Molecular Surveillance of Plasmodium vivax and Plasmodium falciparum Drug Resistance Genes in the Republic of Korea: 2022–2025
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Collection and Malaria Diagnosis
2.3. Drug Resistance Gene Amplification
2.4. Sequence Analysis
2.5. Statistical Analysis
3. Results
3.1. Polymorphism of the Pvmdr-1 Gene
3.2. Polymorphism of Pfmdr-1, PfK13, and Pfcyt-b Genes
3.3. Statistical Analysis of the Pvmdr-1, Pfmdr-1, PfK13, and Pfcyt-b Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| DMZ | Demilitarized Zone |
| DPRK | Democratic People’s Republic of Korea |
| KDCA | Korea Disease Control and Prevention Agency |
| PCR | Polymerase chain reaction |
| ROK | Republic of Korea |
| WHO | World Health Organization |
References
- Caputo, A.; Garavelli, P.L. Climate, environment and transmission of malaria. Infez. Med. 2016, 2, 93–104. [Google Scholar]
- Milner, D.A. Malaria pathogenesis. Cold Spring Harb. Perspect. Med. 2018, 8, a025569. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. World Malaria Report 2025: Addressing the Threat of Antimalarial Drug Resistance; World Health Organization: Geneva, Switzerland, 2025; Available online: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2025 (accessed on 20 April 2026).
- Ree, H.I. Unstable vivax malaria in Korea. Korean J. Parasitol. 2000, 38, 119–138. [Google Scholar] [CrossRef] [Scilit]
- Seong, H.; Suh, J.; Choi, J.Y.; Lee, J.; Yeom, J.S. Development of a Plasmodium vivax malaria model for evaluating the effects of control strategies on the malaria burden in Democratic People’s Republic of Korea. Front. Public Health 2024, 12, 1423004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.-J.; Kim, S.-H.; Jo, S.-N.; Gwack, J.; Youn, S.-K.; Jang, J.-Y. The long and short incubation periods of Plasmodium vivax malaria in Korea: The characteristics and relating factors. Infect. Chemother. 2013, 45, 184–193. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.Y.; Lee, S.D.; Oh, S.K.; Park, S.; Lee, J.Y.; Kim, J. Introduction to the Second Malaria Re-elimination Action Plan (2024–2028) Toward Malaria Elimination by 2030. Public Health Wkly. Rep. 2024, 17, 962–979. [Google Scholar] [CrossRef] [Scilit]
- Rieckmann, K.H.; Davis, D.R.; Hutton, D.C. Plasmodium vivax resistance to chloroquine? Lancet 1989, 2, 1183–1184. [Google Scholar] [CrossRef] [Scilit]
- Ding, H.; Dong, Y.; Deng, Y.; Xu, Y.; Liu, Y.; Wu, J.; Chen, M.; Zhang, C.; Liu, L.; Lin, Y. Molecular surveillance of chloroquine resistance in Plasmodium vivax isolates from malaria cases in Yunnan Province of China using pvcrt-o gene polymorphisms. Malar. J. 2023, 22, 338. [Google Scholar] [CrossRef] [Scilit]
- Gonçalves, L.A.; Cravo, P.; Ferreira, M.U. Emerging Plasmodium vivax resistance to chloroquine in South America: An overview. Mem. Inst. Oswaldo Cruz 2014, 109, 534–539. [Google Scholar] [CrossRef] [Scilit]
- Kaur, D.; Sinha, S.; Sehgal, R. Global scenario of Plasmodium vivax occurrence and resistance pattern. J. Basic Microbiol. 2022, 62, 1417–1428. [Google Scholar] [CrossRef] [Scilit]
- Rungsihirunrat, K.; Muhamad, P.; Chaijaroenkul, W.; Kuesap, J.; Na-Bangchang, K. Plasmodium vivax drug resistance genes; Pvmdr1 and Pvcrt-o polymorphisms in relation to chloroquine sensitivity from a malaria endemic area of Thailand. Korean J. Parasitol. 2015, 53, 43–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Igwe, M.C.; Ogbuabor, O.A.; Obeagu, E.I. Evolutionary biology of antimalarial drug resistance: Understanding of the evolutionary dynamics. Medicine 2025, 104, e41878. [Google Scholar] [CrossRef]
- Sidhu, A.B.S.; Uhlemann, A.C.; Valderramos, S.G.; Valderramos, J.C.; Krishna, S.; Fidock, D.A. Decreasing pfmdr1 copy number in Plasmodium falciparum malaria heightens susceptibility to mefloquine, lumefantrine, halofantrine, quinine, and artemisinin. J. Infect. Dis. 2006, 194, 528–535. [Google Scholar] [CrossRef] [Scilit]
- Ariey, F.; Witkowski, B.; Amaratunga, C.; Beghain, J.; Langlois, A.C.; Khim, N.; Kim, S.; Duru, V.; Bouchier, C.; Ma, L.; et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature 2014, 505, 50–55. [Google Scholar] [CrossRef] [Scilit]
- Happi, C.T.; Gbotosho, G.O.; Folarin, O.A.; Milner, D.; Sarr, O.; Sowunmi, A.; Kyle, D.E.; Milhous, W.K.; Wirth, D.F.; Oduola, A.M.J. Confirmation of emergence of mutations associated with atovaquone-Proguanil resistance in unexposed Plasmodium falciparum isolates from Africa. Malar. J. 2006, 5, 82. [Google Scholar] [CrossRef] [Scilit]
- Ippolito, M.M.; Moser, K.A.; Kabuya, J.B.B.; Cunningham, C.; Juliano, J.J. Antimalarial drug resistance and implications for the WHO global technical strategy. Curr. Epidemiol. Rep. 2021, 8, 46–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- White, N.J. Antimalarial drug resistance. J. Clin. Investig. 2004, 113, 1084–1092. [Google Scholar] [CrossRef]
- Wamae, K.; Magudha, J.; Asiimwe, E.; Kimani, K.; Kandie, R.; Keitany, K.; Snow, R.W.; Ochola-Oyier, L.I. A scoping review of antimalarial drug resistance markers in Kenya (1987–2022): Toward a National Surveillance Framework and Data Repository. Malar. J. 2025, 24, 413. [Google Scholar] [CrossRef] [Scilit]
- Nsanzabana, C. Time to scale up molecular surveillance for anti-malarial drug resistance in sub-Saharan Africa. Malar. J. 2021, 20, 401. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Malaria Microscopy Quality Assurance Manual, 2nd ed.; World Health Organization: Geneva, Switzerland, 2016; Available online: https://www.who.int/publications/i/item/9789241549394 (accessed on 20 April 2026).
- World Health Organization. WHO Guidelines for Malaria; World Health Organization: Geneva, Switzerland, 2025; Available online: https://www.who.int/publications/i/item/guidelines-for-malaria (accessed on 20 April 2026).
- Barnadas, C.; Ratsimbasoa, A.; Tichit, M.; Bouchier, C.; Jahevitra, M.; Picot, S.; Ménard, D. Plasmodium vivax resistance to chloroquine in Madagascar: Clinical efficacy and polymorphisms in pvmdr1 and pvcrt-o genes. Antimicrob. Agents Chemother. 2008, 52, 4233–4240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bong, J.-J.; Lee, W.; Lee, C.H.; Park, Q.; Noh, K.T. Single nucleotide polymorphism analysis of pvmdr-1 in Plasmodium vivax isolated from military personnel of Republic of Korea in 2016 and 2017. Malar. J. 2022, 21, 205. [Google Scholar] [CrossRef] [Scilit]
- Chung, D.-I.; Jeong, S.; Dinzouna-Boutamba, S.-D.; Yang, H.-W.; Yeo, S.-G.; Hong, Y.; Goo, Y.-K. Evaluation of single nucleotide polymorphisms of pvmdr1 and microsatellite genotype in Plasmodium vivax isolates from Republic of Korea military personnel. Malar. J. 2015, 14, 336. [Google Scholar] [CrossRef] [Scilit]
- Griffing, S.; Syphard, L.; Sridaran, S.; McCollum, A.M.; Mixson-Hayden, T.; Vinayak, S.; Villegas, L.; Barnwell, J.W.; Escalante, A.A.; Udhayakumar, V. pfmdr1 amplification and fixation of pfcrt chloroquine resistance alleles in Plasmodium falciparum in Venezuela. Antimicrob. Agents Chemother. 2010, 54, 1572–1579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Chen, J.; Xie, D.; Monte-Nguba, S.M.; Eyi, J.U.M.; Matesa, R.A.; Obono, M.M.O.; Ehapo, C.S.; Yang, L.; Lu, D.; et al. High prevalence of pfmdr1 N86Y and Y184F mutations in Plasmodium falciparum isolates from Bioko Island, Equatorial Guinea. Pathog. Glob. Health 2014, 108, 339–343. [Google Scholar] [CrossRef] [Scilit]
- Kayiba, N.K.; Yobi, D.M.; Tshibangu-Kabamba, E.; Tuan, V.P.; Yamaoka, Y.; Devleesschauwer, B.; Mvumbi, D.M.; Okitolonda Wemakoy, E.; De Mol, P.; Mvumbi, G.L.; et al. Spatial and molecular mapping of Pfkelch13 gene polymorphism in Africa in the era of emerging Plasmodium falciparum resistance to artemisinin: A systematic review. Lancet Infect. Dis. 2021, 21, e82–e92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matrevi, S.A.; Opoku-Agyeman, P.; Quashie, N.B.; Bruku, S.; Abuaku, B.; Koram, K.A.; Fox, A.; Letizia, A.; Duah-Quashie, N.O. Plasmodium falciparum kelch propeller polymorphisms in clinical isolates from Ghana from 2007 to 2016. Antimicrob. Agents Chemother. 2019, 63, e00802-19. [Google Scholar] [CrossRef] [Scilit]
- Yobi, D.M.; Kayiba, N.K.; Mvumbi, D.M.; Boreux, R.; Bontems, S.; Kabututu, P.Z.; De Mol, P.; Speybroeck, N.; Mvumbi, G.L.; Hayette, M.P. The lack of K13-propeller mutations associated with artemisinin resistance in Plasmodium falciparum in Democratic Republic of Congo (DRC). PLoS ONE 2020, 15, e0237791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lê, H.G.; Naw, H.; Kang, J.M.; Võ, T.C.; Myint, M.K.; Htun, Z.T.; Lee, J.; Yoo, W.G.; Kim, T.S.; Shin, H.J.; et al. Molecular profiles of multiple antimalarial drug resistance markers in Plasmodium falciparum and Plasmodium vivax in the Mandalay Region, Myanmar. Microorganisms 2022, 10, 2021. [Google Scholar] [CrossRef] [Scilit]
- Plucinski, M.M.; Huber, C.S.; Akinyi, S.; Dalton, W.; Eschete, M.; Grady, K.; Silva-Flannery, L.; Mathison, B.A.; Udhayakumar, V.; Arguin, P.M.; et al. Novel mutation in cytochrome B of Plasmodium falciparum in one of two atovaquone-Proguanil treatment failures in travelers returning from same site in Nigeria. Open Forum Infect. Dis. 2014, 1, ofu059. [Google Scholar] [CrossRef] [Scilit]
- Bahk, Y.Y.; Lee, H.W.; Na, B.K.; Kim, J.; Jin, K.; Hong, Y.S.; Kim, T.S. Epidemiological characteristics of re-emerging vivax malaria in the Republic of Korea (1993–2017). Korean J. Parasitol. 2018, 56, 531–543. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.-Y.; Goo, Y.-K.; Zo, Y.-G.; Ji, S.-Y.; Trimarsanto, H.; To, S.; Clark, T.G.; Price, R.N.; Auburn, S. Further evidence of increasing diversity of Plasmodium vivax in the Republic of Korea in recent years. PLoS ONE 2016, 11, e0151514. [Google Scholar] [CrossRef] [Scilit]
- Bahk, Y.Y.; Kim, J.; Ahn, S.K.; Na, B.K.; Chai, J.Y.; Kim, T.S. Genetic diversity of Plasmodium vivax causing epidemic malaria in the Republic of Korea. Korean J. Parasitol. 2018, 56, 545–552. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. World Malaria Report 2022; World Health Organization: Geneva, Switzerland, 2022; Available online: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022 (accessed on 20 April 2026).
- White, M.T.; Karl, S.; Battle, K.E.; Hay, S.I.; Mueller, I.; Ghani, A.C. Modelling the contribution of the hypnozoite reservoir to Plasmodium vivax transmission. eLife 2014, 3, e04692. [Google Scholar] [CrossRef] [Scilit]
- Korea Disease Control and Prevention Agency. A Guideline for Malaria Prevention and Control; Korea Disease Control and Prevention Agency: Cheongju, Republic of Korea, 2025. Available online: https://www.kdca.go.kr/sites/eng/index.do (accessed on 20 April 2026).
- Park, S.Y.; Park, Y.S.; Park, Y.; Kwak, Y.G.; Song, J.E.; Lee, K.S.; Cho, S.H.; Lee, S.E.; Shin, H.I.; Yeom, J.S. Increasing malaria parasite clearance time after chloroquine therapy, South Korea, 2000–2016. Emerg. Infect. Dis. 2020, 26, 1852–1855. [Google Scholar] [CrossRef] [Scilit]
- Na-Bangchang, K.; Congpuong, K. Current malaria status and distribution of drug resistance in East and Southeast Asia with special focus to Thailand. Tohoku J. Exp. Med. 2007, 211, 99–113. [Google Scholar] [CrossRef] [Scilit]
- Park, J.-W.; Jun, G.; Yeom, J.-S. Plasmodium vivax malaria: Status in the Republic of Korea following reemergence. Korean J. Parasitol. 2009, 47, S39–S50. [Google Scholar] [CrossRef] [Scilit]
- Faway, E.; Musset, L.; Pelleau, S.; Volney, B.; Casteras, J.; Caro, V.; Menard, D.; Briolant, S.; Legrand, E. Plasmodium vivax multidrug resistance-1 gene polymorphism in French Guiana. Malar. J. 2016, 15, 540. [Google Scholar] [CrossRef] [Scilit]
- Khattak, A.A.; Venkatesan, M.; Khatoon, L.; Ouattara, A.; Kenefic, L.J.; Nadeem, M.F.; Nighat, F.; Malik, S.A.; Plowe, C.V. Prevalence and patterns of antifolate and chloroquine drug resistance markers in Plasmodium vivax across Pakistan. Malar. J. 2013, 12, 310. [Google Scholar] [CrossRef] [Scilit]
- Ngwana-Joseph, G.C.; Phelan, J.E.; Manko, E.; Dombrowski, J.G.; da Silva Santos, S.; Suarez-Mutis, M.; Vélez-Tobón, G.; Tobón Castaño, A.; Machado, R.L.D.; Marinho, C.R.F.; et al. Genomic analysis of global Plasmodium vivax populations reveals insights into the evolution of drug resistance. Nat. Commun. 2024, 15, 10771. [Google Scholar] [CrossRef] [Scilit]
- Brega, S.; Meslin, B.; de Monbrison, F.; Severini, C.; Gradoni, L.; Udomsangpetch, R.; Sutanto, I.; Peyron, F.; Picot, S. Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity. J. Infect. Dis. 2005, 191, 272–277. [Google Scholar] [CrossRef] [Scilit]
- Apinjoh, T.O.; Mugri, R.N.; Miotto, O.; Chi, H.F.; Tata, R.B.; Anchang-Kimbi, J.K.; Fon, E.M.; Tangoh, D.A.; Nyingchu, R.V.; Jacob, C.; et al. Molecular markers for artemisinin and partner drug resistance in natural Plasmodium falciparum populations following increased insecticide treated net coverage along the slope of Mount Cameroon: Cross-sectional study. Infect. Dis. Poverty 2017, 6, 136. [Google Scholar] [CrossRef] [Scilit]
- Ikegbunam, M.N.; Nkonganyi, C.N.; Thomas, B.N.; Esimone, C.O.; Velavan, T.P.; Ojurongbe, O. Analysis of Plasmodium falciparum Pfcrt and Pfmdr1 genes in parasite isolates from asymptomatic individuals in Southeast Nigeria 11 years after withdrawal of chloroquine. Malar. J. 2019, 18, 343. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Zhang, X.; Chen, H.; Zhang, J.; Lu, Q.; Ruan, W.; Wang, X. Molecular markers associated with drug resistance in Plasmodium falciparum parasites in central Africa between 2016 and 2021. Front. Public Health 2023, 11, 1239274. [Google Scholar] [CrossRef] [Scilit]
- de Abreu-Fernandes, R.; de Queiroz, L.T.; Almeida-de-Oliveira, N.K.; de Lavigne Mello, A.R.; de Aguiar Barros, J.; Pratt-Riccio, L.R.; Melo, G.C.; Brasil, P.; Daniel-Ribeiro, C.T.; Menard, D.; et al. Tracking drug resistance in Plasmodium falciparum: Genetic diversity of key resistance markers in Brazilian malaria hotspots. Int. J. Mol. Sci. 2025, 26, 5977. [Google Scholar] [CrossRef] [Scilit]
- Patrick, O.J.; Amodu, O.K.; Sokan-Adeaga, A.A.; Sokan-Adeaga, M.A.; Kotera, Y. Prevalence and distribution of Plasmodium falciparum multidrug resistant 1 D1246Y allele among children in Ibadan Southwest, Nigeria. Sci. Rep. 2025, 15, 9715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Loon, W.; Bergmann, C.; Habarugira, F.; Tacoli, C.; Savelsberg, D.; Oliveira, R.; Mbarushimana, D.; Ndoli, J.; Sendegeya, A.; Bayingana, C.; et al. Changing pattern of Plasmodium falciparum pfmdr1 gene polymorphisms in southern Rwanda. Antimicrob. Agents Chemother. 2021, 65, e0090121. [Google Scholar] [CrossRef] [Scilit]
- Ndwiga, L.; Kimenyi, K.M.; Wamae, K.; Osoti, V.; Akinyi, M.; Omedo, I.; Ishengoma, D.S.; Duah-Quashie, N.; Andagalu, B.; Ghansah, A.; et al. A review of the frequencies of Plasmodium falciparum Kelch 13 artemisinin resistance mutations in Africa. Int. J. Parasitol. Drugs Drug Resist. 2021, 16, 155–161. [Google Scholar] [CrossRef] [Scilit]
- Osoti, V.; Wamae, K.; Musau, M.M.; Magudha, J.B.; Ndwiga, L.; Gichuki, P.M.; Okoyo, C.; Rosebella, K.; Mahugu, S.; Aricha, S.; et al. Serial cross-sectional school surveys identifies C469Y, P553L, R561H and A675V kelch 13 mutations associated with artemisinin resistance in Western Kenya. Sci. Rep. 2025, 15, 38303. [Google Scholar] [CrossRef] [Scilit]
- L’Episcopia, M.; Talha, A.A.; Nour, B.Y.M.; Sana, I.M.A.; Caspar, E.; Thiebaut, L.; Platon, L.; Chala, B.; Ma, L.; Golassa, L.; et al. High prevalence of artemisinin-resistant Plasmodium falciparum, Southeastern Sudan. Emerg. Infect. Dis. 2025, 31, 1211–1215. [Google Scholar] [CrossRef] [Scilit]
- Molina-de la Fuente, I.; Sagrado Benito, M.J.; Ousley, J.; Gisbert, F.B.; García, L.; González, V.; Benito, A.; Chol, B.T.; Julla, A.; Bakri, A.; et al. Screening for K13-propeller mutations associated with artemisinin resistance in Plasmodium falciparum in Yambio County (Western Equatoria State, South Sudan). Am. J. Trop. Med. Hyg. 2023, 109, 1072–1076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sá, J.M.; Yamamoto, M.M.; Fernandez-Becerra, C.; de Azevedo, M.F.; Papakrivos, J.; Naudé, B.; Wellems, T.E.; Del Portillo, H.A. Expression and function of pvcrt-o, a Plasmodium vivax ortholog of pfcrt, in Plasmodium falciparum and Dictyostelium discoideum. Mol. Biochem. Parasitol. 2006, 150, 219–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bennett, J.W.; Pybus, B.S.; Yadava, A.; Tosh, D.; Sousa, J.C.; McCarthy, W.F.; Deye, G.; Melendez, V.; Ockenhouse, C.F. Primaquine failure and cytochrome P-450 2D6 in Plasmodium vivax malaria. N. Engl. J. Med. 2013, 369, 1381–1382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silvino, A.C.R.; Kano, F.S.; Costa, M.A.; Fontes, C.J.F.; Soares, I.S.; de Brito, C.F.A.; Carvalho, L.H.; Sousa, T.N. Novel insights into Plasmodium vivax therapeutic failure: CYP2D6 activity and time of exposure to malaria modulate the risk of recurrence. Antimicrob. Agents Chemother. 2020, 64, e02056-19. [Google Scholar] [CrossRef] [Scilit]


| Gene | Primer | Sequence (5′ to 3′) | PCR-Fragment Size | Mutation | |
|---|---|---|---|---|---|
| Pvmdr-1 | mdr-2F | CAGCCTGAAGATTTAGAAGCCTT | 539 | S513R, S515R, T529, Y541C, I636T | |
| mdr-2R | CATCCACGTCCACAGTGGAAC | ||||
| 1981F | GTGGACGTGGATGTGCTGGGCGA | 900 | G698S, A829V, L845F, M908L | ||
| 2880R | CATGACCGTACTCACAAGGAAGA | ||||
| mdr-3F | GGATAGTCATGCCCCAGGATTG | 604 | T958M, Y976F, K997R, L1022, F1076L | ||
| mdr-3R | CATCAACTTCCCGGCGTAGC | ||||
| mdr-7F | GATGAGCCTGCTGATGCGATTCTAC | 745 | E1233, S1358, K1393N, E1396 | ||
| mdr-5R | ATATACGCCGTCCTGCACCGAG | ||||
| Pfmdr-1 | 1st PCR | Pfmdr-86-1F | TTAAATGTTTACCTGCACAACATAGAAAATT | 612 | N86Y, E130K, Y184F |
| Pfmdr-86-1R | CTCCACAATAACTTGCAACAGTTCTTA | ||||
| 2nd PCR | Pfmdr-86-2F | TGTATGTGCTGTATTATCAGGA | 526 | ||
| Pfmdr-86-2R | CTCTTCTATAATGGACATGGTA | ||||
| 1st PCR | Pfmdr-1034-1F | AATTTGATAGAAAAAGCTATTGATTATAA | 880 | S1034C, N1024D, V1109I, D1246Y | |
| Pfmdr-1034-1R | TATTTGGTAATGATTCGATAAATTCATC | ||||
| 2nd PCR | Pfmdr-1034-2F | GAATTATTGTAAATGCAGCTTTA | 799 | ||
| Pfmdr-1034-2R | GCAGCAAACTTACTAACACG | ||||
| PfK13 | 1st PCR | K13-0F | GGGAATCTGGTGGTAACAGC | 2097 | R471, Y493H, V494I, S522C, V534A, R539T, I543T, R575, A578S, C580Y, F583L, V589I, R622I, A675V |
| K13-0R | CGGAGTGACCAAATCTGGGA | ||||
| 2nd PCR | K13-1F | GCCTTGTTGAAAGAAGCAGA | 849 | ||
| K13-1R | GCCAAGCTGCCATTCATTTG | ||||
| Pfcyt-b | cyt-b1 | CTCTATTAATTTAGTTAAAGCACA | 939 | Y268S/C/N | |
| cyt-b2 | ACAGAATAATCTCTAGCACC | ||||
| Step | Pvmdr-1 | Pfmdr-1 and PfK13 | Pfcyt-b | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Pre-denaturation | 95 °C | 5 min | 1 cycle | 95 °C | 5 min | 1 cycle | 95 °C | 5 min | 1 cycle |
| Cycle | 95 °C | 1 min | 35 cycles | 95 °C | 30 s | 35 cycles | 95 °C | 50 s | 50 cycles |
| 58 °C | 30 s | 58 °C | 30 s | 55 °C | 50 s | ||||
| 72 °C | 1 min | 72 °C | 1 min | 72 °C | 1 min | ||||
| Final extension | 72 °C | 10 min | 1 cycle | 72 °C | 10 min | 1 cycle | 72 °C | 10 min | 1 cycle |
| Year | Group | N | S513R | S515R | T529 | Y541C | G698S | A829V | L845F | M908L | T958M | F1076L | E1233 | S1358 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2022 | Soldier | 34 | - | 34 | 24 | - | 34 | - | 34 | 34 | 34 | 34 | 12 | 1 |
| Relapse (Soldier) | 12 (1) | - | 12 (1) | 5 (1) | - | 12 (1) | - | 12 (1) | 12 (1) | 12 (1) | 12 (1) | 6 (1) | - | |
| Imported | 1 | - | 1 | 1 | - | - | 1 | - | 1 | 1 | 1 | - | - | |
| 2023 | Soldier | 49 | - | 49 | 22 | 2 | 49 | - | 49 | 49 | 49 | 49 | 24 | - |
| Relapse | 14 | - | 14 | 6 | - | 14 | - | 14 | 14 | 14 | 14 | 9 | - | |
| Imported | 4 | 2 | 4 | 4 | - | 3 | - | 2 | 4 | 4 | 4 | - | - | |
| 2024 | Soldier | 76 | - | 76 | 43 | - | 76 | - | 76 | 76 | 76 | 76 | 40 | - |
| Relapse | 18 | - | 18 | 7 | - | 18 | - | 18 | 18 | 18 | 18 | 12 | - | |
| 2025 | Soldier | 27 | - | 27 | 10 | - | 27 | - | 27 | 27 | 27 | 27 | 13 | - |
| Relapse (Soldier) | 25 (1) | - | 25 (1) | 11 (0) | - | 25 (1) | - | 25 (1) | 25 (1) | 25 (1) | 25 (1) | 10 (1) | - | |
| Total | 260 | 2 | 260 | 133 | 2 | 258 | 1 | 257 | 260 | 260 | 260 | 126 | 1 | |
| Gene | Pfmdr-1 | PfK13 | ||||
|---|---|---|---|---|---|---|
| Year | Group | N | Traveled Country | Y184F Mutation | D1246Y Mutation | A675V Mutation |
| 2022 | Soldier | 5 | South Sudan | 4 | - | 2 |
| 2023 | Soldier | 13 | South Sudan | 13 | - | 8 |
| Civilian | 17 | Gabon, Ghana, Guinea, Liberia, Nigeria, Republic of South Africa, Sudan, Tanzania, Uganda | 13 | - | - | |
| 2024 | Soldier | 3 | South Sudan | 3 | - | - |
| Civilian | 16 | Burkina Faso, Cameroon, Cote d’Ivoire, DR Congo, Ethiopia, Ghana, Japan, Kenya, Madagascar, Nigeria, Republic of South Africa, Tanzania, Uganda | 8 | - | - | |
| 2025 | Soldier | 6 | South Sudan | 6 | - | 4 |
| Civilian | 16 | Angola, Burkina Faso, Cameroon, Cote d’Ivoire, Equatorial Guinea, Nigeria, Rwanda, Senegal, Uganda | 8 | 1 | - | |
| Total | 76 | 55 | 1 | 14 | ||
| Gene | Mutation | Soldier (n/N, %) | Relapse (n/N, %) | Imported (n/N, %) | p-Value |
|---|---|---|---|---|---|
| Pvmdr-1 | S513R | 0/186 (0.0) | 0/69 (0.0) | 2/5 (40.0) | 0.0007 |
| S515R | 186/186 (100) | 69/69 (100) | 5/5 (100) | >0.99 | |
| T529 | 99/186 (53.2) | 29/69 (42.0) | 5/5 (100) | 0.018 | |
| Y541C | 2/186 (1.1) | 0/69 (0.0) | 0/5 (0.0) | >0.99 | |
| G698S | 186/186 (100) | 69/69 (100) | 3/5 (60.0) | 0.0003 | |
| A829V | 0/186 (0.0) | 0/69 (0.0) | 1/5 (20.0) | 0.019 | |
| L845F | 186/186 (100) | 69/69 (100) | 2/5 (40.0) | <0.0001 | |
| M908L | 186/186 (100) | 69/69 (100) | 5/5 (100) | >0.99 | |
| T958M | 186/186 (100) | 69/69 (100) | 5/5 (100) | >0.99 | |
| F1076L | 186/186 (100) | 69/69 (100) | 5/5 (100) | >0.99 | |
| E1233 | 89/186 (47.8) | 37/69 (53.6) | 0/5 (0.0) | 0.032 | |
| S1358 | 1/186 (0.5) | 0/69 (0.0) | 0/5 (0.0) | >0.99 |
| Gene | Mutation | Soldier (n/N, %) | Civilian (n/N, %) | p-Value |
|---|---|---|---|---|
| Pfmdr-1 | Y184F | 26/27 (96.3) | 29/49 (59.2) | 0.0008 |
| D1246Y | 0/27 (0.0) | 1/49 (2.0) | >0.99 | |
| PfK13 | A675V | 14/27 (51.9) | 0/49 (0.0) | <0.0001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Jung, H.; Shin, H.-I.; Ku, B.; Park, E.; Lee, M.-R.; Ju, J.-W.; Lee, H.-I. Molecular Surveillance of Plasmodium vivax and Plasmodium falciparum Drug Resistance Genes in the Republic of Korea: 2022–2025. Pathogens 2026, 15, 508. https://doi.org/10.3390/pathogens15050508
Jung H, Shin H-I, Ku B, Park E, Lee M-R, Ju J-W, Lee H-I. Molecular Surveillance of Plasmodium vivax and Plasmodium falciparum Drug Resistance Genes in the Republic of Korea: 2022–2025. Pathogens. 2026; 15(5):508. https://doi.org/10.3390/pathogens15050508
Chicago/Turabian StyleJung, Haneul, Hyun-Il Shin, Bora Ku, Esther Park, Myoung-Ro Lee, Jung-Won Ju, and Hee-Il Lee. 2026. "Molecular Surveillance of Plasmodium vivax and Plasmodium falciparum Drug Resistance Genes in the Republic of Korea: 2022–2025" Pathogens 15, no. 5: 508. https://doi.org/10.3390/pathogens15050508
APA StyleJung, H., Shin, H.-I., Ku, B., Park, E., Lee, M.-R., Ju, J.-W., & Lee, H.-I. (2026). Molecular Surveillance of Plasmodium vivax and Plasmodium falciparum Drug Resistance Genes in the Republic of Korea: 2022–2025. Pathogens, 15(5), 508. https://doi.org/10.3390/pathogens15050508

