An Abattoir-Based Study on the Prevalence of Salmonella Fecal Carriage and ESBL Related Antimicrobial Resistance from Culled Adult Dairy Cows in Wuhan, China
Abstract
1. Introduction
2. Results
2.1. General Description
2.2. Occurrence and Prevalence of Salmonella
2.3. Antimicrobial Resistance Test
2.4. ESBL Characterization
3. Discussion
4. Materials and Methods
4.1. Study Area and Approvals
4.2. Study Design
4.3. Sample Size Calculations
4.4. Study Populations and Selection of Study Subjects
4.5. Collection of Fecal Swabs
4.6. Isolation and Identification
4.7. Characterization Using Rapid Molecular Detection Methods
4.8. Antibiotic Susceptibility Test
4.9. Identification of ESBL-Producing Salmonella
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gieraltowski, L.; Higa, J.; Peralta, V.; Green, A.; Schwensohn, C.; Rosen, H.; Libby, T.; Kissler, B.; Marsden-Haug, N.; Booth, H.; et al. Salmonella Heidelberg Investigation Team. National outbreak of multidrug resistant Salmonella Heidelberg infections linked to a single poultry company. PLoS ONE 2016, 11, e0162369. [Google Scholar] [CrossRef] [PubMed]
- Jiu, Y.; Zhu, S.; Khan, S.B.; Sun, M.; Zou, G.; Meng, X.; Wu, B.; Zhou, R.; Li, S. Phenotypic and genotypic resistance of Salmonella isolates from healthy and diseased pigs in China during 2008–2015. Microb. Drug Resist. 2016, 23, 651–659. [Google Scholar] [CrossRef] [PubMed]
- Awosile, B.; McClure, J.; Sanchez, J.; Rodriguez-Lecompte, J.C.; Keefe, G.; Heider, L.C. Salmonella enterica and extended-spectrum cephalosporin-resistant Escherichia coli recovered from holstein dairy calves from 8 farms in New Brunswick, Canada. J. Dairy. Sci. 2018, 101, 3271–3284. [Google Scholar] [CrossRef] [PubMed]
- Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Tian, L.; Cheng, Z.; Liu, W.; Li, S.; Yu, W.; Zhang, W.; Xiang, X.; Sun, Z. Viral and bacterial etiology of acute diarrhea among children under 5 years of age in Wuhan, China. Chin. Med. J. 2016, 129, 1939–1944. [Google Scholar] [CrossRef]
- Kuang, X.; Hao, H.; Dai, M.; Wang, Y.; Ahmad, I.; Liu, Z.; Yuan, Z. Serotypes and antimicrobial susceptibility of Salmonella spp. isolated from farm animals in China. Front. Microbiol. 2015, 6, 602. [Google Scholar] [CrossRef]
- Li, Y.; Pan, Z.; Kang, X.; Geng, S.; Liu, Z.; Cai, Y.; Jiao, X. Prevalence, characteristics, and antimicrobial resistance patterns of Salmonella in retail pork in Jiangsu Province, eastern China. J. Food Prot. 2014, 77, 236–245. [Google Scholar] [CrossRef]
- WHO. WHO Estimates of the Global Burden of Foodborne Disease Foodborne Diseases Burden Epidemiology Reference Group 2007–2015. Available online: http://www.who.int/foodsafety/publications/foodborne_disease/fergreport/en/ (accessed on 5 May 2017).
- National Bureau of Statistics of China (NBSC). 2018 Statistical Announcement on National Economic and Social Development. Available online: http://www.stats.gov.cn/tjsj/zxfb/201902/t20190228_1651265.html (accessed on 17 October 2020).
- Zhong, Z.; Chen, S.; Kong, X.; Tracy, M. Why improving agrifood quality is difficult in China: Evidence from dairy industry. China Econ. Rev. 2014, 31, 74–83. [Google Scholar] [CrossRef]
- Laufer, A.S.; Grass, J.; Holt, K.; Whichard, J.M.; Griffin, P.M.; Gould, L.H. Outbreaks of Salmonella infections attributed to beef—United States, 1973–2011. Epidemiol. Infect. 2015, 143, 2003–2013. [Google Scholar] [CrossRef]
- Li, W.W.; Wang, S.T.; Liang, J.J.; Liu, C.Q.; Xiong, Y.; Li, N.; Xu, J.; Liu, X.M.; Guo, Y.C. ‘Analysis of foodborne disease outbreaks in China mainland in 2013’. Chin. J. Food Hyg. 2018, 30, 293–298. [Google Scholar]
- Dong, P.; Zhu, L.; Mao, Y.; Liang, R.; Niu, L.; Zhang, Y.; Li, K.; Luo, X. Prevalence and profile of Salmonella from samples along the production line in Chinese beef processing plants. Food Control. 2014, 38, 54–60. [Google Scholar] [CrossRef]
- Cai, Y.; Tao, J.; Jiao, Y.; Fei, X.; Zhou, L.; Wang, Y.; Zheng, H.; Pan, Z.; Jiao, X. Phenotypic characteristics and genotypic correlation between Salmonella isolates from a slaughterhouse and retail markets in Yangzhou, China. Int. J. Food Microbiol. 2016, 222, 56–64. [Google Scholar] [CrossRef]
- Jiang, Z.; Paudyal, N.; Xu, Y.; Deng, T.; Li, F.; Pan, H.; Peng, X.; He, Q.; Yue, M. Antibiotic resistance profiles of Salmonella, recovered from finishing pigs and slaughter facilities in Henan, China. Front. Microbiol. 2019, 10, 1513. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention (CDC). ESBL-Producing Enterobacteriaceae in Healthcare Settings. Available online: https://www.cdc.gov/hai/organisms/ESBL.html (accessed on 18 April 2020).
- Vinueza-Burgos, C.; Ortega-Paredes, D.; Narvaez, C.; De Zutter, L.; Zurita, J. Characterization of cefotaxime resistant Escherichia coli isolated from broiler farms in ecuador. PLoS ONE 2019, 14, e0207567. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.R. Extended-Spectrum Beta-Lactamases Producing Escherichia coli (ESBLS-Producing, E. coli) in Dairy Farms in Beijing, China. Ph.D. Thesis, Chiang Mai University and Freie Universität Berlin, Berlin, Germany, 2013. [Google Scholar]
- Ali, T.; Ur Rahman, S.; Zhang, L.; Shahid, M.; Zhang, S.; Liu, G.; Gao, J.; Han, B. ESBL-producing Escherichia coli from cows suffering mastitis in China contain clinical class 1 integrons with CTX-M linked to ISCR1. Front. Microbiol. 2016, 7, 1931. [Google Scholar] [CrossRef]
- Yang, F.; Zhang, S.; Shang, X.; Wang, X.; Wang, L.; Yan, Z.; Li, H. Prevalence and characteristics of extended spectrum β-lactamase-producing Escherichia coli from bovine mastitis cases in China. J. Integr. Agr. 2018, 17, 1246–1251. [Google Scholar] [CrossRef]
- Liu, G.; Ali, T.; Gao, J.; Ur, R.S.; Yu, D.; Barkema, H.W.; Huo, W.; Xu, S.; Shi, Y.; Kastelic, J.P.; et al. Co-occurrence of plasmid-mediated colistin resistance (mcr-1) and extended spectrum β-lactamase encoding genes in Escherichia coli from bovine mastitis milk in China. Microb. Drug Resist. 2019. [Google Scholar] [CrossRef]
- Pereira, R.; Williams, D.R.; Rossitto, P.; Adaska, J.; Okello, E.; Champagne, J.; Lehenbauer, T.W.; Li, X.; Chase, J.; Nguyen, T.; et al. Association between herd management practices and antimicrobial resistance in Salmonella spp. from cull dairy cattle in Central California. PeerJ 2019, 7, e6546. [Google Scholar] [CrossRef] [PubMed]
- Bonardi, S.; Bruini, I.; Magnani, R.; Cannistrà, N.; Brindani, F. Low prevalence of Salmonella enterica in cull dairy cattle at slaughter in Northern Italy. Ital. J. Food Saf. 2017, 6, 6172. [Google Scholar] [CrossRef] [PubMed]
- Abu Aboud, O.A.; Adaska, J.M.; Williams, D.R.; Rossitto, P.V.; Champagne, J.D.; Lehenbauer, T.W.; Atwill, R.; Li, X.; Aly, S.S. Epidemiology of Salmonella spp. In California cull dairy cattle: Prevalence of fecal shedding and diagnostic accuracy of pooled enriched broth culture of fecal samples. PeerJ 2016, 4, e2386. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Qu, D.; Zhang, X.; Shen, J.; Cui, S.; Shi, Y.; Xi, M.; Sheng., M.; Zhi, S.; Meng, J. Prevalence and characterization of Salmonella serovars in retail meats of marketplace in Shaanxi, China. Int. J. Food Microbiol. 2010, 141, 63–72. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Wang, M.; Zhou, C.; Gu, G.; Liang, J.; Hou, X.; Wang, M.; Wei, P. Prevalence and antimicrobial resistance of retail-meat-borne Salmonella in southern China during the years 2009–2016: The diversity of contamination and the resistance evolution of multidrug-resistant isolates. Int. J. Food Microbiol. 2020, 333, 108790. [Google Scholar] [CrossRef] [PubMed]
- Ministry of Agriculture and Rural Affairs of the People’s Republic of China. Notice of the Ministry of Agriculture on Printing and Distributing the 13th Five-Year Development Plan for the National Herbivorous Animal Husbandry (2016–2020). Available online: http://www.moa.gov.cn/nybgb/2016/dibaqi/201712/t20171219_6102799.htm (accessed on 1 September 2020).
- Canadian Dairy Informational Center (CDIC). Breed Improvement and Genetic Evaluation. Culling and Replacement Rates in Dairy Herds in Canada. Available online: http://www.dairyinfo.gc.ca/index_e.php?s1=dff-fcil&s2=mrr-pcle&s3=cr-tr (accessed on 29 May 2020).
- Pinedo, P.J.; De Vries, A.; Webb, D.W. Dynamics of culling risk with disposal codes reported by dairy herd improvement dairy herds. J. Dairy Sci. 2010, 93, 2250–2261. [Google Scholar] [CrossRef]
- Stojkov, J.; Bowers, G.; Draper, M.; Duffield, T.; Duivenvoorden, P.; Groleau, M.; Haupstein, D.; Peters, R.; Pritchard, J.; Radom, C.; et al. Hot topic: Management of cull dairy cows—Consensus of an expert consultation in Canada. J. Dairy Sci. 2018, 101, 11170–11174. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, L.R.; Dohoo, I. Culling decisions of dairy farmers during a 3-year Salmonella control study. Prev. Vet. Med. 2011, 100, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Zhao, H.; Cui, S.; Wang, Y.; Xia, X.; Xi, M.; Wang, X.; Meng, J.; Ge, W. Prevalence and characterization of Salmonella enterica in dried milk-related infant foods in Shaanxi, China. J. Dairy Sci. 2014, 97, 6754–6760. [Google Scholar] [CrossRef] [PubMed]
- Ministry of Agriculture and Rural Affairs of the People’s Republic of China. Report on the Use of Veterinary Antibiotics of China in 2018. Off. Vet. Bull. 2019, 21, 57–59. [Google Scholar]
- Krömker, V.; Leimbach, S. Mastitis treatment—Reduction in antibiotic usage in dairy cows. Reprod. Domest. Anim. 2017, 52, 21–29. [Google Scholar] [CrossRef]
- Paudyal, N.; Pan, H.; Elbediwi, M.; Zhou, X.; Peng, X.; Li, X.; Fang, W.; Yue, M. Characterization of Salmonella Dublin isolated from bovine and human hosts. BMC Microbiol. 2019, 19, 226–228. [Google Scholar] [CrossRef]
- Zhang, L.; Fu, Y.; Xiong, Z.; Ma, Y.; Wei, Y.; Qu, X.; Zhang, H.; Zhang, J.; Liao, M. Highly prevalent multidrug-resistant Salmonella from chicken and pork meat at retail markets in Guangdong, China. Front. Microbiol. 2018, 9, 2104. [Google Scholar] [CrossRef]
- Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Yigit, H.; Queenan, A.M.; Anderson, G.J.; Domenech-Sanchez, A.; Biddle, J.W.; Steward, C.D.; Alberti, S.; Bush, K.; Tenover, F.C. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2001, 45, 1151–1809. [Google Scholar] [CrossRef]
- Ministry of Agriculture and Rural Affairs of the People’s Republic of China. Announcement of the Ministry of Agriculture of the People’s Republic of China, No. 2428. Available online: http://www.moa.gov.cn/nybgb/2016/dibaqi/201712/t20171219_6102822.htm (accessed on 29 May 2020).
- Eguale, T.; Engidawork, E.; Gebreyes, W.A.; Asrat, D.; Alemayehu, H.; Medhin, G.; Johnson, R.P.; Gunn, J.S. Fecal prevalence, serotype distribution and antimicrobial resistance of Salmonellae in dairy cattle in central Ethiopia. BMC Microbiol. 2016, 16, 20. [Google Scholar] [CrossRef] [PubMed]
- Simova, V.; Voslarova, E.; Vecerek, V.; Passantino, A.; Bedanova, I. Effects of travel distance and season of the year on transport-related mortality in cattle. Anim. Sci. J. 2017, 88, 526–532. [Google Scholar] [CrossRef] [PubMed]
- Dahl-Pedersen, K.; Herskin, M.S.; Houe, H.; Thomsen, P.T. Risk factors for deterioration of the clinical condition of cull dairy cows during transport to slaughter. Front. Vet. Sci. 2018, 5, 297. [Google Scholar] [CrossRef] [PubMed]
- Makino, S.; Kurazono, H.; Chongsanguam, M.; Hayashi, H.; Cheun, H.; Suzuki, S.; Shirahata, T. Establishment of the PCR system specific to Salmonella spp. and its application for the inspection of food and fecal samples. J. Vet. Med. Sci. 1999, 61, 1245–1247. [Google Scholar] [CrossRef]
- Zhai, L.; Kong, X.; Lu, Z.; Lv, F.; Zhang, C.; Bie, X. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format. J. Microbiol. Methods 2014, 100, 52–57. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Wang, Y.; Shen, J.; Wu, C. Development of a novel hexa-plex PCR method for identification and serotyping of Salmonella species. Foodborne. Pathog. Dis. 2014, 11, 75. [Google Scholar] [CrossRef]
- Liu, B. Ming of molecular targets and development of multiplex PCR methods for serogouping and serotyping Salmonella spp. Ph.D. Thesis, Shanghai Jiao Tong University, Shanghai, China, 2012. [Google Scholar]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals: Informational Supplement, M31-A3; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2008. [Google Scholar]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals: Twenty-Second Informational Supplement M100-S22; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2012. [Google Scholar]
- Kwa, A.; Kasiakou, S.K.; Tam, V.H.; Falagas, M.E. Polymyxin B: Similarities to and differences from colistin (polymyxin E). Expert Rev. Anti Infect. Ther. 2007, 5, 811–821. [Google Scholar] [CrossRef]
- EURL-AR. Laboratory Protocol: Quantification of ESBL/AmpC-Producing Escherichia coli in Caecal Content and Fresh Meat Samples. European Union Reference Laboratory Antimicrobial Resistance. December 2017. Version 1. Available online: https://www.eurl-ar.eu/CustomerData/Files/Folders/21-protocols/399_esbl-ampc-quantification-protocol-19-03-2018.pdf (accessed on 20 June 2017).
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. Beta-lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in the Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef]
- Rasheed, J.K.; Jay, C.; Metchock, B.; Berkowitz, F.; Weigel, L.; Crellin, J.; Steward, C.; Hill, B.; Medeiros, A.A.; Tenover, F.C. Evolution of extended-spectrum beta-lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia. Antimicrob. Agents Chemother. 1997, 41, 647–653. [Google Scholar] [CrossRef] [PubMed]
- Dierikx, C.; van Essen-Zandbergen, A.; Veldman, K.; Smith, H.; Mevius, D. Increased detection of extended spectrum beta-lactamase producing Salmonella enterica and Escherichia coli isolates from poultry. Vet. Microbiol. 2010, 145, 273–278. [Google Scholar] [CrossRef] [PubMed]
- Xavier, B.B.; Lammens, C.; Ruhal, R.; Kumar-Singh, S.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Eurosurveillance 2016, 21, 30280. [Google Scholar] [CrossRef] [PubMed]

| Source | Total No. of Salmonella-Positive Cases | No. of Culled Dairy Cows Sampled | Prevalence (95% CI) | OR (95% CI) | p-Value * | No. of MDR Samples, Percentages (%) 95% CI | No. of S. Typhimurium-Positive Samples | No. of MDR of S. Typhimurium-Positive Samples, Percentages (%) 95% CI | 
|---|---|---|---|---|---|---|---|---|
| Central | 5 | 27 | 18.5% (6.3, 38.1) | 1 | 1, 20.0 ** (0.5, 71.6) | 2 | 0, 0.0 *** (0.0, 84.2) | |
| North | 15 | 65 | 23.1% (13.5, 35.2) | 1.3 (0.4, 4.1) | 0.629 | 8, 53.3 ** (26.6, 78.7) | 10 | 4, 40.0 *** (12.2, 73.8) | 
| Northeast | 19 | 40 | 47.5% (31.5, 63.9) | 4.0 (1.3, 12.6) | 0.015 | 10, 52.6 ** (28.9, 75.6) | 13 | 5, 38.5 *** (13.9, 68.4) | 
| Northwest | 0 | 1 | 0.0% (0.0, 97.5) | - | - | - | - | |
| East | 0 | 1 | 0.0% (0.0, 97.5) | - | - | - | - | |
| Unspecified | 1 | 4 | 25.0% (0.6, 80.6) | 1.5 (0.1, 17.2) | 1, 100.0 ** (2.5, 100.0) | 1 | 1, 100.0 *** (2.5, 100.0) | |
| Total | 40 | 138 | 29.0% (21.6, 37.3) | - | 10,50.0 (33.8, 66.2) | 26 | 10, 38.5 (20.2, 59.4) | 
| Antibiotic Group | Antibiotic | Percentage of Isolates with Resistance (95% CI) | 
|---|---|---|
| Penicillins | Ampicillin | 87.8% (73.8, 95.9) | 
| Tetracyclines | Tetracycline | 56.1% (39.7, 71.5) | 
| Cephems | Ceftiofur | 39.0% (24.2, 55.5) | 
| Phenicols | Florfenicol | 31.7% (18.1, 48.1) | 
| Aminoglycosides | Gentamicin | 26.8% (14.2, 42.9) | 
| Quinolones | Enrofloxacin | 26.8% (14.2, 42.9) | 
| Folate pathway antagonists | Trimethoprim- Sulfamethoxazole | 4.9% (0.6, 16.5) | 
| Polypeptides | Polymyxin | 0.0% (0.0, 8.6) | 
| Carbapenems | Imipenem | 0.0% (0.0, 8.6) | 
| Serotype | Sequence (5′-3′) | 
|---|---|
| Dublin | GAGATTGCCGATGCTTTTCC | 
| AACCTGCTCTACGGGTCTGATT | |
| Agona | AATTGTCTGCGTCATTGAGTTGGA | 
| CGGCGGTTCTTCATCTATCTTCG | |
| Typhimurium | AAAAGCAGGCATGTCCACCG | 
| ATCCCGCAGCGTAAAGCAAC | |
| Enteritidis | GCCACTGTCTGATGCTCTTG | 
| GAAAGGCTCCGTGGTTAGT | |
| Infantis | AGCCAACGCCACCTACTACT | 
| TGAACACCATATCCATCCACAT | 
| Genes | Sequence | 
|---|---|
| blaCTX-M | ATGTGCAGYACCAGTAARGTKATGGC | 
| TGGGTRAARTARGTSACCAGAAYCAGCGG | |
| blaTEM | ATGAGTATTCAACATTTCCG | 
| CTGACAGTTACCAATGCTTA | |
| blaSHV | TTATCTCCCTGTTAGCCACC | 
| GATTTGCTGATTTCGCTCGG | |
| blaKPC | TGTCACTGTATCGCCGTC | 
| CTCAGTGCTCTACAGAAAACC | |
| mcr-1 | CGGTCAGTCCGTTTGTTC | 
| CTTGGTCGGTCTGTAGGG | |
| mcr-2 | TGGTACAGCCCCTTTATT | 
| GCTTGAGATTGGGTTATGA | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Xue, K.; Yi, P.; Zhu, X.; Peng, Q.; Wang, Z.; Peng, Y.; Chen, Y.; Robertson, I.D.; Li, X.; et al. An Abattoir-Based Study on the Prevalence of Salmonella Fecal Carriage and ESBL Related Antimicrobial Resistance from Culled Adult Dairy Cows in Wuhan, China. Pathogens 2020, 9, 853. https://doi.org/10.3390/pathogens9100853
Wang J, Xue K, Yi P, Zhu X, Peng Q, Wang Z, Peng Y, Chen Y, Robertson ID, Li X, et al. An Abattoir-Based Study on the Prevalence of Salmonella Fecal Carriage and ESBL Related Antimicrobial Resistance from Culled Adult Dairy Cows in Wuhan, China. Pathogens. 2020; 9(10):853. https://doi.org/10.3390/pathogens9100853
Chicago/Turabian StyleWang, Jie, Kaili Xue, Ping Yi, Xiaojie Zhu, Qingjie Peng, Zijian Wang, Yongchong Peng, Yingyu Chen, Ian D. Robertson, Xiang Li, and et al. 2020. "An Abattoir-Based Study on the Prevalence of Salmonella Fecal Carriage and ESBL Related Antimicrobial Resistance from Culled Adult Dairy Cows in Wuhan, China" Pathogens 9, no. 10: 853. https://doi.org/10.3390/pathogens9100853
APA StyleWang, J., Xue, K., Yi, P., Zhu, X., Peng, Q., Wang, Z., Peng, Y., Chen, Y., Robertson, I. D., Li, X., Guo, A., & Aleri, J. W. (2020). An Abattoir-Based Study on the Prevalence of Salmonella Fecal Carriage and ESBL Related Antimicrobial Resistance from Culled Adult Dairy Cows in Wuhan, China. Pathogens, 9(10), 853. https://doi.org/10.3390/pathogens9100853
 
        


 
       