Next Article in Journal
The Emerging JEV Genotype 5 Exhibits Distinct Codon Usage Characteristics
Previous Article in Journal
Occurrence of Citrobacter spp.-Associated and Non-Associated Lesions in a Stranded Loggerhead Sea Turtle (Caretta caretta) from Italy
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis

by
Jesús Gabriel León-Beltrán
1,
Sarita Montaño
1,
Rossana Arroyo
2,
Daniela Estrada-Ramírez
1,
Nidia León-Sicairos
1,
Adrián Canizalez-Román
1,
María Angélica Sánchez-González
1,
José Antonio Garzón-Tiznado
1 and
Claudia León-Sicairos
1,*
1
Programa Regional del Noroeste para el Posgrado en Biotecnología de la Facultad de Ciencias Químico-Biológicas, Universidad Autónoma de Sinaloa, Av. de las Américas y Josefa Ortíz (Cd. Universitaria), Culiacán 80030, Mexico
2
Departamento de Infectómica y Patogénesis Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav), Av. IPN No. 2508, Colonia San Pedro Zacatenco, Mexico City 07360, Mexico
*
Author to whom correspondence should be addressed.
Pathogens 2026, 15(1), 57; https://doi.org/10.3390/pathogens15010057
Submission received: 24 November 2025 / Revised: 21 December 2025 / Accepted: 31 December 2025 / Published: 7 January 2026

Abstract

Protozoa use iron to grow, feed, and cause harm through elaborate mechanisms to obtain it from the host. In addition, expression of virulence genes is affected by iron. In Entamoeba histolytica, the parasite that causes amoebic dysentery and complications in human organs, our group have previously reported the presence of an IRE/IRP-like (Iron Responsive Element/Iron Regulatory Protein) mechanism. Giardia duodenalis is another parasite of medical interest that causes giardiasis, including nutrient malabsorption syndrome and dysbiosis, among other complications, such as anemia in children with giardiasis. Moreover, expression of many putative giardial virulence factors by free-iron levels has been reported. Recently, we have reported stem-loop structures in some mRNAs coding virulence proteins from both parasites. However, much remains to be studied about the role of iron in pathogenesis. In this review, we summarize several aspects of gene expression regulation by iron in these protozoa as well as an iron regulatory mechanism in E. histolytica and discuss the possibility of an iron regulatory IRE/IRP-like mechanism in G. duodenalis.

1. Introduction

Protozoan parasites are responsible for human mortality and morbidity, causing a significant health and economic burden worldwide. Some of them have complex life cycles in multiple hosts and must initiate complex developmental programs in response to environmental cues including stress and transition to different hosts or their defenses. Many protozoan parasites use antigenic variation to elude the host immune response. Two protozoa responsible for intestinal diseases with great impact on public health worldwide are Entamoeba histolytica and Giardia duodenalis, causative agents of amoebiasis and giardiasis, respectively. Both parasitoses have great epidemiological and clinical importance due to their high morbidity and pathogenicity [1,2]. Amoebiasis is the second leading cause of death from parasitic disease worldwide. It is a major public health problem due to poor sanitation that contaminates drinking water and food with feces [3,4]. E. histolytica causes up to 100,000 deaths worldwide each year. Human amoebiasis is mainly characterized by local dysentery (bloody intestinal diarrhea) and in extreme cases invasive extraintestinal disease, including peritonitis and liver, pulmonary, and brain abscesses [5,6]. Giardiasis is caused by the flagellate protozoan parasite G. duodenalis, the most common protozoal infection in humans. In fact, Giardia has eight assemblies ranging from A to H; A and B infect humans, while C to H assemblies can infect domestic animals such as dogs and cats [7]. G. duodenalis is an important cause of waterborne and foodborne diarrhea, day-care center outbreaks, and traveler’s diarrhea. The disease is included in the World Health Organization (WHO) neglected diseases initiative owing to its burden and association with poverty [8]. This parasite is responsible for 280 million symptomatic infections per year. The outcome of giardiasis can vary: the infection may remain asymptomatic or lead to severe and sometimes persistent symptoms such as irritable bowel syndrome and dysbiosis [7,8,9,10,11,12].
Iron is an essential element for all living organisms and functions as a cofactor in many biochemical activities, including DNA synthesis, oxygen transport, and cellular respiration. Iron deficiency can cause cellular death, whereas iron excess is potentially toxic causing oxidative stress [13]. Therefore, the iron concentration in the cell must be carefully regulated. The IRE/IRP system (Iron Responsive Element/Iron Regulatory Protein) is an iron regulatory mechanism at the posttranscriptional level that has been widely studied in higher eukaryotes. It specializes in maintaining iron homeostasis in cells for optimal functioning. In recent years, this study has been extended to protozoan parasites [14,15,16] that use iron-regulated virulence genes to obtain iron from the host to feed, survive, and cause damage. Iron is an important factor for E. histolytica growth, adherence, and cytotoxicity, and it modulates its gene expression [17,18]. Iron is also an essential component of E. histolytica enzymes [19], such as iron superoxide dismutase (FeSOD) and hemoglobinases [4,20,21]. Our research group has reported IRE-like structures in the untranslated-regions (UTRs) from mRNA coding virulence factors. These mRNA stem-loop structures specifically bind to human IRP and amoebic cytoplasmic proteins in low iron conditions, suggesting the presence of an IRE/IRP-like regulatory system in E. histolytica [4,16]. Recently, in G. duodenalis an iron effect in the expression of many putative giardial virulence factors in RNAseq experiments has been reported [22], as well as the presence of stem-loop structures in some of the mRNA encoding virulence factors [23]. In other protozoans such as Trichomonas vaginalis, the causal agent of trichomonasis, the most common sexually transmitted infection, the presence of IRE-like structures in some iron differentially regulated mRNAs [14,15,24], as well as atypical RNA-binding proteins under iron-restricted conditions that bind to these structures have been reported [25]. Despite having found stem-loop structures in these three parasites with similar motifs, an IRP/aconitase homolog sequence has not been found in their genomes, suggesting the presence of multifunctional proteins with RNA-binding functions, such as Tvactinin-3 and TvHSP70 in T. vaginalis [14,15,24,25]. Thus, much remains to be understood about the iron regulatory mechanism in these parasites. In this review, we highlight the importance of iron gene regulation and discuss the presence of a putative iron regulatory mechanism mainly in E. histolytica and G. duodenalis. In addition, in silico analysis related to possible RNA–protein interactions in Giardia is presented and discussed. It is the protozoan with the fewest studies on this subject, in spite of the fact that in this parasite the growth and expression of several virulence genes are also affected by iron.

2. Mechanisms of Pathogenicity and Virulence Factors in E. histolytica

For E. histolytica to cause disease, multiple mechanisms are needed. Trophozoites adhere to host mucous and epithelial cells and secrete multiple cysteine proteases (CPs), which degrade mucin and extracellular matrix, and they also kill host cells through a contact-dependent process. This parasite also invades and phagocytizes red blood cells and nucleated host cells [26]. The principal mediator of adherence is the amebic Gal/GalNAc lectin which participates in adherence and cytotoxicity of trophozoites to mammalian cells, erythrophagocytosis, and liver abscess formation in hamsters [27,28,29,30].
Other molecules involved in the adhesion process of E. histolytica have been reported, such as cysteine and serine proteases and the EhCPADH complex [31,32], lectin 220, a protein enriched with lysine and glutamic acid (KERP1), Pyruvate: ferredoxin oxidoreductase (PFO), and a rhomboid protein (EhROM) [5,33].
E. histolytica excretory-secretory products (ESPs) may play critical roles during invasion. The non-pathogenic Rahman strain showed reduced secretion of Enolase 1, alcohol dehydrogenase, transketolase, malic enzyme, phosphoglucose mutase, superoxide dismutase (SOD), and PFO. Some of these proteins control carbohydrate metabolism but may have other moonlighting effects [34,35].
Most of the antioxidant activity of E. histolytica against reactive oxygen species (ROS) generated by neutrophils and macrophages from the host is dependent on two proteins, a peroxiredoxin and the iron-dependent superoxide dismutase (FeSOD) [36]. Overexpression of peroxiredoxin in the avirulent Rahman strain restores its resistance to oxidative stress and its ability to cause colitis [37]. High-oxygen-exposed E. histolytica lysates showed up-regulation on mRNAs of the thiol-dependent peroxidase (Eh29), FeSOD, and heat shock protein 70 (HSP70) [38].
CPs of E. histolytica in addition to participating in adherence to enterocytes are important for combating host defenses and favor the infection process. The expression of six CPs (EhCP1–EhCP6) under iron-restricted conditions was increased [17,18]. The most highly expressed CPs are EhCP1, EhCP2, and EhCP5, which are responsible for ~90% of enzymatic activity [4,17,18].
Most virulent E. histolytica trophozoites can invade and produce liver abscesses. These trophozoites show up-regulation of genes encoding heat shock proteins, which are molecular chaperones that allow cells to survive during stress by maintaining proper protein folding [39]. When invasive disease occurs by an E. histolytica infection, there is a potent cytotoxic activity. The parasite kills and ingests host cells in a contact-dependent manner using Gal/GalNAc lectins. Tissue damage is also augmented by parasite proteases and inflammatory host immune reactions [34,40]. E. histolytica secretes macrophage migration inhibitory factor (EhMIF) that promotes mucosal inflammation, resulting in an increased production of matrix metalloproteinases that break down extracellular matrix in the gut to promote cell migration. These changes allow immune cells infiltration, generating ROS to kill the parasite. Free radicals are responsible for collateral tissue damage while E. histolytica may be able to evade the immune response [41]. After degradation of epithelial cells, the parasite navigates through extracellular matrix for dissemination to the extra-intestinal sites. Moreover, E. histolytica requires glycosidases and proteases for the basement membrane disintegration and entry into the circulation [40].

3. Mechanisms of Pathogenicity and Virulence Factors in G. duodenalis

Giardia is a non-invasive parasite which infects the small intestine and colonizes the lumen and epithelial surface. Trophozoites attach to epithelial cells and induce shortening of microvilli. The parasite targets specific signaling networks that activate apoptosis, leading to the loss of intercellular junctions, barrier function, and cytoskeletal rearrangement, which contribute to diarrhea [42]. Some virulence factors have been identified in the parasite, such as the adhesive disk and the four flagella [43,44]. The giardial ventral disk mediates reversible parasite attachment to the host intestinal microvilli. This attachment allows Giardia to resist peristalsis and remain in the gut [44,45,46]. The disk is primarily composed of ankyrins and novel hypothetical proteins that have no homology to proteins outside of Giardia species. Early biochemical studies reported the presence of proteins termed “giardins” [46,47]. There are different giardin classes of proteins (alpha-, beta-, gamma-, and delta-giardins) [48]. Recombinant alpha-1 giardin binds thin sections of human small intestine to the apical surface of epithelial cells but also other cellular structures rich in glycosaminoglycans. It has been suggested that this protein may play a role in early host–parasite interactions [48].
Virulence factors are necessary in giardiasis pathogenesis. The contact between G. duodenalis and the small intestine epithelium might induce the secretion of some of these factors, such as CPs, variant surface-proteins (VSPs), ESPs, tenascins, and high cysteine membrane proteins (HCMPs). Attached parasites can counteract host defenses by up-regulating their protein ubiquitination and antioxidant responses [22,49].
Although some molecules implicated in the adhesion mechanism remain incompletely understood, some attachment models have been established, such as ligand-specific, ligand-independent, and suction-mediated mechanisms [50]. However, none of them could completely explain the attachment of Giardia. Studies indicate that host–parasite interactions are stimulatory, inducing expression of parasite factors, which have limited or no expression in axenic culture alone. Parasites exposed to host soluble factors triggered up-regulation of membrane and secreted proteins, including cathepsin-B precursor, cystatin, tenascins, and VSPs, promoting a motile population, potentially to continue its migration through the gut to a less hostile environment. Trophozoites attached to host cells respond by up-regulating intracellular pathways involved in disappearance of ROS, anticipating host defense response [51].
Parasites produce ESPs that include secreted proteins, released surface proteins, and extracellular vesicles (EVs). These ESPs affect gene expression, signaling, metabolism, secretion, and immune responses of intestinal epithelial cells (IECs) and parasite attachment induce stronger and more complex responses [52]. It has been reported that Giardia EVs have relevant virulence factors such as arginine metabolizing enzymes, cathepsin-B, and VSPs, as well as giardins, katanin, and ankyrin repeat proteins, which have prominent adhesion roles [53]. VSPs can undergo antigenic variation, their size ranging from 60 to 180 kDa. The vsp gene repertoire has been estimated at 270 to 300, about 4% of the genome. These proteins appear to play a role in immune evasion and protect the trophozoites from intestinal proteases. The mechanism for switching the expression of one vsp gene to another remains to be determined. Although, there is evidence supporting two mechanisms: lysine acetylation, which limits expression to even one allele of four and an RNAi system that limits expression at a posttranscriptional level [54,55].
G. duodenalis lacks some of the conventional mechanisms of the oxidative stress management system, including SOD, catalase, peroxidase, and glutathione cycling, which are present in most eukaryotes [56]. However, it possesses alternative antioxidants, such as NADH oxidase and a flavoprotein, which can detoxify oxygen to form water; SOR (superoxide reductase) that converts superoxide to hydrogen peroxide; some peroxiredoxins with the ability to detoxify hydrogen peroxide to form oxygen and water; and low molecular weight thiols. It has also been reported that on albendazole-resistant Giardia, NADH oxidase, and peroxiredoxin are overexpressed. Moreover, the role of pyruvate against oxidative stress in G. duodenalis, exerting antioxidant activity, was reported in some studies [57,58,59].
There are still questions around G. duodenalis adhesion and the molecules that participate in this mechanism. Our research group identified some possible ortholog adhesin proteins using the tool BLAST in GiardiaDB website; protein sequences for adhesin from E. histolytica and T. vaginalis were used to perform the BLAST analysis with the most recent giardial genome sequence reported [60]. Among the most important sequences obtained from GiardiaDB database were two pyruvate, flavodoxin oxidoreductase (GL50803_0017063, GL50803_00114609) that share homology with PFO from both E. histolytica and T. vaginalis, a malate dehydrogenase (GL50803_0014285) sharing homology with T. vaginalis AP65 (adhesin protein 65), and some cathepsins B and cathepsins L that share homology with E. histolytica cysteine proteases (EhCP1, EhCP2, and EhCP5). Along with BLAST from GiardiaDB, an analysis with ClustalW was performed to obtain the similarity between the sequences from Giardia genome and the other parasites (Table 1).
Another of the main mechanisms by which G. duodenalis can invade and produce illness is the releasing of substances with cytotoxic effects against the host, promoting cytoskeleton and cell membrane degradation, metabolic functions and compound synthesis interruption, and cell division damage. These kinds of substances are regulated by iron in T. vaginalis [14,61,62,63,64] and E. histolytica [65,66,67,68]. Thus, we took several of these sequences from T. vaginalis and E. histolytica as probes to search for possible orthologs in the Giardia genome. When TvCP4, TvCP12, TvCP30, TvCP39, and TvCP65 sequences were used as probes in BLASTp, several possible orthologs of cytotoxicity factors in G. duodenalis proteome were found, among which cathepsin precursors and other cysteine proteases such as cathepsin B and cathepsin L proteins with 18–22% identity were found (Table 2). It is of particular interest to the cathepsin B precursor (GL50803_14019), also known as giardipain-1. It is the most expressed cysteine protease in this parasite, which is able to degrade cell–cell junctional components and induce apoptotic damage in epithelial cells [49,69]. As for E. histolytica EhCP1, EhCP2, and EhCP5 which were used as probes [4], they also showed homology with G. duodenalis’s cathepsins B and L with 18 to 22% identity (Table 2). Remarkably there are some repetitions in the homolog proteins obtained, such as cathepsin B: GL50803_0014019 giardipain-1 [49] and some other cathepsins such as GL50803_0016160. GL50803_0014983, GL50803_0010217, GL50803_0016380, and GL50803_0016468 share homology with multiple CPs from other protozoans, which may suggest that they are virulence factors relevant in G. duodenalis.

4. Iron Regulation in Protozoa

Iron is an essential metal ion for all organisms. It is a known regulator of virulence genes in many bacteria and pathogenic protozoa. Iron is an essential constituent of many proteins in pathogens, such as metabolic, antioxidant enzymes, and virulence factors [70,71]. Tight regulation of iron in mammalian hosts presents an obstacle to invading pathogens. Therefore, protists have evolved efficient mechanisms to exploit host iron sources. Thus, this host–pathogen competition for iron is a deciding factor in the success of an infection.

4.1. E. histolytica

Iron is a necessity for E. histolytica trophozoites; the parasite uses diverse human proteins, such as hemoglobin, holo-lactoferrin, holo-transferrin, and ferritin as sources of iron. It is an important factor for parasite growth, adherence, and cytotoxicity. It also modulates gene expression [4,16,72]. Some of these genes are EhCP1–EhCP6, hemoglobin-binding proteins (Ehhmbp45 and Ehhmbp26), FeSOD, actin, and Acyl-CoA synthetase [4]. Iron concentration also influences cytoadherence and cytotoxicity [17]. In these studies, parasites were cultured in medium prepared without ammonium ferric citrate, treated with 0.5 g per 100 mL Chelex-100 which was removed by filtration, to obtain iron-restricted conditions (6.5 µM). For the iron-rich medium, the BI-S-33 medium was prepared to a final concentration of 250 µM ammonium ferric citrate [4,16,17,72]. There is reported data suggesting the presence of a posttranscriptional iron regulatory IRE/IRP-like mechanism in E. histolytica, supported by specific RNA–protein interactions in RNA electrophoretic mobility shift assays [4,16]. Some key iron-dependent enzymes in amoebas include acetaldehyde/alcohol dehydrogenase-2, ferredoxin, diaphorase, and SOD. Fe-S proteins are also important. They are necessary in energy metabolism and electron transfer in the parasite. E. histolytica can cleave ferritin into several fragments. Three neutral cysteine proteinases (100, 75, and 50 kDa) [20] were observed to degrade ferritin in culture extracts. In addition, amoebae quickly internalized ferritin via clathrin-coated vesicles. E. histolytica trophozoites have the capacity to phagocytose and lyse red blood cells [73] with the purpose of accessing the hemoglobin. Once this protein is available to amoebae, it is cleaved by hemoglobinases, releasing the haem group and amino acids, which are used by the parasite as iron and energy sources for growth. In E. histolytica in vitro cultures have been reported that Lf protein can be either amoebicidal or used as an iron source for growth, depending on the Lf saturation [20]. It has been suggested that E. histolytica uses five pathways to access the host iron: hemophore-like proteins that bind free heme; several transporter families up-regulated in iron-limited conditions; internalizing hololactoferrin, holotransferrin, and ferritin via receptor recognition pathway; and performing phagocytosis of whole erythrocytes and using both ferric and ferrous iron [71].

4.2. G. duodenalis

There is almost no information regarding iron’s direct relationship with G. duodenalis. Recently, a few reports about some genes that are differentially regulated by iron concentration in vitro and stem-loop structures in some mRNA of virulence proteins have been reported [22,23]. Peirasmaki et al. cultured the Giardia trophozoites in a TYDK medium without ferric ammonium citrate and 50 µM of 2-2′ bipyridyl to obtain iron-restricted parasites [22], while our group cultured the trophozoites in a TYI-S-33 medium without ferric ammonium citrate and the Chelex-100 resin (to obtain a 7.7 µM final concentration of iron) as has been reported [16,23]. In addition, based on clinical cases, it appears that infections by the parasite turn out to be related to anemia or iron deficiency, resulting in an improvement of these symptoms when the infection is treated with metronidazole [11,74,75,76]. Thus, a clear relationship with G. duodenalis and iron exists but is not fully understood.
Giardia trophozoites can damage the IECs leading to the malabsorption of water, electrolytes, glucose, and maldigestion due to the loss of digestive enzymes [77,78]. Studies related to trophozoite attachment causes damage to the intestinal epithelial cells [79] and release cysteine proteases, tenancins, metabolic enzymes, HCMPs, and VSPs [10,51,52,80,81,82]. In addition, these studies showed that HCMPs are localized in the trophozoite plasma membrane and are regulated by histone acetylation and levels of free iron in the culture medium [22,82]. The transport of iron within cells of parasitic protists is poorly understood. In G. duodenalis there is a lack of information [77]. Recently, our research group performed a BLASTp analysis to find potential proteins homologs in G. duodenalis genome using T. vaginalis ZIP proteins as probes, which have been suggested to participate in iron and zinc uptake [83]. In addition, a protein from E. histolytica Rab7A was used as a probe, due to its role in endocytosis from early phase holo-transferrin [84]. TvZIP2 and TvZIP4 proteins shared around 16 and 17% identity with GL50803_006664 zinc transporter protein (Table S1 on Supplementary Material File S1). On the other hand, E. histolytica Rab7A protein matched with Rab2a (GL50803_005567), Rab2b (GL50803_0016636), and Rab1a (GL50803_009558) proteins from G. duodenalis with 26–27% identity (Table S1 on Supplementary Material File S1). These alignments may suggest that these proteins may be involved within an iron uptake mechanism in G. duodenalis, similar to that one present in T. vaginalis and E. histolytica; however, further investigation is needed to support this hypothesis.

4.3. Other Protozoa

Trichomonas vaginalis, the protozoan responsible for the sexually transmitted infection trichomoniasis, has high iron requirements. Iron is essential for its metabolism, division and survival [85]. Under iron deficiency T. vaginalis exhibits slow-growing or arrested-growth phenotype since the parasite utilizes iron-dependent metabolic systems to generate energy. The hydrogenosomal energy metabolism of T. vaginalis is upregulated by iron; however, the regulation of glycolysis associated with iron availability remains unclear [86,87].
T. vaginalis utilizes multiple sources of iron: lactoferrin, heme, and hemoglobin. The parasite has multiple iron uptake systems. It has a 136 kDa receptor for binding the host holo-lactoferrin; other receptors bind hemoglobin, heme, and cytochrome C, using AP65 and AP51 adhesins as heme- and hemoglobin-binding proteins [88].
Iron modulates the expression of several virulence factors in T. vaginalis, including adhesins and CPs [24]. Iron also differentially modulates some properties in T. vaginalis such as hemolysis, induction of apoptosis in the host cells, immune evasion, cytotoxicity, and cytoadherence [Adhesin protein 65 (ap65) iron inducible transcription] just by repression or induction of the cysteine proteinases expression [64,88]. The T. vaginalis ap65 gene is regulated at the transcriptional level by an iron responsive promoter that includes an iron-responsive DNA element overlapping with 3′-MYB-like protein-binding sequence [89]. It has been reported that iron depletion in T. vaginalis reduces the protein synthesis and cell density, although it increases the expression of lactoferrin-binding receptor [90]. This parasite resides in an environment with fluctuating iron availability. Thus, mechanisms to respond to iron limitations are important for its adaptation and survival.
Plasmodium falciparum, the causal agent of malaria, is an obligate intracellular parasite that relies on bioavailable iron to meet its nutrient requirements [91]. P. falciparum has an intra-erythrocytic proliferation and uses iron for pyrimidine and heme synthesis; the parasite also needs to balance its need for iron and the cytotoxicity of the metal [92]. Interestingly, P. falciparum metabolizes hemoglobin to acquire amino acids, but it does not utilize that iron. Instead, it uses the cytoplasmic iron pool of red blood cells, iron that is not incorporated into hemoglobin or stored as ferritin [93]. This adds complexity to the relationship between the parasite and iron and may explain the existence of the P. falciparum IRP reported by Loyevsky et al., 2001 [94]. There is still a lot of unknown data about this parasite’s iron biology. To date, the main studies related to iron’s effect on virulence have been focused mainly on these protozoans.

5. The IRE/IRP-like Regulatory System in Protozoan

Iron is essential for all living organisms. Because both the deficiency and the iron overload are harmful, iron absorption, concentration, and redox status should be carefully regulated [95,96,97,98]. The post-transcriptional regulation by the IRE/IRP system is the most studied iron regulatory mechanism in mammalian cells. The IRE/IRP system involves IREs (Iron Responsive Elements) and IRPs (Iron Regulatory Proteins), where under low iron conditions IRPs bind IRE structures, which are stem-loop secondary RNA structures present in the 5′ or 3′ UTR of iron-regulated mRNA. Under low-iron conditions, IRPs modulate the expression of proteins involved in iron metabolism by binding to conserved IREs. The regulatory outcome depends on the position and context of the IRE in the mRNA: an IRP bound to a 5′-UTR IRE represses translation, whereas an IRP bound to a 3′-UTR IRE can indirectly activate translation via the suppression of mRNA degradation. At high iron concentrations, IRP1 acts as a cytosolic aconitase enzyme, whereas IRP2 is degraded. The dual roles of IRP1 link gene regulation in iron homeostasis to the sensing of intracellular iron levels and oxidative stress [99]. The coordinated regulation of the IRE/IRP network enables cells to respond to multiple signals of iron availability and demand in a balanced manner [100,101,102,103].
IREs contain two regions necessary for IRP binding: the consensus CAGUGN loop sequence is most frequently found, and UAGUAN is less common [99]. The contiguous stem sequence, containing either a conserved C nucleotide five bases upstream of the CAGUGN sequence, creates a bulge in the hairpin, or a UGC/C loop-bulge [104]. Numerous studies have reported RNAs with non-canonical loop sequences that still interact with IRPs, even though many of those sequences are mutants of the canonical IREs [105] (Table 3).
This system was first described in humans [95,96,97,98] on mRNAs that code for proteins involved in iron homeostasis. Interestingly, some IRE-like structures were described in the parasite T. vaginalis that were recognized by human IRPs and atypical RNA-binding trichomonad proteins [14,15,24,25]. Moreover, some IRE-like structures were also described in silico for E. histolytica by our research group [16] (Table 3). In addition, certain E. histolytica mRNAs contained IRE-like structures in both the 5′- and 3′-UTR. However, dG (Gibbs free energy or free enthalpy, where, in this case a reduction in dG (negative dG) is a necessary condition for spontaneous structure formation) could help predict which structure is more stable, as well as the up- or down-regulation by iron.
P. falciparum possesses an IRP-like protein that binds consensus IRE sequence and a putative plasmodial IRE; the binding is iron-regulated, and the IRP-like protein has aconitase activity. This regulation is very similar to IRE/IRP system of higher eukaryotic cells [94]. However, there are no more recent studies related to other IRE-like in this protozoon.
Discussion around IRE-like structures not having consensus motifs in the loop as canonical IREs; for example, Senoura et al. 2020 reported that rice aconitase OsACO1 protein potentially has RNA-binding activity with plant ACO-interacting RNA element (PAIR), similar to mammalian IRE, raising the possibility that OsACO1 senses iron status as IRP1 [106]. These PAIR structures conserve a GGUGG motif within the loop, which is also different from consensus motifs reported in IREs. The PAIR-OsACO1 interaction mirrors an IRE-IRP system. Although the RNA structures do not share the consensus motifs, both have proven to be functional [106,107]. This may also be true in other organisms with IRE-like structures.
Furthermore, the presence of some residues was reported for canonical [108] and protozoan IRE-like structures [15] by the Zuker mfold program [109], while iron modulation was reported for some mRNAs. Moreover, the stem-loop structure analysis showed the presence of atypical IREs. Remarkably, the GUU/UUG protozoan-specific motif and a new motif AUU/AUUU were observed in almost all mRNAs analyzed. This new motif could be an amoebic-specific motif. Likewise, all the analyzed structures showed the presence of several motifs. Surprisingly, these sequences were also found in the stem structure, suggesting a possible interaction between an amoebic IRP-like protein and this stem sequence [16].
Given the evolutive closeness that G. duodenalis holds with amoebal and trichomonal parasites, our research group performed an in silico analysis using the Zuker mfold Software [109] in order to search for possible IRE-like structures in the mRNAs of the putative giardial adhesin orthologs obtained by the BLAST analysis and alpha-1 giardin which may have an important role in adhesive mechanisms [110] (Figure 1). The theoretical and in silico analysis were carried out as has been described previously [16], based on regulatory elements reported [111,112,113]. Some of the IRE-like structures found in these genes are within the coding region of the mRNAs, as has been reported in T. vaginalis structures [14], possible due to the short UTR regions of G. duodenalis genome. The IRE-like structures found in our study may be considered non-canonical because the consensus loop sequence of human IRE structures (CAGUGN) was not found. Nevertheless, these hairpins have some specific motifs reported in parasites (GUU/UUG and AUU/UUA) [15,16]. In addition, some of these structures are also predicted by SIREs web server, despite the SIREs web server being based on canonical IREs (human ferritin-IRE) [108].
Moreover, these possible orthologs from cytotoxicity factors (CPs) mentioned before (Table 2) were also analyzed by the Zuker mfold Software [109] and several stem-loop structures were found in the UTRs as well as coding regions (Figure 2). Although, these were not identical to the typical IREs found in higher eukaryotic organisms [108]. The GUU/UUG-protozoa-specific motif was identified in some of these giardial stem-loop structures [15] (Figure 2). It is important to mention that Piccinelli and Samuelsson, 2007 [114], reported a bioinformatic analysis of mRNA sequences for more than 100 novel sequences for ferritin, mitochondrial aconitase, transferrin receptor, ferroportin, and DMT1 from different species [114]. These sequences formed IRE-type structures with the CAGUGN sequence in the loop and, in some IREs, a bulge with the UGC/C nucleotides in the stem with an unpaired cytosine is present. The IRE-like structures from G. duodenalis bioinformatic analysis in this study, despite lacking the canonical CAGUGN sequences in the loop, in some structures, the UGC/C motif was observed (Figure 1 and Figure 2).
To validate these bioinformatic results, interactions between these RNA hairpins and cytoplasmatic proteins from trophozoites grown under different iron conditions are being performed in our lab. Recently, bioinformatic analyses were carried out within the G. duodenalis genome and several IRE-like structures were found in the UTRs from different virulence factors that are modulated by iron, suggesting the presence of an iron regulatory mechanism similar to the IRE/IRP system of higher eukaryotes [23]. Thus, we hypothesized that a similar mechanism to the canonical IRE/IRP system could also exist in G. duodenalis.
Figure 2. Prediction of stem-loop structures of mRNAs coding for possible orthologs from CP cytotoxicity factors of G. duodenalis. The arrows indicate the GUU/UUG-protozoa-specific motif [15]. Boxes indicate the CGU motif [104]. CR, coding region. dG, Gibbs free energy or free enthalpy; in this case, a reduction in dG (negative dG) is a necessary condition for spontaneous structure formation.
Figure 2. Prediction of stem-loop structures of mRNAs coding for possible orthologs from CP cytotoxicity factors of G. duodenalis. The arrows indicate the GUU/UUG-protozoa-specific motif [15]. Boxes indicate the CGU motif [104]. CR, coding region. dG, Gibbs free energy or free enthalpy; in this case, a reduction in dG (negative dG) is a necessary condition for spontaneous structure formation.
Pathogens 15 00057 g002
Table 3. IRE-IRP comparative data between mammalians and protozoans.
Table 3. IRE-IRP comparative data between mammalians and protozoans.
IREsCanonical IREsNon-Canonical IREs
Homo sapiens Ferritin IRE: UUCCUGCUUCAACAGUGCUUGGACGGAA [114]P. falciparum IRE-1: AACUUAUAAAGUUAUAUAAUU [115]
H. sapiens Tfr1 IRE: UAUUUAUCAGUGAGCAGUGCCUCACUAUAAAUG [98]P. falciparum IRE-2: UUCUUGUUAAGUUGAACAAAA [115]
H. sapiens Ferroportin IRE: AACUUCAGCUACAGUGUUAGCUAAGUU [98]T. vaginalis cp4: UCGUUCAGGCACAUGAGCAGA [15]
H. sapiens DMT1 IRE: GCCAUCAGAGCCAGUGUGUUUCUAUGGU [114] T. vaginalis cp12: AACGUAUUUAAUUGAUUGCGAA [15,116]
H. sapiens mACO IRE: UCAUCUUUGUCAGUGCACAAAAUGG [108]E. histolytica Ehhmbp26: AAUAAAUUGAAUUAAUGUUCUCUUUAUU [16]
H. sapiens eALAS IRE: GUUCGUCCUCAGUGCAGGGCAAC [108]G. duodenalis pfo: ACCCGAUUGUUUUCGGGU [23]
IRPsMammalian IRPsSuggested IRP-like
H. sapiens IRP1 (Cytosolic Aconitase) 889 aa [95]P. falciparum: PfIRPa 909 aa (47% homology with human IRP1) [94]
T. vaginalis: TvACTN3 1129 aa (No homology with other IRPs) [25]
H. sapiens IRP2 963 aa [95]T. vaginalis: HSP70 659 aa (No homology with other IRPs) [116]
T. vaginalis: PSP1 124 aa (No homology with other IRPs) [117]
G. duodenalis: Translation Initiation Inhibitor 120aa (Shares homology with PSP1 32.5%) [This study]
Tfr1: Transferrin Receptor 1. DMT1: Divalent Metal Transporter 1. mACO: Mithocondrial Aconitase. eALAS: Erythroid Delta-Aminolevulinate Synthase. TvACTN-3: Tvactinin-3. TvHSP70: Tvheat shock protein 70. Tv-PSP1: Trichomonas vaginalis perchloric-acid-soluble protein. Colored letters indicate consensus motifs. CAGUG is the canonical motif for IREs, and GUU/AUU is found in non-canonical IRE-like structures in protozoans. aa: amino acid.
A lot of questions remain around the IRE/IRP system in protozoan parallel to metazoans. There are multiple reports of non-canonical IRE-like stem-loop structures within the sequence of some virulence factors of these microorganisms [4,15,16,23,116]. Some of these RNA structures interact with proteins, including human IRP and trichomonads proteins such as HSP70 and α-Actinin 3 [116]. Recently Millán-Pacheco et al., 2023 [117] reported a PSP1 protein (Tv-PSP1) in T. vaginalis that binds stem-loop IRE-like and ERE-like structures (eukaryotic initiation factor 5A response element stem-loop which participates in mRNA expression and stability) by RNA electrophoretic mobility shift assays (REMSA). These investigations suggest that even without canonical motifs within these RNA structures exists some type of regulation involving iron and RNA–protein interactions.
We performed BLASTp analysis on the website giardiaDB to identify proteins that share homology with these IRE-like stem-loop RNA-binding proteins (PSP1, HSP70, and α-Actinin 3) in G. duodenalis. Our findings showed proteins with homology between Tv-HSP70 and GL50803_0088765 Cytosolic heat shock protein 70, GL50803_0017121 Bip, and GL50803_0014581 Chaperone protein DnaK HSP70 from G. duodenalis (Table 4). This is expected based on the nature of these proteins. Although, this does not discard the possibility of interaction between these molecules and RNA stem-loop structures. In the case of Tv-PSP1, we found 32.5% homology by ClustalW alignment with translation initiation inhibitor (TII) (GL50803_00480) from G. duodenalis. The alignment shows that the protein TII (GL50803_00480) has some key conserved residues that Tv-PSP1 utilizes to interact with stem-loop structures (Figure 3) [117].
Lastly, we have been performing several in silico analyses, which suggest the presence of an IRE/IRP-like system in G. duodenalis. Recently, based on the hypothesis that Giardia’s PSP-like could be a possible ortholog of T. vaginalis PSP [117] and bioinformatic tools to simulate RNA, we performed docking using ClusPro2.0 [118,119,120,121]. We also used PDBsum to obtain details about interactions between IRE/IRE-like structures and IRP/IRP-like. Structures were either downloaded from the Protein Data Bank (PDB) or modeled by SimRNA for RNA and I-TASSER for proteins (Figure 4) [118,119,120,121,122,123,124,125,126,127,128,129,130]. hIRP (PDB: 2B3X) and IRE wild type (PDB: 1NBR) were used as controls given that it is already experimentally reported that these molecules formed RNA–protein complexes when they interact. The tvcp4 IRE-like structure was also used as a control, since the interaction between this IRE-like structure and hIRP was experimentally shown [14]. Here, we suggest the putative interaction between pfo IRE-like structure of G. duodenalis [23] and hIRP, TvPSP, and GdPSP-like by docking analysis. The docking between IRE-wild type and hIRP analysis was observed; there were eight hydrogen bonds in the stem and unpaired C typical of these structures (Figure S1 on Supplementary Material File S1, Figure 4). There were also five hydrogen bonds on the loop AGUGC (Figure 4A). This matches with the information reported by Volz in 2021 [108] that highlights the AGU region in this interaction. As to the interaction of tvcp4 IRE-like with hIRP there were two hydrogen bonds in the stem; however, the GGCACA loop region showed most of the hydrogen bonds with 13 interactions in this region (Figure 4B and Figure S1 on Supplementary Material File S1). As for the Giardia’s pfo IRE-like structure interaction with hIRP, there were 17 hydrogen bonds around the whole structure; there were 10 hydrogen bonds in the stem and seven in the loop, and most of the nucleotides in that region participated (Figure 4C and Figure S1 on Supplementary Material File S1). The Giardia’s pfo IRE-like structure interaction with G. duodenalis PSP-like (TII) had most of its bonds (12 hydrogen bonds) at the stem and just one at the end of the loop (Figure 4D and Figure S1 on Supplementary Material File S1). In the Giardia’s pfo IRE-like structure’s interaction with T. vaginalis PSP (PDB: 7KGC), there were not as many bonds as in other dockings (eight hydrogen bonds in total, seven in the stem and one in the loop). Interestingly, some of the residues that participate in these interactions were reported by Millán-Pacheco et al., 2023 [117] as important in RNA-binding activity (Figure 4D and Figure S1 on Supplementary Material File S1).
This data suggests that control RNA–protein interactions have bonds on the loop and stem, most of them with positively charged amino acids. This behavior was also observed in the docking with pfo IRE-like structure and proteins tested. It is important to mention that there were some bonds at the beginning and at the end of the RNA structures (5′- and 3′-end), where in vivo may not be possible due to the rest of the RNA around the stem-loops. In general, the behavior observed in these dockings shows the importance of positively charged amino acids in the interactions with the RNA. Most of the bonds included this kind of residue, as expected given the negative charge of the RNA molecule. Multiple interactions were with phosphate groups of the RNA. Some neutral amino acids that form polar bonds also appear in silico RNA–protein interactions (Figure S1 on Supplementary Material File S1).
It is important to mention that the objective of this analysis is not to confirm or determine new IRE-like structures; there are limitations within this in silico analysis. Thus, further experiments such as molecular dynamics simulation and REMSA are necessary to validate these putative RNA–protein interactions predicted by docking analyses. The objective of this analysis is to suggest possible molecules that may be involved in this type of interaction. We will continue investigating the presence of the IRE/IRP-like regulation mechanism by in vitro studies in these protozoan parasites.

6. Conclusions and Perspectives

As we have discussed in this review, iron is an essential cation that can regulate some of the most important functions of protozoan, including its virulence factors. Undoubtedly, there is still work to be done to understand in a broader way the iron regulatory mechanisms employed by these protozoans.
There are more studies in E. histolytica than in G. duodenalis. Recently, studies were published corresponding to the iron effect on the expression of several proteins such as HCMPs [22] as well as in silico analysis showing the presence of IRE-like elements similar to those reported in E. histolytica in their iron-regulated mRNA [16,23]. These reports lead us to hypothesize that an iron mechanism mediated by an IRE/IRP-like regulatory system can occur in both protozoan parasites. IRE-like structures have the GUU/UUG protozoan-specific motif both in the loop and stem [15,16]. In addition, specific sequences to each protozoon have been observed [16,23]. The search for an IRP-like protein in both protozoa presents a more complex challenge, requiring advanced in silico and in vitro methodologies. This is because the proteins interacting with these secondary structures do not exhibit homology to a consensus IRP; instead, they are multifunctional proteins that also bind to RNA [24,25,116,117]. Advances in the study of an IRP in T. vaginalis help us predict which proteins might bind to these IRE-like proteins in E. histolytica and G. duodenalis. Currently, we are carrying out experiments to determine whether these Giardia IRE-like structures can bind IRP-like proteins, such as the recombinant human IRP and cytoplasmic proteins from Giardia trophozoites grown under different iron conditions. Elucidation of these iron regulatory mechanisms will help us to understand the biology of these parasites and, in the future, improve the diagnosis and prevention of E. histolytica and G. duodenalis parasites that continue causing major health problems worldwide. For instance, recently, it has been reported in vivo therapeutic efficacy of polypiridine compounds, PHN-H2 (with iron-binding affinity), can completely cure liver abscess following its administration to E. histolytica-infected hamsters [131]. Another example is the mammalian chelator protein lactoferrin with antiparasitic activity [132] and some studies with the iron-regulated ferredoxin and PFO (responsible for activation of metronidazole in hydrogenosomes) which can activate metronidazole more efficiently in iron-rich conditions [71]. In addition, it has been discussed how microbial iron uptake systems can be used for selective targets to impair iron-dependent virulence mechanisms by nutrient restriction [133]. In consequence, next-generation iron chelators, iron-regulated virulence factors inhibitors, and conventional antimicrobial agents combined exemplify new strategies that modulate iron availability or mimic iron function. A better understanding of iron–pathogen–host interactions can enable the development of next-generation antimicrobials that are both non-toxic and broadly effective. Therefore, a therapy based on the combinations of compounds is a promising alternative.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens15010057/s1, Figure S1: interactions for each modeled RNA-Protein docking of Figure 4A–E, Table S1: Possible Iron uptake proteins homologs in G. duodenalis.

Author Contributions

Conceptualization, C.L.-S., N.L.-S., A.C.-R. and R.A.; methodology, C.L.-S., J.G.L.-B., M.A.S.-G. and D.E.-R.; validation, C.L.-S.; formal analysis, C.L.-S. and R.A.; investigation, C.L.-S. and R.A.; resources, C.L.-S. and J.A.G.-T.; data curation, C.L.-S., R.A. and J.G.L.-B.; writing—original draft preparation, J.G.L.-B., D.E.-R. and C.L.-S.; writing—review and editing, R.A., C.L.-S., J.G.L.-B., S.M., A.C.-R. and N.L.-S.; visualization, C.L.-S. and R.A.; supervision, C.L.-S., N.L.-S., S.M. and R.A. project administration, C.L.-S.; funding acquisition, C.L.-S. and J.A.G.-T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Grants 51241 and 152772 (to C.L.-S.) from National Council of Science and Technology, Mexico (CONACYT) and SEP-CONACYT, Ciencia de Frontera 2019. It was also supported by the Promotion and support program for research projects (PROFAPI) from University Autonomous of Sinaloa (to C.L.-S.). Jesús Gabriel León Beltrán, María Angélica Sánchez-González and Daniela Guadalupe Estrada Ramírez were scholarship recipients from CONACYT (now SECIHTI, Secretaría de Ciencia, Humanidades, Tecnología e Innovación), Mexico.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors are grateful to Jorge Milán-Carrillo and Cuauhtémoc Reyes-Moreno for their great help with equipment and Marian Medina-León and Omar Nahum Medina-León for English language proofreading. Special thanks to all the reviewers for their constructive comments.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Domínguez, M.I. Amebiasis Intestinal y Hepática. Gastroenterol. Latinoam. 2018, 29, 50–53. [Google Scholar]
  2. Vivancos, V.; González-Alvarez, I.; Bermejo, M.; Gonzalez-Alvarez, M. Giardiasis: Characteristics, Pathogenesis and New Insights About Treatment. Curr. Top. Med. Chem. 2018, 18, 1287–1303. [Google Scholar] [CrossRef] [Scilit]
  3. Stanley, S.L., Jr. Amoebiasis. Lancet 2003, 361, 1025–1034. [Google Scholar] [CrossRef] [Scilit]
  4. Gastelum-Martínez, A.; León-Sicairos, C.; Plata-Guzmán, L.; Soto-Castro, L.; León-Sicairos, N.; De La Garza, M. Iron-modulated virulence factors of Entamoeba histolytica. Future Microbiol. 2018, 13, 1329–1341. [Google Scholar] [CrossRef] [Scilit]
  5. Betanzos, A.; Bañuelos, C.; Orozco, E. Host invasion by pathogenic amoebae: Epithelial disruption by parasite proteins. Genes 2019, 10, 618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Marchat, L.A.; Hernández-de la Cruz, O.N.; Ramírez-Moreno, E.; Silva-Cázares, M.B.; López-Camarillo, C. Proteomics approaches to understand cell biology and virulence of Entamoeba histolytica protozoan parasite. J. Proteom. 2020, 226, 103897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Yaoyu, F.; Xiao, L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 2011, 24, 110–140. [Google Scholar] [CrossRef] [Scilit]
  8. Leung, A.K.C.; Leung, A.A.M.; Wong, A.H.C.; Sergi, C.M.; Kamsites, J.K.M. Giardiasis: An overview. Recent Pat. Inflamm. Allergy Drug Discov. 2019, 13, 134–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Mastronicola, D.; Falabella, M.; Forte, E.; Testa, F.; Sarti, P.; Giuffrè, A. Antioxidant defense systems in the protozoan pathogen Giardia intestinalis. Mol. Biochem. Parasitol. 2016, 206, 55–66. [Google Scholar] [CrossRef] [Scilit]
  10. Liu, J.; Ma’ayeh, S.; Peirasmaki, D.; Lundström-Stadelmann, B.; Hellman, L.; Svärd, S.G. Secreted Giardia intestinalis cysteine proteases disrupt intestinal epithelial cell junctional complexes and degrade chemokines. Virulence 2018, 9, 879–894. [Google Scholar] [CrossRef] [Scilit]
  11. Monajemzadeh, S.M.; Monajemzadeh, M. Comparison of iron and hematological indices in Giardia lamblia infection before and after treatment in 102 children in Ahwaz, Iran. Med. Sci. Monit. 2008, 14, 19–23. [Google Scholar]
  12. Adam, R.D. Biology of Giardia lamblia. Clin. Microbiol. Rev. 2001, 14, 447–475. [Google Scholar] [CrossRef] [Scilit]
  13. Aisen, P.; Enns, C.; Wessling-Resnick, M. Chemistry and biology of eukaryotic iron metabolism. Int. J. Biochem. Cell Biol. 2001, 33, 940–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Solano-González, E.; Burrola-Barraza, E.; León-Sicairos, C.; Ávila-González, L.; Gutiérrez-Escolano, L.; Ortega-López, J.; Arroyo, R. The trichomonad cysteine proteinase TVCP4 transcript contains an iron-responsive element. FEBS Lett. 2007, 581, 2919–2928. [Google Scholar] [CrossRef] [Scilit]
  15. Torres-Romero, J.C.; Arroyo, R. Responsiveness of Trichomonas vaginalis to iron concentrations: Evidence for a post-transcriptional iron regulation by an IRE/IRP-like system. Infect. Genet. Evol. 2009, 9, 1065–1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Soto-Castro, L.; Plata-Guzmán, L.Y.; Figueroa-Angulo, E.E.; Calla-Choque, J.S.; Reyes-López, M.; De la Garza, M.; León-Sicairos, N.; Garzón-Tiznado, J.A.; Arroyo, R.; León-Sicairos, C. Iron Responsive-like Elements in the parasite Entamoeba histolytica. Microbiology 2019, 165, 366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Lee, J.; Park, S.J.; Yong, T.S. Effect of iron on adherence and cytotoxicity of Entamoeba histolytica to CHO cell monolayers. Korean J. Parasitol. 2008, 46, 37–40. [Google Scholar] [CrossRef] [Scilit]
  18. Park, S.J.; Lee, S.M.; Lee, J.; Yong, T.S. Differential gene expression by iron-limitation in Entamoeba histolytica. Mol. Biochem. Parasitol. 2001, 114, 257–260. [Google Scholar] [CrossRef] [Scilit]
  19. Wassmann, C.; Hellberg, A.; Tannich, E.; Bruchhaus, I. Metronidazole resistance in the protozoan parasite Entamoeba histolytica is associated with increased expression of iron-containing superoxide dismutase and peroxiredoxin and decreased expression of ferredoxin 1 and flavin reductase. J. Biol. Chem. 1999, 274, 26051–26056. [Google Scholar] [CrossRef] [Scilit]
  20. López-Soto, F.; León-Sicairos, N.; Reyes-López, M.; Serrano-Luna, J.; Ordaz-Pichardo, C.; Piña-Vázquez, C.; Ortiz-Estrada, G.; de la Garza, M. Use and endocytosis of iron-containing proteins by Entamoeba histolytica trophozoites. Infect. Genet. Evol. 2009, 9, 1038–1050. [Google Scholar] [CrossRef] [Scilit]
  21. Cruz-Castañeda, A.; Hernández-Sánchez, J.; Olivares-Trejo, J.J. Cloning and identification of a gene coding for a 26-kDa hemoglobin-binding protein from Entamoeba histolytica. Biochimie 2009, 91, 383–389. [Google Scholar] [CrossRef] [Scilit]
  22. Peirasmaki, D.; Ma’ayeh, S.Y.; Xu, F.; Ferella, M.; Campos, S.; Liu, J.; Svärd, S.G. High Cysteine Membrane Proteins (HCMPs) Are Up-Regulated During Giardia-Host Cell Interactions. Front. Genet. 2020, 11, 913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Plata-Guzmán, L.Y.; Arroyo, R.; León-Sicairos, N.; Canizalez-Román, A.; López-Moreno, H.S.; Chávez-Ontiveros, J.; Garzón-Tiznado, J.A.; León-Sicairos, C. Stem-Loop Structures in Iron-Regulated mRNAs of Giardia duodenalis. Int. J. Environ. Res. Public Health 2023, 20, 3556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Figueroa-Angulo, E.E.; Calla-Choque, J.S.; Mancilla-Olea, M.I.; Arroyo, R. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins. Biomolecules 2015, 5, 3354–3395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Calla-Choque, J.S.; Figueroa-Angulo, E.E.; Ávila-González, L.; Arroyo, R. α-Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism. Biomed. Res. Int. 2014, 2014, 424767. [Google Scholar] [CrossRef] [Scilit]
  26. González-Rivas, E.; Nieves-Ramírez, M.; Magaña, U.; Morán, P.; Rojas-Velázquez, L.; Hernández, E.; Serrano-Vázquez, A.; Partida, O.; Pérez-Juárez, H.; Ximénez, C. Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis. Microorganisms 2020, 8, 1556. [Google Scholar] [CrossRef] [Scilit]
  27. Aguirre-García, M.; Gutiérrez-Kobeh, L.; López-Vancell, R. Entamoeba histolytica: Adhesins and lectins in the trophozoite surface. Molecules 2015, 20, 2802–2815. [Google Scholar] [CrossRef] [Scilit]
  28. Tachibana, H.; Cheng, X.J.; Masuda, G.; Horiki, N.; Takeuchi, T. Evaluation of recombinant fragments of Entamoeba histolytica Gal/GalNAc lectin intermediate subunit for serodiagnosis of amebiasis. J. Clin. Microbiol. 2004, 42, 1069–1074. [Google Scholar] [CrossRef] [Scilit]
  29. Ankri, S.; Padilla-Vaca, F.; Stolarsky, T.; Koole, L.; Katz, U.; Mirelman, D. Antisense inhibition of expression of the light subunit (35 kDa) of the Gal/GalNac lectin complex inhibits Entamoeba histolytica virulence. Mol. Microbiol. 1999, 33, 327–337. [Google Scholar] [CrossRef] [Scilit]
  30. Marie, C.; Petri, W.A. Regulation of virulence of Entamoeba histolytica. Annu. Rev. Microbiol. 2014, 68, 493–520. [Google Scholar] [CrossRef] [Scilit]
  31. García-Rivera, G.; Rodríguez, M.A.; Ocádiz, R.; Martínez-López, M.C.; Arroyo, R.; González-Robles, A.; Orozco, E. Entamoeba histolytica: A novel cysteine protease and an adhesin form the 112 kDa surface protein. Mol. Microbiol. 1999, 33, 556–568. [Google Scholar] [CrossRef] [Scilit]
  32. Betanzos, A.; Zanatta, D.; Bañuelos, C.; Hernández-Nava, E.; Cuellar, P.; Orozco, E. Epithelial Cells Expressing EhADH, An Entamoeba histolytica Adhesin, Exhibit Increased Tight Junction Proteins. Front. Cell. Infect. Microbiol. 2018, 8, 340. [Google Scholar] [CrossRef] [Scilit]
  33. Guzmán-Téllez, P.; Martínez-Castillo, M.; Flores-Huerta, N.; Rosales-Morgan, G.; Pacheco-Yépez, J.; la Garza, M.; Serrano-Luna, J.; Shibayama, M. Lectins as virulence factors in Entamoeba histolytica and free-living amoebae. Future Microbiol. 2020, 15, 919–936. [Google Scholar] [CrossRef] [Scilit]
  34. Ralston, K.S.; Petri, W.A., Jr. Tissue destruction and invasion by Entamoeba histolytica. Trends. Parasitol. 2011, 27, 254–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Ahn, C.S.; Kim, J.G.; Shin, M.H.; Lee, Y.A.; Kong, Y. Comparison of Secretome Profile of Pathogenic and Non-Pathogenic Entamoeba histolytica. Proteomics 2018, 18, e1700341. [Google Scholar] [CrossRef] [Scilit]
  36. Yanagawa, Y.; Singh, U. Diversity and Plasticity of Virulent Characteristics of Entamoeba histolytica. Trop. Med. Infect. Dis. 2023, 8, 255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Nagaraja, S.; Ankri, S. Utilization of Different Omic Approaches to Unravel Stress Response Mechanisms in the Parasite Entamoeba histolytica. Front. Cell. Infect. Microbiol. 2018, 8, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Akbar, M.A.; Chatterjee, N.S.; Sen, P.; Debnath, A.; Pal, A.; Bera, T.; Das, P. Genes induced by a high-oxygen environment in Entamoeba histolytica. Mol. Biochem. Parasitol. 2004, 133, 187–196. [Google Scholar] [CrossRef] [Scilit]
  39. Guillén, N. Pathogenicity and virulence of Entamoeba histolytica, the agent of amoebiasis. Virulence 2023, 14, 2158656. [Google Scholar] [CrossRef] [Scilit]
  40. Singh, A.; Banerjee, T. Host-parasite interactions in infections due to Entamoeba histolytica: A tale of known and unknown. Trop. Parasitol. 2022, 12, 69–77. [Google Scholar] [CrossRef] [Scilit]
  41. Ghosh, S.; Padalia, J.; Moonah, S. Tissue Destruction Caused by Entamoeba histolytica Parasite: Cell Death, Inflammation, Invasion, and the Gut Microbiome. Curr. Clin. Microbiol. Rep. 2019, 6, 51–57. [Google Scholar] [CrossRef] [Scilit]
  42. Dixon, B.R. Giardia duodenalis in humans and animals—Transmission and disease. Res. Vet. Sci. 2021, 135, 283–289. [Google Scholar] [CrossRef] [Scilit]
  43. Ankarklev, J.; Jerlström-Hultqvist, J.; Ringqvist, E.; Troell, K.; Svärd, S.G. Behind the smile: Cell biology and disease mechanisms of Giardia species. Nat. Rev. Microbiol. 2010, 8, 413–422. [Google Scholar] [CrossRef] [Scilit]
  44. Nosala, C.; Hagen, K.D.; Dawson, S.C. ‘Disc-o-Fever’: Getting Down with Giardia’s Groovy Microtubule Organelle. Trends Cell Biol. 2018, 28, 99–112. [Google Scholar] [PubMed]
  45. Brown, J.R.; Schwartz, C.L.; Heumann, J.M.; Dawson, S.C.; Hoenger, A. A detailed look at the cytoskeletal architecture of the Giardia lamblia ventral disc. J. Struct. Biol. 2016, 194, 38–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Hagen, K.D.; McInally, S.G.; Hilton, N.D.; Dawson, S.C. Microtubule organelles in Giardia. Adv. Parasitol. 2020, 107, 25–96. [Google Scholar]
  47. Jenkins, M.C.; O’Brien, C.N.; Murphy, C.; Schwarz, R.; Miska, K.; Rosenthal, B.; Trout, J.M. Antibodies to the Ventral Disc Protein δ-giardin Prevent in Vitro Binding of Giardia lamblia Trophozoites. J. Parasitol. 2009, 95, 895–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Weiland, M.E.L.; Palm, J.E.D.; Griffiths, W.J.; McCaffery, J.M.; Svärd, S.G. Characterization of alpha-1 giardin: An immunodominant Giardia lamblia annexin with glycosaminoglycan-binding activity. Int. J. Parasitol. 2003, 33, 1341–1351. [Google Scholar]
  49. Ortega-Pierres, G.; Argüello-García, R.; Laredo-Cisneros, M.S.; Fonseca-Linán, R.; Gómez-Mondragón, M.; Inzunza-Arroyo, R.; Flores-Benítez, D.; Raya-Sandino, A.; Chavez-Munguía, B.; VenturaGallegos, J.L.; et al. Giardipain-1, a protease secreted by Giardia duodenalis trophozoites, causes junctional, barrier and apoptotic damage in epithelial cell monolayers. Int. J. Parasitol. 2018, 48, 621–639. [Google Scholar] [CrossRef] [Scilit]
  50. Gutiérrez, L.; Bartelt, L. Current Understanding of Giardia lamblia and Pathogenesis of Stunting and Cognitive Deficits in Children from Low- and Middle-Income Countries. Curr. Trop. Med. Rep. 2024, 11, 28–39. [Google Scholar] [CrossRef] [Scilit]
  51. Emery, S.J.; Mirzaei, M.; Vuong, D.; Pascovici, D.; Chick, J.M.; Lacey, E.; Haynes, P.A. Induction of virulence factors in Giardia duodenalis independent of host attachment. Sci. Rep. 2016, 6, 20765. [Google Scholar] [CrossRef] [Scilit]
  52. Ma’ayeh, S.Y.; Liu, J.; Peirasmaki, D.; Hörnaeus, K.; Bergström-Lind, S.; Grabherr, M.; Bergquist, J.; Svärd, S.G. Characterization of the Giardia intestinalis secretome during interaction with human intestinal epithelial cells: The impact on host cells. PLoS Negl. Trop. Dis. 2017, 11, e0006120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Gavinho, B.; Sabatke, B.; Feijoli, V.; Rossi, I.V.; da Silva, J.M.; Evans-Osses, I.; Palmisano, G.; Lange, S.; Ramirez, M.I. Peptidylarginine Deiminase Inhibition Abolishes the Production of Large Extracellular Vesicles from Giardia intestinalis, Affecting Host-Pathogen Interactions by Hindering Adhesion to Host Cells. Front. Cell. Infect. Microbiol. 2020, 10, 417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Adam, R.D. Giardia duodenalis: Biology and Pathogenesis. Clin. Microbiol. Rev. 2021, 34, e0002419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Prucca, C.G.; Slavin, I.; Quiroga, R.; Elías, E.V.; Rivero, F.D.; Saura, A.; Carranza, P.G.; Luján, H.D. Antigenic variation in Giardia lamblia is regulated by RNA interference. Nature 2008, 456, 750–754. [Google Scholar] [CrossRef] [Scilit]
  56. Tekwani, B.L.; Mehlotra, R.K. Molecular basis of defense against oxidative stress in Entamoeba histolytica and Giardia lamblia. Microbes Infect. 1999, 5, 385–394. [Google Scholar] [CrossRef] [Scilit]
  57. Raj, D.; Ghosh, E.; Mukherjee, A.K.; Nozaki, T.; Ganguly, S. Differential gene expression in Giardia lamblia under oxidative stress: Significance in eukaryotic evolution. Gene 2014, 535, 131–139. [Google Scholar] [CrossRef] [Scilit]
  58. Argüello-García, R.; Cruz-Soto, M.; González-Trejo, R.; Paz-Maldonado, L.M.T.; Bazán-Tejeda, M.L.; Mendoza-Hernández, G.; Ortega-Pierres, G. An antioxidant response is involved in resistance of Giardia duodenalis to albendazole. Front. Microbiol. 2015, 6, 286. [Google Scholar] [CrossRef] [Scilit]
  59. Raj, D.; Chowdhury, P.; Sarkar, R.; Saito-Nakano, Y.; Okamoto, K.; Dutta, S.; Nozaki, T.; Ganguly, S. Pyruvate Protects Giardia Trophozoites from Cysteine-Ascorbate Deprived Medium Induced Cytotoxicity. Korean J. Parasitol. 2018, 56, 1–9. [Google Scholar] [CrossRef] [Scilit]
  60. Xu, F.; Jex, A.; Svärd, S.G. A chromosome-scale reference genome for Giardia intestinalis WB. Sci. Data 2020, 7, 38. [Google Scholar] [CrossRef] [Scilit]
  61. Álvarez-Sánchez, M.E.; Ávila-González, L.; Becerril-García, C.; Fattel-Facenda, L.V.; Ortega-López, J.; Arroyo, R. A novel cysteine proteinase (CP65) of Trichomonas vaginalis involved in cytotoxicity. Microb. Pathog. 2000, 28, 193–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Hernández-Gutiérrez, R.; Ortega-López, J.; Arroyo, R. A 39-kDa cysteine proteinase CP39 from Trichomonas vaginalis, which is negatively affected by iron may be involved in trichomonal cytotoxicity. J. Eukaryot. Microbiol. 2003, 50, 696–698. [Google Scholar] [CrossRef] [Scilit]
  63. Sommer, U.; Costello, C.E.; Hayes, G.R.; Beach, D.H.; Gilbert, R.O.; Lucas, J.J.; Singh, B.N. Identification of Trichomonas vaginalis cysteine proteases that induce apoptosis in human vaginal epithelial cells. J. Biol. Chem. 2005, 280, 23853–23860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Figueroa-Angulo, E.E.; Rendón-Gandarilla, F.J.; Puente-Rivera, J.; Calla-Choque, J.S.; Cárdenas-Guerra, R.E.; Ortega-López, J.; Quintas-Granados, L.I.; Álvarez-Sánchez, M.E.; Arroyo, R. The effects of environmental factors on the virulence of Trichomonas vaginalis. Microbes Infect. 2012, 14, 1411–1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. MacFarlane, R.C.; Singh, U. Identification of an Entamoeba histolytica serine-, threonine-, and isoleucine-rich protein with roles in adhesion and cytotoxicity. Eukaryot. Cell 2007, 6, 2139–2146. [Google Scholar] [CrossRef] [Scilit]
  66. Xun, Y.; Tremouilhac, P.; Carraher, C.; Gelhaus, C.; Ozawa, K.; Otting, G.; Dixon, N.E.; Leippe, M.; Grötzinger, J.; Dingley, A.J.; et al. Cell-free synthesis and combinatorial selective 15N-labeling of the cytotoxic protein amoebapore A from Entamoeba histolytica. Protein Expr. Purif. 2009, 68, 22–27. [Google Scholar] [CrossRef] [Scilit]
  67. Kato, K.; Yahata, K.; Gopal Dhoubhadel, B.; Fujii, Y.; Tachibana, H. Novel hemagglutinating, hemolytic and cytotoxic activities of the intermediate subunit of Entamoeba histolytica lectin. Sci. Rep. 2015, 5, 13901. [Google Scholar] [CrossRef] [Scilit]
  68. Sánchez, V.; Serrano-Luna, J.; Ramírez-Moreno, E.; Tsutsumi, V.; Shibayama, M. Entamoeba histolytica: Overexpression of the gal/galnac lectin, ehcp2 and ehcp5 genes in an in vivo model of amebiasis. Parasitol. Int. 2016, 65, 665–667. [Google Scholar] [CrossRef] [Scilit]
  69. Ortega-Pierres, M.G.; Argüello-García, R. Giardia duodenalis: Role of secreted molecules as virulent factors in the cytotoxic effect on epithelial cells. Adv. Parasitol. 2019, 106, 129–169. [Google Scholar]
  70. Seyoum, Y.; Baye, K.; Humblot, C. Iron homeostasis in host and gut bacteria—A complex interrelationship. Gut Microbes 2021, 13, 1874855. [Google Scholar] [CrossRef] [Scilit]
  71. Mach, J.; Sutak, R. Iron in parasitic protists—From uptake to storage and where we can interfere. Metallomics 2020, 12, 1335–1347. [Google Scholar] [CrossRef] [Scilit]
  72. Arroyo, R.; Ochoa, T.; Tai, J.H.; de la Garza, M. Iron and Parasites. Biomed. Res. Int. 2015, 2015, 291672. [Google Scholar] [CrossRef] [Scilit]
  73. Miller, H.W.; Tam, T.S.Y.; Ralston, K.S. Entamoeba histolytica Develops Resistance to Complement Deposition and Lysis after Acquisition of Human Complement-Regulatory Proteins through Trogocytosis. mBio 2022, 13, e0316321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Danquah, I.; Gahutu, J.B.; Ignatius, R.; Musemakweri, A.; Mockenhaupt, F.P. Reduced prevalence of Giardia duodenalis in iron-deficient Rwandan children. Trop. Med. Int. Health 2014, 19, 563–567. [Google Scholar] [CrossRef] [Scilit]
  75. Gil, F.F.; Ventura, L.L.A.; Fonseca, J.F.; Saniago, H.C.; Busatti, H.; Santos, J.F.G.; Gomes, M.A. Hematological profile in natural progression of giardiasis: Kinetics of experimental infection in gerbils. J. Infect. Dev. Ctries. 2018, 12, 492–498. [Google Scholar] [CrossRef] [Scilit]
  76. Javed, I.N.; Tajammal, R.; Ijaz, S.H.; Ahmad, N.; Mahmood, S. “Tear Drops in the Duodenum”: Uncommon Cause of Iron Deficiency Anemia in Adults. Cureus 2019, 11, e5532. [Google Scholar] [CrossRef] [Scilit]
  77. Solaymani-Mohammadi, S.; Singer, S.M. Giardia duodenalis: The double-edged sword of immune responses in giardiasis. Exp. Parasitol. 2010, 126, 292–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Bénéré, E.; Van Assche, T.; Cos, P.; Maes, L. Intrinsic susceptibility of Giardia duodenalis assemblage subtypes AI, AII, B and EIII for nitric oxide under axenic culture conditions. Parasitol. Res. 2012, 110, 1315–1319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Magne, D.; Favennec, L.; Chochillon, C.; Gorenflot, A.; Meillet, D.; Kapel, N.; Raichvarg, D.; Savel, J.; Gobert, J.G. Role of cytoskeleton and surface lectins in Giardia duodenalis attachment to Caco2 cells. Parasitol. Res. 1991, 77, 659–662. [Google Scholar] [CrossRef] [Scilit]
  80. Ringqvist, E.; Palm, J.E.; Skarin, H.; Hehl, A.B.; Weiland, M.; Davids, B.J.; Reiner, D.S.; Griffiths, W.J.; Eckmann, L.; Gillin, F.D.; et al. Release of metabolic enzymes by Giardia in response to interaction with intestinal epithelial cells. Mol. Biochem. Parasitol. 2008, 159, 85–91. [Google Scholar] [CrossRef] [Scilit]
  81. Dubourg, A.; Xia, D.; Winpenny, J.P.; Al Naimi, S.; Bouzid, M.; Sexton, D.W.; Wastling, J.M.; Hunter, P.R.; Tyler, K.M. Giardia secretome highlights secreted tenascins as a key component of pathogenesis. Gigascience 2018, 7, giy003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  82. Ringqvist, E.; Avesson, L.; Söderbom, F.; Svärd, S.G. Transcriptional changes in Giardia during host-parasite interactions. Int. J. Parasitol. 2011, 41, 277–285. [Google Scholar] [CrossRef] [Scilit]
  83. Fernández-Martín, K.G.; Alvarez-Sánchez, M.E.; Arana-Argáez, V.E.; Alvarez-Sánchez, L.C.; Lara-Riegos, J.C.; Torres-Romero, J.C. Genome-wide identification, in silico characterization and expression analysis of ZIP-like genes from Trichomonas vaginalis in response to Zinc and Iron. Biometals 2017, 30, 663–675. [Google Scholar] [CrossRef] [Scilit]
  84. Verma, K.; Saito-Nakano, Y.; Nozaki, T.; Datta, S. Insights into endosomal maturation of human holo-transferrin in the enteric parasite Entamoeba histolytica: Essential roles of Rab7A and Rab5 in biogenesis of giant early endocytic vacuoles. Cell Microbiol. 2015, 17, 1779–1796. [Google Scholar] [CrossRef] [Scilit]
  85. Rivera-Rivas, L.A.; Lorenzo-Benito, S.; Sánchez-Rodríguez, D.B.; Miranda-Ozuna, J.F.; Euceda-Padilla, E.A.; Ortega-López, J.; Chávez-Munguía, B.; Lagunes-Guillén, A.; Velázquez-Valassi, B.; Jasso-Villazul, L.; et al. The effect of iron on Trichomonas vaginalis TvCP2: A cysteine proteinase found in vaginal secretions of trichomoniasis patients. Parasitology 2020, 147, 760–774. [Google Scholar] [CrossRef] [Scilit]
  86. Cheng, W.H.; Huang, K.Y.; Ong, S.C.; Ku, F.M.; Huang, P.J.; Lee, C.C.; Yeh, Y.M.; Lin, R.; Chiu, C.H.; Tang, P. Protein cysteine S-nitrosylation provides reducing power by enhancing lactate dehydrogenase activity in Trichomonas vaginalis under iron deficiency. Parasit. Vectors 2020, 13, 477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  87. Cheng, W.H.; Huang, P.J.; Lee, C.C.; Yeh, Y.M.; Ong, S.C.; Lin, R.; Ku, F.M.; Chiu, C.H.; Tang, P. Metabolomics analysis reveals changes related to pseudocyst formation induced by iron depletion in Trichomonas vaginalis. Parasit. Vectors 2023, 16, 226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. Arroyo, R.; Cárdenas-Guerra, R.E.; Figueroa-Angulo, E.E.; Puente-Rivera, J.; Zamudio-Prieto, O.; Ortega-López, J. Trichomonas vaginalis Cysteine Proteinases: Iron Response in Gene Expression and Proteolytic Activity. Biomed. Res. Int. 2015, 2015, 946787. [Google Scholar] [CrossRef] [Scilit]
  89. Tsai, C.D.; Liu, H.W.; Tai, J.H. Characterization of an iron-responsive promoter in the protozoan pathogen Trichomonas vaginalis. J. Biol. Chem. 2002, 277, 5153–5162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Lehker, M.W.; Alderete, J.F. Iron regulates growth of Trichomonas vaginalis and the expression of immunogenic trichomonad proteins. Mol. Microbiol. 1992, 6, 123–132. [Google Scholar] [CrossRef] [Scilit]
  91. Wunderlich, J.; Kotov, V.; Votborg-Novél, L.; Ntalla, C.; Geffken, M.; Peine, S.; Portugal, S.; Strauss, J. Iron transport pathways in the human malaria parasite Plasmodium falciparum revealed by RNA-sequencing. Front. Cell. Infect. Microbiol. 2024, 14, 1480076. [Google Scholar] [CrossRef] [Scilit]
  92. Clark, M.A.; Goheen, M.M.; Cerami, C. Influence of host iron status on Plasmodium falciparum infection. Front. Pharmacol. 2014, 5, 84. [Google Scholar] [CrossRef] [Scilit]
  93. Clark, M.; Fisher, N.C.; Kasthuri, R.; Cerami Hand, C. Parasite maturation and host serum iron influence the labile iron pool of erythrocyte stage Plasmodium falciparum. Br. J. Haematol. 2013, 161, 262–269. [Google Scholar] [CrossRef] [Scilit]
  94. Loyevsky, M.; LaVaute, T.; Allerson, C.R.; Stearman, R.; Kassim, O.O.; Cooperman, S.; Gordeuk, V.R.; Rouault, T.A. An IRP-like protein from Plasmodium falciparum binds to a mammalian iron-responsive element. Blood 2001, 98, 2555–2562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  95. Pantopoulos, K. Iron metabolism and the IRE/IRP regulatory system: An update. Ann. N. Y. Acad. Sci. 2004, 1012, 1–13. [Google Scholar] [CrossRef] [Scilit]
  96. Pérez, G.; Vittori, D.; Pregi, N.; Garbossa, G.; Nesse, A. Homeostasis del hierro. Mecanismos de absorción, captación celular y regulación. Acta Bioquímica Clínica Latinoam. 2005, 39, 301–314. [Google Scholar]
  97. Tandara, L.; Salamunic, I. Iron metabolism: Current facts and future directions. Biochem. Med. 2012, 22, 311–328. [Google Scholar]
  98. Wilkinson, N.; Pantopoulos, K. The IRP/IRE system in vivo: Insights from mouse models. Front. Pharmacol. 2014, 5, 176. [Google Scholar] [CrossRef] [Scilit]
  99. Volz, K. The functional duality of iron regulatory protein 1. Curr. Opin. Struct. Biol. 2008, 18, 106–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Hentze, M.W.; Muckenthaler, M.U.; Andrews, N.C. Balancing Acts: Molecular control of mammalian iron metabolism. Cell 2004, 117, 285–297. [Google Scholar] [CrossRef] [Scilit]
  101. Rouault, T.A. The role of iron regulatory proteins in mammalian iron homeostasis and disease. Nat. Chem. Biol. 2006, 2, 406–414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  102. De Domenico, D.; McVey Ward, D.; Kaplan, J. Regulation of iron acquisition and storage: Consequences for iron-linked disorders. Nat. Rev. Mol. Cell Biol. 2008, 9, 72–81. [Google Scholar] [CrossRef] [Scilit]
  103. Muckenthaler, M.U.; Galy, B.; Hentze, M.W. Systemic iron homeostasis and the iron-responsive element/iron-regulatory protein (IRE/IRP) regulatory network. Annu. Rev. Nutr. 2008, 28, 197–213. [Google Scholar] [CrossRef] [Scilit]
  104. Ke, Y.; Wu, J.; Leibold, E.A.; Walden, W.E.; Theil, E.C. Loops and bulge/loops in iron-responsive element isoforms influence iron regulatory protein binding. Fine-tuning of mRNA regulation? J. Biol. Chem. 1998, 273, 23637–23640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  105. Butt, J.; Kim, H.Y.; Basilion, J.P.; Cohen, S.; Iwai, K.; Philpott, C.C.; Altschul, S.; Klausner, R.D.; Rouault, T.A. Differences in the RNA bindings sites of iron regulatory proteins and potential target diversity. Proc. Natl. Acad. Sci. USA 1996, 9, 4345–4349. [Google Scholar] [CrossRef] [Scilit]
  106. Senoura, T.; Kobayashi, T.; An, G.; Nakanishi, H.; Nishizawa, N.K. Defects in the rice aconitase-encoding OsACO1 gene alter iron homeostasis. Plant Mol. Biol. 2020, 104, 629–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  107. Liang, G. Iron uptake, signaling, and sensing in plants. Plant Commun. 2022, 3, 100349. [Google Scholar] [CrossRef] [Scilit]
  108. Volz, K. Conservation in the Iron Responsive Element Family. Genes 2021, 12, 1365. [Google Scholar] [CrossRef] [Scilit]
  109. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [Scilit]
  110. Weiland, M.E.; McArthur, A.G.; Morrison, H.G.; Sogin, M.L.; Svärd, S.G. Annexin-like alpha giardins: A new cytoskeletal gene family in Giardia lamblia. Int. J. Parasitol. 2005, 35, 617–626. [Google Scholar] [CrossRef] [Scilit]
  111. Tolba, M.E.; Kobayashi, S.; Imada, M.; Suzuki, Y.; Sugano, S. Giardia lamblia transcriptome analysis using TSS-Seq and RNA-Seq. PLoS ONE 2013, 8, e76184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  112. Franzén, O.; Jerlström-Hultqvist, J.; Einarsson, E.; Ankarklev, J.; Ferella, M.; Andersson, B.; Svärd, S.G. Transcriptome profiling of Giardia intestinalis using strand-specific RNA-seq. PLoS Comput. Biol. 2013, 9, e1003000. [Google Scholar] [CrossRef] [Scilit]
  113. Bilodeau, D.Y.; Sheridan, R.M.; Balan, B.; Jex, A.R.; Rissland, O.S. Precise gene models using long-read sequencing reveal a unique poly(A) signal in Giardia lamblia. RNA 2022, 28, 668–682. [Google Scholar] [CrossRef] [Scilit]
  114. Piccinelli, P.; Samuelsson, T. Evolution of the Iron-Responsive Element. RNA 2007, 13, 952–966. [Google Scholar] [CrossRef] [Scilit]
  115. Loyevsky, M.; Mompoint, F.; Yikilmaz, E.; Altschul, S.F.; Madden, T.; Wootton, J.C.; Kurantsin-Mills, J.; Kassim, O.O.; Gordeuk, V.R.; Rouault, T.A. Expression of a recombinant IRP-like Plasmodium falciparum protein that specifically binds putative plasmodial IREs. Mol. Biochem. Parasitol. 2003, 126, 231–238. [Google Scholar] [CrossRef] [Scilit]
  116. León-Sicairos, C.R.; Figueroa-Angulo, E.E.; Calla-Choque, J.S.; Arroyo, R. The Non-Canonical Iron-Responsive Element of IRE-tvcp12 Hairpin Structure at the 3′-UTR of Trichomonas vaginalis TvCP12 mRNA That Binds TvHSP70 and TvACTN-3 Can Regulate mRNA Stability and Amount of Protein. Pathogens 2023, 12, 586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  117. Millán-Pacheco, C.; Arreola, R.; Villalobos-Osnaya, A.; Garza-Ramos, G.; Serratos, I.N.; Díaz-Vilchis, A.; Rudiño-Piñera, E.; Alvarez-Sanchez, M.E. A Putative New Role of Tv-PSP1 Recognizes IRE and ERE Hairpin Structures from Trichomonas vaginalis. Pathogens 2023, 12, 79. [Google Scholar] [CrossRef] [Scilit]
  118. Moafinejad, S.N.; de Aquino, B.R.H.; Boniecki, M.J.; Pandaranadar Jeyeram, I.P.N.; Nikolaev, G.; Magnus, M.; Farsani, M.A.; Badepally, N.G.; Wirecki, T.K.; Stefaniak, F.; et al. SimRNAweb v2.0: A web server for RNA folding simulations and 3D structure modeling, with optional restraints and enhanced analysis of folding trajectories. Nucleic Acids Res. 2024, 52, W368–W373. [Google Scholar] [CrossRef] [Scilit]
  119. Magnus, M.; Boniecki, M.J.; Dawson, W.; Bujnicki, J.M. SimRNAweb: A web server for RNA 3D structure modeling with optional restraints. Nucleic Acids Res. 2016, 44, W315–W319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  120. Boniecki, M.J.; Lach, G.; Dawson, W.K.; Tomala, K.; Lukasz, P.; Soltysinski, T.; Rother, K.M.; Bujnicki, J.M. SimRNA: A coarse-grained method for RNA folding simulations and 3D structure prediction. Nucleic Acids Res. 2016, 44, e63. [Google Scholar] [CrossRef] [Scilit]
  121. Jones, G.; Jindal, A.; Ghani, U.; Kotelnikov, S.; Egbert, M.; Hashemi, N.; Vajda, S.; Padhorny, D.; Kozakov, D. Elucidation of protein function using computational docking and hotspot analysis by ClusPro and FTMap. Acta Crystallogr. D Struct. Biol. 2022, 78, 690–697. [Google Scholar] [CrossRef] [Scilit]
  122. Desta, I.T.; Porter, K.A.; Xia, B.; Kozakov, D.; Vajda, S. Performance and Its Limits in Rigid Body Protein-Protein Docking. Structure 2020, 28, 1071–1081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  123. Vajda, S.; Yueh, C.; Beglov, D.; Bohnuud, T.; Mottarella, S.E.; Xia, B.; Hall, D.R.; Kozakov, D. New additions to the ClusPro server motivated by CAPRI. Proteins Struct. Funct. Bioinform. 2017, 85, 435–444. [Google Scholar] [CrossRef] [Scilit]
  124. Kozakov, D.; Hall, D.R.; Xia, B.; Porter, K.A.; Padhorny, D.; Yueh, C.; Beglov, D.; Vajda, S. The ClusPro web server for protein-protein docking. Nat. Protoc. 2017, 12, 255–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  125. Kozakov, D.; Beglov, D.; Bohnuud, T.; Mottarella, S.; Xia, B.; Hall, D.R.; Vajda, S. How good is automated protein docking? Proteins Struct. Funct. Bioinform. 2013, 81, 2159–2166. [Google Scholar] [CrossRef] [Scilit]
  126. Zheng, W.; Wuyun, Q.; Li, Y.; Liu, Q.; Zhou, X.; Peng, C.; Zhu, Y.; Freddolino, L.; Zhang, Y. Deep-learning-based single-domain and multidomain protein structure prediction with D-I-TASSER. Nat. Biotechnol. 2025. Epub ahead of print. [Google Scholar] [CrossRef] [Scilit]
  127. Zhou, X.; Zheng, W.; Li, Y.; Pearce, R.; Zhang, C.; Bell, E.W.; Zhang, G.; Zhang, Y. I-TASSER-MTD: A deep-learning-based platform for multi-domain protein structure and function prediction. Nat. Protoc. 2022, 17, 2326–2353. [Google Scholar] [CrossRef] [Scilit]
  128. Zheng, W.; Zhang, C.; Li, Y.; Pearce, R.; Bell, E.W.; Zhang, Y. Folding non-homology proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Rep. Methods 2021, 1, 100014. [Google Scholar] [CrossRef] [Scilit]
  129. Humphrey, W.; Dalke, A.; Schulten, K. VMD: Visual Molecular Dynamics. J. Mol. Graph. 1996, 14, 33–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  130. Laskowski, R.A.; Jablonska, J.; Pravda, L.; Varekova, R.S.; Thornton, J.M. PDBsum: Structural summaries of PDB entries. Protein Sci. 2018, 27, 169–173. [Google Scholar]
  131. Wada, A.; Umeki, Y.; Annoura, T.; Saito-Nakano, Y. In Vitro and In Vivo Antiamebic Activity of Iron-Targeting Polypyridine Compounds against Enteric Protozoan Parasite Entamoeba histolytica. ACS Infect. Dis. 2022, 8, 457–462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  132. Aguilar-Diaz, H.; Canizalez-Román, A.; Nepomuceno-Mejia, T.; Gallardo-Vera, F.; Hornelas-Orozco, Y.; Nazmi, K.; Bolscher, J.G.; Carrero, J.C.; Leon-Sicairos, C.; Leon-Sicairos, N. Parasiticidal effect of synthetic bovine lactoferrin peptides on the enteric parasite Giardia intestinalis. Biochem. Cell Biol. 2017, 95, 82–90. [Google Scholar] [CrossRef] [Scilit]
  133. Hoffmann, A.; Grubwieser, P.; Bumann, D.; Haschka, D.; Weiss, G. Tackling microbial iron homeostasis: Novel antimicrobial strategies. Trends Pharmacol. Sci. 2025, 46, 1004–1017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. G. duodenalis IRE-like structures on mRNAs of adhesin homologs. The arrows indicate the GUU/UUG-protozoa-specific motif [15]. Boxes indicate the CGU motif. Diamonds indicates the sequence similar to the canonical CAGUGN of higher eukaryotes [108]. CR, coding region. dG, Gibbs free energy or free enthalpy; in this case, a reduction in dG (negative dG) is a necessary condition for spontaneous structure formation.
Figure 1. G. duodenalis IRE-like structures on mRNAs of adhesin homologs. The arrows indicate the GUU/UUG-protozoa-specific motif [15]. Boxes indicate the CGU motif. Diamonds indicates the sequence similar to the canonical CAGUGN of higher eukaryotes [108]. CR, coding region. dG, Gibbs free energy or free enthalpy; in this case, a reduction in dG (negative dG) is a necessary condition for spontaneous structure formation.
Pathogens 15 00057 g001
Figure 3. Alignment between Tv-PSP1 (PDB: 7KGC D) and translation initiation inhibitor, TII (GL50803_00480). The green squares indicate highlighted residues in RNA–protein interface of TvPSP1 and IRE-like interaction. TII (GL50803_00480) holds conserved residues in some of these regions. (*) indicate equal residues, (:) indicate highly conserved residues, (.) indicate weakly conserved residues.
Figure 3. Alignment between Tv-PSP1 (PDB: 7KGC D) and translation initiation inhibitor, TII (GL50803_00480). The green squares indicate highlighted residues in RNA–protein interface of TvPSP1 and IRE-like interaction. TII (GL50803_00480) holds conserved residues in some of these regions. (*) indicate equal residues, (:) indicate highly conserved residues, (.) indicate weakly conserved residues.
Pathogens 15 00057 g003
Figure 4. Docking models between IRE and IRE-like structures with hIRP-1 and IRP-like proteins. Highlighted regions in every model represent contact residues. (A). IRE Wild-type (PDB: 1NBR) is represented in blue and human hIRP1 (PDB: 2B3X) in red. (B). T. vaginalis cysteine protease 4 (tvcp4) IRE-like structure (simulated by simRNA2.0) represented in black and human IRP1 (PDB: 2B3X) in magenta. (C). G. duodenalis pyruvate flavodoxin oxidoreductase (Gdpfo) IRE-like structure (simulated by simRNA2.0 (https://genesilico.pl/SimRNAweb, accessed on 7 October 2025)) is represented in green and hIRP1 (PDB: 2B3X) in cyan. (D). G. duodenalis pfo IRE-like structure represented in gray and G. duodenalis PSP-like protein (GdPSP-like or translation initiation inhibitor GL50803_00480, TII) in red (modeled with I-TASSER). (E). G. duodenalis pfo IRE-like structure represented in orange and T. vaginalis PSP (TvPSP, PDB: 7KGC) in blue. Structures were modeled with VMD (http://www.ks.uiuc.edu/Research/vmd/, accessed on 7 October 2025) and dockings were performed using Cluspro2.0 [118,119,120,121,122,123,124,125,126,127,128,129,130].
Figure 4. Docking models between IRE and IRE-like structures with hIRP-1 and IRP-like proteins. Highlighted regions in every model represent contact residues. (A). IRE Wild-type (PDB: 1NBR) is represented in blue and human hIRP1 (PDB: 2B3X) in red. (B). T. vaginalis cysteine protease 4 (tvcp4) IRE-like structure (simulated by simRNA2.0) represented in black and human IRP1 (PDB: 2B3X) in magenta. (C). G. duodenalis pyruvate flavodoxin oxidoreductase (Gdpfo) IRE-like structure (simulated by simRNA2.0 (https://genesilico.pl/SimRNAweb, accessed on 7 October 2025)) is represented in green and hIRP1 (PDB: 2B3X) in cyan. (D). G. duodenalis pfo IRE-like structure represented in gray and G. duodenalis PSP-like protein (GdPSP-like or translation initiation inhibitor GL50803_00480, TII) in red (modeled with I-TASSER). (E). G. duodenalis pfo IRE-like structure represented in orange and T. vaginalis PSP (TvPSP, PDB: 7KGC) in blue. Structures were modeled with VMD (http://www.ks.uiuc.edu/Research/vmd/, accessed on 7 October 2025) and dockings were performed using Cluspro2.0 [118,119,120,121,122,123,124,125,126,127,128,129,130].
Pathogens 15 00057 g004
Table 1. Possible orthologs from adhesion factors in G. duodenalis and their respective probes used for BLAST search.
Table 1. Possible orthologs from adhesion factors in G. duodenalis and their respective probes used for BLAST search.
Used Probe (NCBI)Homolog Sequence from
GiardiaDB
Accession Number
(GiardiaDB)
Identity (%)
PFO E. histolytica (EAL51636.2)Pyruvate-flavodoxin oxidoreductaseGL50803_001706338.4682
PFO E. histolytica (EAL51636.2)Pyruvate-flavodoxin oxidoreductaseGL50803_0011460926.2478
EhCP1
(Q01957.1)
Cathepsin LGL50803_001498320.9524
EhCP1
(Q01957.1)
Cathepsin LGL50803_001638023.1746
EhCP1
(Q01957.1)
Cathepsin BGL50803_001401919
EhCP1
(Q01957.1)
Cathepsin BGL50803_001616020.6081
EhCP1
(Q01957.1)
Cathepsin BGL50803_001677917.4497
EhCP1
(Q01957.1)
Cathepsin BGL50803_001646817.7049
EhCP2
(Q01958.1)
Cathepsin LGL50803_001498322.8571
EhCP2
(Q01958.1)
Cathepsin LGL50803_001638022.8571
EhCP2
(Q01958.1)
Cathepsin BGL50803_001401919.6667
EhCP2
(Q01958.1)
Cathepsin BGL50803_001677918.1208
EhCP2
(Q01958.1)
Cathepsin BGL50803_001616018.5811
EhCP2
(Q01958.1)
Cathepsin BGL50803_001646818.6885
EhCP5
(CAA62835.1)
Cathepsin LGL50803_001498322.0126
EhCP5
(CAA62835.1)
Cathepsin LGL50803_001638022.6415
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001401920.6667
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001677918.4564
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001646818.3607
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001021719.1419
AP65 T. vaginalis
(AAA87406.1)
Malate dehydrogenaseGL50803_001428529.8025
PFO T. vaginalis
(AAA85495.1)
Pyruvate-flavodoxin oxidoreductaseGL50803_001706336.3872
PFO T. vaginalis
(AAA85495.1)
Pyruvate-flavodoxin oxidoreductase GL50803_0011460928.7813
Table 2. Possible orthologs from cytotoxicity factors (CPs) in G. duodenalis and their respective probes used for BLAST search.
Table 2. Possible orthologs from cytotoxicity factors (CPs) in G. duodenalis and their respective probes used for BLAST search.
Used Probe
(NCBI)
Homolog Sequence from GiardiaDBAccess Number (GiardiaDB)Identity (%)
TvCP4
(AAV98582.1)
Cathepsin BGL50803_001401920.3333
TvCP4
(AAV98582.1)
Cathepsin BGL50803_001677918.7919
TvCP4
(AAV98582.1)
Cathepsin BGL50803_001616018.9189
TvCP4
(AAV98582.1)
Cathepsin BGL50803_001021718.4818
TvCP4
(AAV98582.1)
Cathepsin BGL50803_001646818.3607
TvCP4
(AAV98582.1)
Cathepsin LGL50803_001498321.9672
TvCP4
(AAV98582.1)
Cathepsin LGL50803_001638022.623
TvCP12
(AAS38515.1)
Cysteine proteaseGL50803_0011365620.5479
TvCP30
(CAA54437.1)
Cathepsin LGL50803_001498320.8633
TvCP30
(CAA54437.1)
Cathepsin LGL50803_001638018.705
TvCP39
(ABX56032.1)
Cathepsin BGL50803_001677919.1275
TvCP39
(ABX56032.1)
Cathepsin BGL50803_001616018.5811
TvCP65
(AAS38514.1)
Cathepsin BGL50803_001021719.4175
TvCP65
(AAS38514.1)
Cathepsin BGL50803_001556418.932
TvCP65
(AAS38514.1)
Cathepsin LGL50803_001498322.8155
TvCP65
(AAS38514.1)
Cathepsin LGL50803_001638022.8155
EhCP1
(AAA29090.1)
Cathepsin BGL50803_001616020.6081
EhCP1
(AAA29090.1)
Cysteine proteaseGL50803_0011365621.9048
EhCP2
(AAA29091.1)
Cathepsin BGL50803_001401919.6667
EhCP2
(AAA29091.1)
Cathepsin BGL50803_001646818.6885
EhCP2
(AAA29091.1)
Cysteine proteaseGL50803_0011365621.2698
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001401920.6667
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001677918.4564
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001021719.1419
EhCP5
(CAA62835.1)
Cathepsin BGL50803_001646818.3607
EhCP5
(CAA62835.1)
Cathepsin LGL50803_00309920.4403
EhCP5
(CAA62835.1)
Cathepsin LGL50803_001498322.0126
EhCP5
(CAA62835.1)
Cathepsin LGL50803_001638022.6415
Table 4. TvHSP70 and G. duodenalis homologous proteins.
Table 4. TvHSP70 and G. duodenalis homologous proteins.
T. vaginalis ProteinG. duodenalis ProteinIdentity (%)
TvHSP70 [25]GL50803_0088765 Cytosolic heat shock protein 7055.0835
GL50803_0017121
Bip
46.3746
GL50803_0014581 Chaperone protein DnaK HSP7030.625
The alignment was performed using ClustalW.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

León-Beltrán, J.G.; Montaño, S.; Arroyo, R.; Estrada-Ramírez, D.; León-Sicairos, N.; Canizalez-Román, A.; Sánchez-González, M.A.; Garzón-Tiznado, J.A.; León-Sicairos, C. Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis. Pathogens 2026, 15, 57. https://doi.org/10.3390/pathogens15010057

AMA Style

León-Beltrán JG, Montaño S, Arroyo R, Estrada-Ramírez D, León-Sicairos N, Canizalez-Román A, Sánchez-González MA, Garzón-Tiznado JA, León-Sicairos C. Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis. Pathogens. 2026; 15(1):57. https://doi.org/10.3390/pathogens15010057

Chicago/Turabian Style

León-Beltrán, Jesús Gabriel, Sarita Montaño, Rossana Arroyo, Daniela Estrada-Ramírez, Nidia León-Sicairos, Adrián Canizalez-Román, María Angélica Sánchez-González, José Antonio Garzón-Tiznado, and Claudia León-Sicairos. 2026. "Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis" Pathogens 15, no. 1: 57. https://doi.org/10.3390/pathogens15010057

APA Style

León-Beltrán, J. G., Montaño, S., Arroyo, R., Estrada-Ramírez, D., León-Sicairos, N., Canizalez-Román, A., Sánchez-González, M. A., Garzón-Tiznado, J. A., & León-Sicairos, C. (2026). Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis. Pathogens, 15(1), 57. https://doi.org/10.3390/pathogens15010057

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop