, B.; Woudstra, C.; Mustafa, A.; Wang, T.; Zou, J.; Blaney, S.C.; Collet, B.; Secombes, C.J. Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus mykiss: Functional analysis and transcriptional modulation. Mol. Immunol. 2008, 46, 269–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robertsen, B. The role of type I interferons in innate and adaptive immunity against viruses in Atlantic salmon. Dev. Comp. Immunol. 2018, 80, 41–52. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.L.; Shiu, Y.L.; Chiu, C.S.; Huang, S.L.; Liu, C.H. Screening probiotic candidates for a mixture of probiotics to enhance the growth performance, immunity, and disease resistance of Asian seabass, Lates calcarifer (Bloch), against Aeromonas hydrophila. Fish Shellfish Immunol. 2017, 60, 474–482. [Google Scholar] [CrossRef] [Scilit]
- Román, L.; Acosta, F.; Padilla, D.; El Aamri, F.; Bravo, J.; Vega, B.; Rodriguez, E.; Vega, J.; Déniz, S.; Real, F. The in vitro immunomodulatory effect of extracellular products (ECPs) of Vagococcus fluvialis L21 on European sea bass (Dicentrarchus labrax) leucocytes. Fish Shellfish Immunol. 2015, 42, 517–521. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Wang, S.; Cai, Y.; Guo, X.; Cao, Z.; Zhang, Y.; Liu, S.; Yuan, W.; Zhu, W.; Zheng, Y.; et al. Dietary administration of Bacillus subtilis HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2017, 60, 326–333. [Google Scholar] [CrossRef] [Scilit]
- Chiu, C.H.; Cheng, C.H.; Gua, W.R.; Guu, Y.K.; Cheng, W. Dietary administration of the probiotic, Saccharomyces cerevisiae P13, enhanced the growth, innate immune responses, and disease resistance of the grouper, Epinephelus coioides. Fish Shellfish Immunol. 2010, 29, 1053–1059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Son, V.M.; Chang, C.-C.; Wu, M.-C.; Guu, Y.-K.; Chiu, C.-H.; Cheng, W. Dietary administration of the probiotic, Lactobacillus plantarum, enhanced the growth, innate immune responses, and disease resistance of the grouper Epinephelus coioides. Fish Shellfish Immunol. 2009, 26, 691–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tattiyapong, P.; Sirikanchana, K.; Surachetpong, W. Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish. J. Fish Dis. 2018, 41, 255–261. [Google Scholar] [CrossRef] [Scilit]
- Iwamoto, T.; Nakai, T.; Mori, K.; Arimoto, M.; Furusawa, I. Cloning of the fish cell line SSN-1 for piscine nodaviruses. Dis. Aquat Organ. 2000, 43, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef] [Scilit]
- Nicholson, P.; Rawiwan, P.; Surachetpong, W. Detection of Tilapia lake virus using conventional RT-PCR and SYBR green RT-qPCR. JoVE 2018, 141, e58596. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]








| Parameters | Treatments | ||
|---|---|---|---|
| Control Diet | 0.5% Probiotics | 1% Probiotics | |
| Initial weight (g) | 11.4 ± 0.82 | 11.3 ± 1.04 | 9.9 ± 0.20 |
| Final weight (g) | 24.9 ± 0.99 | 25.0 ± 0.78 | 24.2 ± 0.24 |
| Weight gain (g) | 13.6 ± 0.18 | 13.7 ± 0.61 | 14.3 ± 0.10 |
| Weight gain (%) | 218.1 ± 7.59 | 220.2 ± 15.65 | 242.1 ± 2.79 |
| Feed efficiency | 0.97 ± 0.01 | 0.98 ± 0.04 | 1.02 ± 0.007 |
| Average daily gain (ADG) (g) | 0.65 ± 0.009 | 0.65 ± 0.02 | 0.68 ± 0.004 |
| Feed conversion ratio (FCR) | 1.03 ± 0.01 | 1.02 ± 0.04 | 0.98 ± 0.006 |
| Gene | Primer Sequence (5′-3′) | Amplicon Size (bp) | Accession Number | Source |
|---|---|---|---|---|
| β-actin | F: GTGGGTATGGGTCAGAAAGAC | 111 | XM003443127 | Mugimba et al., 2019 |
| R: GTCATCCCAGTTGGTCACAATA | ||||
| TiLV | F: CTGAGCTAAAGAGGCAATATGGATT | 112 | KU751816 | Tattiyapong et al., 2018 |
| R: CGTGCGTACTCGTTCAGTATAAGTTCT | ||||
| il-8 | F: TCGCCACCTGTGAAGGCA | 116 | NM001279704 | this study |
| R: GCAGTGGGAGTTGGGAAGAAT | ||||
| Irf-3 | F: CTGTGTTTTCGGAATCTGCTG | 182 | XM005448320 | this study |
| R: CATTACTGGATACTGCTGTTGC | ||||
| ifn-γ | F: GAAACTTCTGCAGGGATTGG | 132 | NM001287402 | Velázquez et al., 2017 |
| R: CTCTGGATCTTGATTTCGGG | ||||
| Mx | F: ACCCTTGAGCTGGTGAATCA | 174 | XM003442686 | Velázquez et al., 2017 |
| R: ATCCTGAGTGAATGCGGTCA | ||||
| RSAD-2 | F: ATCAACTTCTCTGGCGGA | 161 | XM003453237 | this study |
| R: AGATAGACACCATATTTCTGGAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Waiyamitra, P.; Zoral, M.A.; Saengtienchai, A.; Luengnaruemitchai, A.; Decamp, O.; Gorgoglione, B.; Surachetpong, W. Probiotics Modulate Tilapia Resistance and Immune Response against Tilapia Lake Virus Infection. Pathogens 2020, 9, 919. https://doi.org/10.3390/pathogens9110919
Waiyamitra P, Zoral MA, Saengtienchai A, Luengnaruemitchai A, Decamp O, Gorgoglione B, Surachetpong W. Probiotics Modulate Tilapia Resistance and Immune Response against Tilapia Lake Virus Infection. Pathogens. 2020; 9(11):919. https://doi.org/10.3390/pathogens9110919
Chicago/Turabian StyleWaiyamitra, Pitchaporn, Mehmet Arif Zoral, Aksorn Saengtienchai, Amorn Luengnaruemitchai, Olivier Decamp, Bartolomeo Gorgoglione, and Win Surachetpong. 2020. "Probiotics Modulate Tilapia Resistance and Immune Response against Tilapia Lake Virus Infection" Pathogens 9, no. 11: 919. https://doi.org/10.3390/pathogens9110919
APA StyleWaiyamitra, P., Zoral, M. A., Saengtienchai, A., Luengnaruemitchai, A., Decamp, O., Gorgoglione, B., & Surachetpong, W. (2020). Probiotics Modulate Tilapia Resistance and Immune Response against Tilapia Lake Virus Infection. Pathogens, 9(11), 919. https://doi.org/10.3390/pathogens9110919

