Potential for Duplexed, In-Tandem gRNA-Mediated Suppression of Two Essential Genes of Tomato Leaf Curl New Delhi Virus in Crop Plants
Abstract
1. Introduction
2. Materials and Methods
2.1. Genome Cloning and Construction of Tomato Leaf Curl New Delhi Virus
2.2. Selection of Targeted Regions and Designing of gRNA Sequences for Genome Editing of ToLCNDV
2.3. In Vitro Cleavage Assay for Estimating the Predicted Efficiency of gRNA Cleavage
2.4. Duplexed gRNA-Cas9 Cassette Construction
2.5. Transient Co-Inoculation of Plants with Constructs and Tomato Leaf Curl New Delhi Virus
2.6. Detection of ToLCNDV in Agro-Infiltrated Plants by Polymerase Chain Reaction and Rolling Circle Amplification
2.7. Quantitative PCR Amplification and Virus Accumulation
3. Results
3.1. Infectious Clone of ToLCNDV Isolated from Chili Plants Produced Leaf Curl Disease Symptoms in Tobacco Plants
3.2. In Vitro gRNA Cleavage of ToLCNDV Genome
3.3. Duplexed gRNA-Cas9 Complex Vectors
3.4. Efficiency of Transiently Expressed Duplex gRNA-Cas9 Complex
3.5. Duplex gRNA-Cas9 Complexes Restrict Disease Development
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Navas-Castillo, J.; Fiallo-Olivé, E.; Sánchez-Campos, S. Emerging virus diseases transmitted by whiteflies. Annu. Rev. Phytopathol. 2011, 49, 219–248. [Google Scholar]
- Brown, J.K.; Zerbini, F.M.; Navas-Castillo, J.; Moriones, E.; Ramos-Sobrinho, R.; Silva, J.C.F.; Fiallo-Olivé, E.; Briddon, R.W.; Hernández-Zepeda, C.; Idris, A.; et al. Revision of Begomovirus taxonomy based on pairwise sequence comparisons. Arch. Virol. 2015, 160, 1593–1619. [Google Scholar] [PubMed]
- Chakraborty, S.; Vanitharani, R.; Chattopadhyay, B.; Fauquet, C.M. Supervirulent pseudorecombination and asymmetric synergism between genomic components of two distinct species of begomovirus associated with severe tomato leaf curl disease in India. J. Gen. Virol. 2008, 89, 818–828. [Google Scholar] [PubMed]
- Prasanna, H.C.; Kashyap, S.P.; Krishna, R.; Sinha, D.P.; Reddy, S.; Malathi, V.G. Marker assisted selection of Ty-2 and Ty-3 carrying tomato lines and their implications in breeding tomato leaf curl disease resistant hybrids. Euphytica 2015, 204, 407–418. [Google Scholar]
- Vasudeva, R.; Raj, J.S. A leaf-curl disease of tomato. Phytopathology 1948, 38, 364–369. [Google Scholar]
- Abhary, M.; Patil, B.L.; Fauquet, C.M. Molecular Biodiversity, Taxonomy, and Nomenclature of Tomato Yellow Leaf Curl-like Viruses. In Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance; Czosnek, H., Ed.; Springer: Dordrecht, The Netherlands, 2007; pp. 85–118. [Google Scholar]
- Kon, T.; Gilbertson, R.L. Two genetically related begomoviruses causing tomato leaf curl disease in Togo and Nigeria differ in virulence and host range but do not require a betasatellite for induction of disease symptoms. Arch. Virol. 2012, 157, 107–120. [Google Scholar]
- Osei, M.K.; Cornelius, E.; Asare-Bediako, E.; Oppong, A.; Quain, M.D. Status of begomoviruses in Ghana: The case of vegetables and root and tuber crops. In Begomoviruses: Occurrence and Management in Asia and Africa; Springer: Singapore, 2017; pp. 297–314. [Google Scholar]
- de Moya, R.S.; Brown, J.K.; Sweet, A.D.; Walden, K.K.O.; Paredes-Montero, J.R.; Waterhouse, R.M.; Johnson, K.P. Nuclear Orthologs Derived from Whole Genome Sequencing Indicate Cryptic Diversity in the Bemisia tabaci (Insecta: Aleyrodidae) Complex of Whiteflies. Diversity 2019, 11, 151. [Google Scholar] [CrossRef] [Scilit]
- Padidam, M.; Beachy, R.N.; Fauquet, C.M. Tomato leaf curl geminivirus from India has a bipartite genome and coat protein is not essential for infectivity. J. Gen. Virol. 1995, 76, 25–35. [Google Scholar]
- Zaidi, S.S.-E.; Shafiq, M.; Amin, I.; Scheffler, B.E.; Scheffler, J.A.; Briddon, R.W.; Mansoor, S.; Lin, B. Frequent Occurrence of Tomato Leaf Curl New Delhi Virus in Cotton Leaf Curl Disease Affected Cotton in Pakistan. PLoS ONE 2016, 11, e0155520. [Google Scholar]
- Moriones, E.; Praveen, S.; Chakraborty, S. Tomato leaf curl New Delhi virus: An emerging virus complex threatening vegetable and fiber crops. Viruses 2017, 9, 264. [Google Scholar] [CrossRef] [Scilit]
- de Paz, A.I.E.; Botella-Guillén, M.; Otazo-González, H.C.; Alfaro-Fernández, A.; Font-San-Ambrosio, I.; Galipienso, L.; Rubio, L. First report of tomato leaf curl New Delhi virus infecting cucurbits in the Canary Islands. Plant Dis. 2019, 103, 1798. [Google Scholar]
- Wilisiani, F.; Mashiko, T.; Wang, W.-Q.; Suzuki, T.; Hartono, S.; Neriya, Y.; Nishigawa, H.; Natsuaki, T. New recombinant of tomato leaf curl New Delhi virus infecting melon in Indonesia. J. Gen. Plant Pathol. 2019, 85, 306–310. [Google Scholar]
- Hussain, M.; Mansoor, S.; Iram, S.; Zafar, Y.; Briddon, R.W. First report of tomato leaf curl New Delhi virus affecting chilli pepper in Pakistan. Plant Pathol. 2004, 53, 794. [Google Scholar]
- Usharani, K.S.; Surendranath, B.; Paul-Khurana, S.M.; Garg, I.D.; Malathi, V.G. Potato leaf curl-a new disease of potato in northern India caused by a strain of tomato leaf curl New Delhi virus. Plant Pathol. 2004, 53, 235. [Google Scholar]
- Jyothsna, P.; Haq, Q.M.I.; Singh, P.; Sumiya, K.V.; Praveen, S.; Rawat, R.; Briddon, R.W.; Malathi, V.G. Infection of tomato leaf curl New Delhi virus (ToLCNDV), a bipartite begomovirus with betasatellites, results in enhanced level of helper virus components and antagonistic interaction between DNA B and betasatellites. Appl. Microbiol. Biotechnol. 2013, 97, 5457–5471. [Google Scholar]
- Sahu, P.P.; Rai, N.K.; Chakraborty, S.; Singh, M.; Chandrappa, P.H.; Ramesh, B.; Chattopadhyay, D.; Prasad, M. Tomato cultivar tolerant to tomato leaf curl New Delhi virus infection induces virus-specific short interfering RNA accumulation and defence-associated host gene expression. Mol. Plant Pathol. 2010, 11, 531–544. [Google Scholar]
- EFSA Panel on Plant Health (PLH); Bragard, C.; Dehnen-Schmutz, K.; Di Serio, F.; Gonthier, P.; Jacques, M.; Miret, J.A.J.; Justesen, A.F.; MacLeod, A.; Magnusson, C.S.; et al. Pest categorisation of tomato leaf curl New Delhi virus. EFSA J. 2020, 18, e06179. [Google Scholar]
- Juárez, M.; Tovar, R.; Fiallo-Olivé, E.; Aranda, M.A.; Gosálvez, B.; Castillo, P.; Moriones, E.; Navas-Castillo, J. First detection of tomato leaf curl New Delhi virus infecting zucchini in Spain. Plant Dis. 2014, 98, 857. [Google Scholar]
- Panno, S.; Iacono, G.; Davino, M.; Marchione, S.; Zappardo, V.; Bella, P.; Tomassoli, L.; Accotto, G.; Davino, S. First report of tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy. New Dis. Rep. 2016, 33, 6. [Google Scholar]
- Sifres Cuerda, A.G.; Sáez-Sánchez, C.; Molina, M.F.; Selmani, E.; Riado, J.; Sirvent, M.B.P.; Del Rincón, C.L. First report of tomato leaf curl New Delhi virus infecting zucchini in Morocco. Plant Dis. 2018, 102, 1045. [Google Scholar]
- Orfanidou, C.G.; Malandraki, I.; Beris, D.; Kektsidou, O.; Vassilakos, N.; Varveri, C.; Katis, N.I.; Maliogka, V.I. First report of tomato leaf curl New Delhi virus in zucchini crops in Greece. J. Plant Pathol. 2019, 101, 799. [Google Scholar]
- Akhter, A.; Akhtar, S.; Saeed, M.; Mansoor, S. Chili leaf curl betasatellite enhances symptoms induced by tomato leaf curl New Delhi virus a bipartite begomovirus. Int. J. Agric. Biol. 2014, 16, 1225–1228. [Google Scholar]
- Shafiq, M.; Asad, S.; Zafar, Y.; Briddon, R.W.; Mansoor, S. Pepper leaf curl Lahore virus requires the DNA B component of tomato leaf curl New Delhi virus to cause leaf curl symptoms. Virol. J. 2010, 7, 367. [Google Scholar] [PubMed]
- Vats, S.; Kumawat, S.; Kumar, V.; Patil, G.B.; Joshi, T.; Sonah, H.; Sharma, T.R.; Deshmukh, R. Genome editing in plants: Exploration of technological advancements and challenges. Cells 2019, 8, 1386. [Google Scholar] [CrossRef] [Scilit]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar]
- Jiang, W.; Zhou, H.; Bi, H.; Fromm, M.; Yang, B.; Weeks, D.P. Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res. 2013, 41, e188. [Google Scholar]
- Pan, C.; Ye, L.; Qin, L.; Liu, X.; He, Y.; Wang, J.; Chen, L.; Lu, G. CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations. Sci. Rep. 2016, 6, 24765. [Google Scholar]
- Schachtsiek, J.; Stehle, F. Nicotine-free, nontransgenic tobacco (Nicotiana tabacum L.) edited by CRISPR-Cas9. Plant Biotechnol. J. 2019, 17, 2228–2230. [Google Scholar]
- Howells, R.M.; Craze, M.; Bowden, S.; Wallington, E.J. Wallington. Efficient generation of stable, heritable gene edits in wheat using CRISPR/Cas9. BMC Plant Biol. 2018, 18, 215. [Google Scholar]
- Miki, D.; Zhang, W.; Zeng, W.; Feng, Z.; Zhu, J.-K. CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation. Nat. Commun. 2018, 9, 1967. [Google Scholar]
- Feng, Z.; Zhang, B.; Ding, W.; Liu, X.; Yang, D.-L.; Wei, P.; Cao, F.; Zhu, S.; Zhang, F.; Mao, Y.; et al. Efficient genome editing in plants using a CRISPR/Cas system. Cell Res. 2013, 23, 1229–1232. [Google Scholar] [PubMed]
- Bortesi, L.; Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol. Adv. 2015, 33, 41–52. [Google Scholar] [PubMed]
- Baltes, N.J.; Hummel, A.W.; Konecna, E.; Cegan, R.; Bruns, A.N.; Bisaro, D.M.; Voytas, D.F. Conferring resistance to geminiviruses with the CRISPR–Cas prokaryotic immune system. Nat. Plants 2015, 1, 15145. [Google Scholar] [PubMed]
- Zhan, X.; Zhang, F.; Li, N.; Xu, K.; Wang, X.; Gao, S.; Yin, Y.; Yuan, W.; Chen, W.; Ren, Z.; et al. CRISPR/Cas: An Emerging Toolbox for Engineering Virus Resistance in Plants. Plants 2024, 13, 3313. [Google Scholar] [CrossRef] [Scilit]
- Mehta, D.; Stürchler, A.; Anjanappa, R.B.; Zaidi, S.S.-e.-A.; Hirsch-Hoffmann, M.; Gruissem, W.; Vanderschuren, H. Linking CRISPR-Cas9 interference in cassava to the evolution of editing-resistant geminiviruses. Genome Biol. 2019, 20, 80. [Google Scholar]
- Rybicki, E.P. CRISPR–Cas9 strikes out in cassava. Nat. Biotechnol. 2019, 37, 727–728. [Google Scholar]
- Roy, A.; Zhai, Y.; Ortiz, J.; Neff, M.; Mandal, B.; Mukherjee, S.K.; Pappu, H.R.; Melcher, U. Duplexed editing of a begomovirus genome restricts escape mutant formation and disease development. PLoS ONE 2019, 14, e0223765. [Google Scholar]
- Zafar, Z.; Nawaz-Ul-Rehman, M.S.; Mubin, M.; Jamil, A. Tomato leaf curl Palampur virus; an otherwise bipartite begomovirus infects the chili crop in association with betasatellite. Pak. J. Agri. Sci. 2023, 60, 117–124. [Google Scholar]
- Hellens, R.P.; Edwards, E.A.; Leyland, N.R.; Bean, S.; Mullineaux, P.M. pGreen: A versatile and flexible binary Ti vector for agrobacterium-mediated plant transformation. Plant Mol. Biol. 2000, 42, 819–832. [Google Scholar]
- Thomas, C.L.; Jones, L.; Baulcombe, D.C.; Maule, A.J. Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J. 2001, 25, 417–425. [Google Scholar]
- Doyle, J.J.; Doyle, J.L.; Brown, A. A chloroplast-DNA phylogeny of the wild perennial relatives of soybean (Glycine subgenus Glycine): Congruence with morphological and crossing groups. Evolution 1990, 44, 371–389. [Google Scholar]
- Briddon, R.W.; Markham, P.G. Universal primers for the PCR amplification of dicot-lnfecting geminiviruses. Mol. Biotechnol. 1994, 1, 202–205. [Google Scholar] [PubMed]
- Karvelis, T.; Gasiunas, G.; Young, J.; Bigelyte, G.; Silanskas, A.; Cigan, M.; Siksnys, V. Rapid characterization of CRISPR-Cas9 protospacer adjacent motif sequence elements. Genome Biol. 2015, 16, 253. [Google Scholar]
- Naito, Y.; Hino, K.; Bono, H.; Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 2015, 31, 1120–1123. [Google Scholar] [PubMed]
- Larson, M.H.; Gilbert, L.A.; Wang, X.; Lim, W.A.; Weissman, J.S.; Qi, L.S. CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat. Protoc. 2013, 8, 2180–2196. [Google Scholar]
- Karmakar, S.; Behera, D.; Baig, M.J.; Molla, K.A. In vitro Cas9 cleavage assay to check guide RNA efficiency. In CRISPR-Cas Methods; Humana: New York, NY, USA, 2021; Volume 2, pp. 23–39. [Google Scholar]
- Lowder, L.G.; Zhang, D.; Baltes, N.J.; Paul, J.W., III; Tang, X.; Zheng, X.; Voytas, D.F.; Hsieh, T.-F.; Zhang, Y.; Qi, Y. A CRISPR/Cas9 toolbox for duplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015, 169, 971–985. [Google Scholar]
- Tang, X.; Lowder, L.G.; Zhang, T.; Malzahn, A.A.; Zheng, X.; Voytas, D.F.; Zhong, Z.; Chen, Y.; Ren, Q.; Li, Q.; et al. A CRISPR–Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat. Plants 2017, 3, 17018. [Google Scholar]
- Bechtold, N.; Bouchez, D. In planta agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. In Gene Transfer to Plants; Springer: Berlin/Heidelberg, Germany, 1995; pp. 19–23. [Google Scholar]
- Idris, A.; Al-Saleh, M.; Amer, M.; Abdalla, O.; Brown, J. Introduction of Cotton leaf curl Gezira virus into the United Arab Emirates. Plant Dis. 2014, 98, 1593. [Google Scholar]
- Guenoune-Gelbart, D.; Sufrin-Ringwald, T.; Capobianco, H.; Gaba, V.; Polston, J.E.; Lapidot, M. Inoculation of plants with begomoviruses by particle bombardment without cloning: Using rolling circle amplification of total DNA from infected plants and whiteflies. J. Virol. Methods 2010, 168, 87–93. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar]
- Zaidi, S.S.; Martin, D.P.; Amin, I.; Farooq, M.; Mansoor, S. Tomato leaf curl New Delhi virus: A widespread bipartite begomovirus in the territory of monopartite begomoviruses. Mol. Plant Pathol. 2017, 18, 901–911. [Google Scholar] [PubMed]
- Kheireddine, A.; Sifres, A.; Sáez, C.; Picó, B.; López, C. First report of tomato leaf curl New Delhi virus infecting cucurbit plants in Algeria. Plant Dis. 2019, 103, 3291. [Google Scholar]
- Hsu, P.D.; Lander, E.S.; Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157, 1262–1278. [Google Scholar]
- Ali, Z.; Ali, S.; Tashkandi, M.; Zaidi, S.S.-E.; Mahfouz, M.M. CRISPR/Cas9-mediated immunity to geminiviruses: Differential interference and evasion. Sci. Rep. 2016, 6, 26912. [Google Scholar]
- Ali, Z.; Abulfaraj, A.; Idris, A.; Ali, S.; Tashkandi, M.; Mahfouz, M.M. CRISPR/Cas9-mediated viral interference in plants. Genome Biol. 2015, 16, 238. [Google Scholar]
- Xie, K.; Minkenberg, B.; Yang, Y. Boosting CRISPR/Cas9 duplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. USA 2015, 112, 3570–3575. [Google Scholar]
- Xing, H.-L.; Dong, L.; Wang, Z.-P.; Zhang, H.-Y.; Han, C.-Y.; Liu, B.; Wang, X.-C.; Chen, Q.-J. A CRISPR/Cas9 toolkit for duplex genome editing in plants. BMC Plant Biol. 2014, 14, 327. [Google Scholar]






| Primer Name | Primer Sequence |
|---|---|
| BegomoF | 5′ GCCYATRTAYAGRAAGCCMAG 3′ |
| BegomoR | 5′ GGRTTDGARGCATGHGTACANGCC 3′ |
| pTC14-F2 | 5′ CAAGCCTGATTGGGAGAAAA 3′ |
| M13-F | 5′ CCCAGTCACGACGTTGTAAAACG 3′ |
| M13-R | 5′ GGAAACAGCTATGACCATG 3′ |
| AVcore | 5′ GCCHATRTAYAGRAAGCCMAGRAT 3′ |
| ACcore | 5′ GGRTTDGARGCATGHGTACANGCC 3′ |
| Genomic Region | gRNA Name | Sequence | PAM | Position in Genome | No. of SNP’s | CRISPR-Direct | ||
|---|---|---|---|---|---|---|---|---|
| 20 mer PAM | 12 mer PAM | 8 mer PAM | ||||||
| AV1 ORF (Coat Protein region) | AV1-01 * | GTTGAAATGATGATATCTGC * | TGG | 293- 315 | 1 | 0 | 0 | 517 |
| AV1-02 * | GTTCATCGGCCTGTTGGTCC * | AGG | 459–481 | 1 | 0 | 0 | 176 | |
| AV1-03 | TAGAAGTCCCGACGTGCCAA | GGG | 460–482 | 4 | 0 | 0 | 152 | |
| AV1-04 | TGTGTTAGTGATGTTACCCG | AGG | 554–576 | 4 | 0 | 1 | 55 | |
| AV1-05 | GTGAAATCCGTCTATGTGCT | GGG | 614–636 | 10 | 0 | 2 | 164 | |
| AV1-06 | GAAGTGGCATGCGACTGTGA | CGG | 823–845 | 7 | 0 | 0 | 1020 | |
| AV1-07 * | GTTATCAAGTCTTACGGAAG * | TGG | 807–829 | 2 | 0 | 0 | 416 | |
| AV1-08 | GTTTATAATCAACAAGAGGC | CGG | 911–933 | 5 | 0 | 0 | 231 | |
| AC1 ORF (Rep Protein region) | AC1-01 * | CTCGAAGAACCACTCTATTC * | CGG | 1561–1583 | 1 | 0 | 3 | 436 |
| AC1-02 * | GATTTAGCTCCCTGAATGTT * | CGG | 2302–2324 | 1 | 0 | 1 | 2864 | |
| AC1-03 * | GTCATCAATGACGTTGTACC * | AGG | 1803–1825 | 0 | 0 | 1 | 536 | |
| AC1-04 | GGGCCTAAAAGGCCGCGCAG | CGG | 1947–1969 | 7 | 0 | 0 | 72 | |
| AC1-05 | GGAGAAACATAAACCTCGGA | AGG | 2041–2063 | 12 | 0 | 0 | 38 | |
| gRNA | Sequence from 5′ to 3′ |
|---|---|
| AV1-01 | TTCTAATACGACTCACTATAGTTGAAATGATGATATCTGCGTTTTAGAGCTAGA |
| AV1-02 | TTCTAATACGACTCACTATAGTTCATCGGCCTGTTGGTCCGTTTTAGAGCTAGA |
| AV1-07 | TTCTAATACGACTCACTATAGTTATCAAGTCTTACGGAAGGTTTTAGAGCTAGA |
| AC1-01 | TTCTAATACGACTCACTATAGCTCGAAGAACCACTCTATTCGTTTTAGAGCTAGA |
| AC1-02 | TTCTAATACGACTCACTATAGATTTAGCTCCCTGAATGTTGTTTTAGAGCTAGA |
| AC1-03 | TTCTAATACGACTCACTATAGTCATCAATGACGTTGTACCGTTTTAGAGCTAGA |
| Selected gRNA | Two Strands of Oligo Sequence with Linkers (5′-3′) | Entry Vector | Name of Clone |
|---|---|---|---|
| AC1-03 | Top: GATTGTCATCAATGACGTTGTACC | pYPQ131 | gRNA 1 |
| Bottom: AAACGGTACAACGTCATTGATGAC | |||
| AC1-02 | Top: GATTGATTTAGCTCCCTGAATGTT | pYPQ132 | gRNA 2 |
| Bottom: AAACAACATTCAGGGAGCTAAATC | |||
| AV1-02 | Top: GATTGTTCATCGGCCTGTTGGTCC | pYPQ132 | gRNA 3 |
| Bottom: AAACGGACCAACAGGCCGATGAAC | |||
| AV1-01 | Top: GATTGTTGAAATGATGATATCTGC | pYPQ131 | gRNA 4 |
| Bottom: AAACGCAGATATCATCATTTCAAC |
| Construct Name | gRNA Sequence | Target Region |
|---|---|---|
| Construct 1 | gRNA 1 + gRNA 3 | Rep region and CP region (Dual target) |
| Construct 2 | gRNA 4 + gRNA 2 | Rep region and CP region (Dual target) |
| Construct 3 | gRNA 4 + gRNA 3 | CP region (Single target) |
| Construct 4 | gRNA 1 + gRNA 2 | Rep region (Single target) |
| Treatment | No of Plants Replication-1 | No of Plants Replication-2 | No of Plants Replication-3 | Symptoms |
|---|---|---|---|---|
| CRISPR construct 1 coupled with ToLCNDV DNA-A & DNA-B dimer | 10 plants | 10 plants | 10 plants | No symptoms |
| CRISPR construct 2 coupled with ToLCNDV DNA-A & DNA-B dimer | 10 plants | 10 plants | 10 plants | No symptoms |
| CRISPR construct 3 coupled with ToLCNDV DNA-A & DNA-B dimer | 10 plants | 10 plants | 10 plants | No symptoms |
| CRISPR construct 4 coupled with ToLCNDV DNA-A & DNA-B dimer | 10 plants | 10 plants | 10 plants | No symptoms |
| ToLCNDV DNA-A & DNA-B dimer (negative control) | 10 plants | 9 plants | 9 plants | Severe leaf curling and vein thickening |
| ToLCNDV DNA-A dimer | 5 plants | 5 plants | 5 plants | Severe leaf curling and vein thickening |
| Mock control (inoculated with non-transformed agrobacterium) | 10 plants | 10 plants | 10 plants | No symptoms |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Naveed, S.; Brown, J.K.; Mubin, M.; Javed, N.; Nawaz-ul-Rehman, M.S. Potential for Duplexed, In-Tandem gRNA-Mediated Suppression of Two Essential Genes of Tomato Leaf Curl New Delhi Virus in Crop Plants. Pathogens 2025, 14, 679. https://doi.org/10.3390/pathogens14070679
Naveed S, Brown JK, Mubin M, Javed N, Nawaz-ul-Rehman MS. Potential for Duplexed, In-Tandem gRNA-Mediated Suppression of Two Essential Genes of Tomato Leaf Curl New Delhi Virus in Crop Plants. Pathogens. 2025; 14(7):679. https://doi.org/10.3390/pathogens14070679
Chicago/Turabian StyleNaveed, Saher, Judith K. Brown, Muhammad Mubin, Nazir Javed, and Muhammad Shah Nawaz-ul-Rehman. 2025. "Potential for Duplexed, In-Tandem gRNA-Mediated Suppression of Two Essential Genes of Tomato Leaf Curl New Delhi Virus in Crop Plants" Pathogens 14, no. 7: 679. https://doi.org/10.3390/pathogens14070679
APA StyleNaveed, S., Brown, J. K., Mubin, M., Javed, N., & Nawaz-ul-Rehman, M. S. (2025). Potential for Duplexed, In-Tandem gRNA-Mediated Suppression of Two Essential Genes of Tomato Leaf Curl New Delhi Virus in Crop Plants. Pathogens, 14(7), 679. https://doi.org/10.3390/pathogens14070679

