Detection and Characterization of Paslahepevirus balayani (Hepatitis E Virus) in Dairy Products from Hebei Province, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Viral RNA Extraction
2.3. RT-qPCR and RT-Nested PCR
2.4. Sequencing and Phylogenetic Analysis of the HEV ORF2 Gene
3. Results
3.1. HEV RNA in Cow, Sheep, and Goat Milk
3.2. Analysis of Sequencing Results
3.3. Phylogenetic Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization. Hepatitis E. Available online: https://www.who.int/news-room/fact-sheets/detail/hepatitis-e (accessed on 16 October 2024).
- Yugo, D.M.; Meng, X.J. Hepatitis E virus: Foodborne, waterborne and zoonotic transmission. Int. J. Environ. Res. Public Health 2013, 10, 4507–4533. [Google Scholar] [CrossRef]
- Dong, D.; Zou, S.; Tang, S. Analysis on the spatial-temporal epidemiological characteristics of viral hepatitis in China from 2009 to 2019. Mod. Prev. Med. 2024, 51, 595–601. [Google Scholar] [CrossRef]
- National Disease Control and Prevention Administration of China. Overview of the Epidemic Situation of Statutory Infectious Diseases in the Country for 2024. Available online: https://www.ndcpa.gov.cn/ (accessed on 16 October 2024).
- Park, K.; Kim, J.; Noh, J.; Kim, K.; Yang, E.; Kim, S.G.; Cho, H.K.; Byun, K.S.; Kim, J.H.; Lee, Y.S.; et al. First detection and characterization of hepatitis E virus (Rocahepevirus ratti) from urban Norway rats (Rattus norvegicus) in the Republic of Korea. J. Med. Virol. 2024, 96, e29401. [Google Scholar] [CrossRef] [PubMed]
- Kamar, N.; Selves, J.; Mansuy, J.M.; Ouezzani, L.; Péron, J.M.; Guitard, J.; Cointault, O.; Esposito, L.; Abravanel, F.; Danjoux, M.; et al. Hepatitis E virus and chronic hepatitis in organ-transplant recipients. N. Engl. J. Med. 2008, 358, 811–817. [Google Scholar] [CrossRef] [PubMed]
- Reyes, G.R.; Purdy, M.A.; Kim, J.P.; Luk, K.C.; Young, L.M.; Fry, K.E.; Bradley, D.W. Isolation of a cDNA from the virus responsible for enterically transmitted non-A, non-B hepatitis. Science 1990, 247, 1335–1339. [Google Scholar] [CrossRef]
- Tam, A.W.; Smith, M.M.; Guerra, M.E.; Huang, C.C.; Bradley, D.W.; Fry, K.E.; Reyes, G.R. Hepatitis E virus (HEV): Molecular cloning and sequencing of the full-length viral genome. Virology 1991, 185, 120–131. [Google Scholar] [CrossRef]
- Cancela, F.; Noceti, O.; Arbiza, J.; Mirazo, S. Structural aspects of hepatitis E virus. Arch. Virol. 2022, 167, 2457–2481. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.B.; Izopet, J.; Nicot, F.; Simmonds, P.; Jameel, S.; Meng, X.J.; Norder, H.; Okamoto, H.; van der Poel, W.H.M.; Reuter, G.; et al. Update: Proposed reference sequences for subtypes of hepatitis E virus (species Orthohepevirus A). J. Gen. Virol. 2020, 101, 692–698. [Google Scholar] [CrossRef]
- Li, S.; Liu, M.; Cong, J.; Zhou, Y.; Miao, Z. Detection and Characterization of Hepatitis E Virus in Goats at Slaughterhouse in Tai’an Region, China. Biomed. Res. Int. 2017, 2017, 3723650. [Google Scholar] [CrossRef]
- Kamar, N.; Izopet, J.; Pavio, N.; Aggarwal, R.; Labrique, A.; Wedemeyer, H.; Dalton, H.R. Hepatitis E virus infection. Nat. Rev. Dis. Primers 2017, 3, 17086. [Google Scholar] [CrossRef]
- Wang, B.; Meng, X.J. Hepatitis E virus: Host tropism and zoonotic infection. Curr. Opin. Microbiol. 2021, 59, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Turlewicz-Podbielska, H.; Augustyniak, A.; Wojciechowski, J.; Pomorska-Mól, M. Hepatitis E Virus in Livestock—Update on Its Epidemiology and Risk of Infection to Humans. Animals 2023, 13, 3239. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.J.; Zhao, Q.; Jiang, F.L.; Liu, B.Y.; Zhao, J.N.; Dang, L.; Sun, Y.N.; Mu, Y.; Xiao, S.Q.; Wang, C.B.; et al. Genetic characterization and serological prevalence of swine hepatitis E virus in Shandong province, China. Vet. Microbiol. 2014, 172, 415–424. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Liu, L.; Wang, J.; Sun, X.; Han, Q.; Zhou, C.; Xu, X.; Wang, J. Quantification of hepatitis E virus in raw pork livers using droplet digital RT-PCR. Food Microbiol. 2023, 109, 104114. [Google Scholar] [CrossRef]
- Wang, W.; Wu, W.; Chen, M.; Teng, Z. Prevalence of hepatitis E virus in domestic animals in the Chinese mainland: A systematic review and meta-analysis. BMC Vet. Res. 2025, 21, 136. [Google Scholar] [CrossRef]
- Doceul, V.; Bagdassarian, E.; Demange, A.; Pavio, N. Zoonotic Hepatitis E Virus: Classification, Animal Reservoirs and Transmission Routes. Viruses 2016, 8, 270. [Google Scholar] [CrossRef]
- Schlosser, J.; Eiden, M.; Vina-Rodriguez, A.; Fast, C.; Dremsek, P.; Lange, E.; Ulrich, R.G.; Groschup, M.H. Natural and experimental hepatitis E virus genotype 3-infection in European wild boar is transmissible to domestic pigs. Vet. Res. 2014, 45, 121. [Google Scholar] [CrossRef]
- Izopet, J.; Dubois, M.; Bertagnoli, S.; Lhomme, S.; Marchandeau, S.; Boucher, S.; Kamar, N.; Abravanel, F.; Guérin, J.L. Hepatitis E virus strains in rabbits and evidence of a closely related strain in humans, France. Emerg. Infect. Dis. 2012, 18, 1274–1281. [Google Scholar] [CrossRef]
- Yan, B.; Zhang, L.; Gong, L.; Lv, J.; Feng, Y.; Liu, J.; Song, L.; Xu, Q.; Jiang, M.; Xu, A. Hepatitis E Virus in Yellow Cattle, Shandong, Eastern China. Emerg. Infect. Dis. 2016, 22, 2211–2212. [Google Scholar] [CrossRef]
- Tian, F.; Li, J.; Liu, Y.; Liu, W.; Liu, Y.; Xu, S.; Tong, Y.; Feng, F. First molecular evidence of hepatitis E virus in farmed raccoon dogs. Emerg. Microbes Infect. 2024, 13, 2361025. [Google Scholar] [CrossRef]
- Huang, F.; Li, Y.; Yu, W.; Jing, S.; Wang, J.; Long, F.; He, Z.; Yang, C.; Bi, Y.; Cao, W.; et al. Excretion of infectious hepatitis E virus into milk in cows imposes high risks of zoonosis. Hepatology 2016, 64, 350–359. [Google Scholar] [CrossRef]
- Dziedzinska, R.; Krzyzankova, M.; Bena, M.; Vasickova, P. Evidence of Hepatitis E Virus in Goat and Sheep Milk. Viruses 2020, 12, 1429. [Google Scholar] [CrossRef] [PubMed]
- Demirci, M.; Yiğin, A.; Ünlü, Ö.; Kılıç Altun, S. Detection of HEV RNA amounts and genotypes in raw milks obtained from different animals. Mikrobiyol. Bül. 2019, 53, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Sayed, I.M.; Elkhawaga, A.A.; El-Mokhtar, M.A. Circulation of hepatitis E virus (HEV) and/or HEV-like agent in non-mixed dairy farms could represent a potential source of infection for Egyptian people. Int. J. Food Microbiol. 2020, 317, 108479. [Google Scholar] [CrossRef]
- Long, F.; Yu, W.; Yang, C.; Wang, J.; Li, Y.; Li, Y.; Huang, F. High prevalence of hepatitis E virus infection in goats. J. Med. Virol. 2017, 89, 1981–1987. [Google Scholar] [CrossRef]
- Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef]
- Huang, F.F.; Haqshenas, G.; Guenette, D.K.; Halbur, P.G.; Schommer, S.K.; Pierson, F.W.; Toth, T.E.; Meng, X.J. Detection by reverse transcription-PCR and genetic characterization of field isolates of swine hepatitis E virus from pigs in different geographic regions of the United States. J. Clin. Microbiol. 2002, 40, 1326–1332. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Chen, Y.; Cai, G.; Cai, R.; Hu, Z.; Wang, H. Tree Visualization by One Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Wu, J.; Si, F.; Jiang, C.; Li, T.; Jin, M. Molecular detection of hepatitis E virus in sheep from southern Xinjiang, China. Virus Genes 2015, 50, 410–417. [Google Scholar] [CrossRef]
- Xu, F.; Pan, Y.; Baloch, A.R.; Tian, L.; Wang, M.; Na, W.; Ding, L.; Zeng, Q. Hepatitis E virus genotype 4 in yak, northwestern China. Emerg. Infect. Dis. 2014, 20, 2182–2184. [Google Scholar] [CrossRef] [PubMed]
- Rivero-Juarez, A.; Frias, M.; Rodriguez-Cano, D.; Cuenca-López, F.; Rivero, A. Isolation of Hepatitis E Virus from Breast Milk During Acute Infection. Clin. Infect. Dis. 2016, 62, 1464. [Google Scholar] [CrossRef] [PubMed]
- El-Mokhtar, M.A.; Elkhawaga, A.A.; Sayed, I.M. Assessment of hepatitis E virus (HEV) in the edible goat products pointed out a risk for human infection in Upper Egypt. Int. J. Food Microbiol. 2020, 330, 108784. [Google Scholar] [CrossRef]
- Geng, Y.; Zhao, C.; Guo, T.; Xu, Y.; Wang, X.; Huang, W.; Liu, H.; Wang, Y. Detection of Hepatitis E Virus in Raw Pork and Pig Viscera as Food in Hebei Province of China. Foodborne Pathog. Dis. 2019, 16, 325–330. [Google Scholar] [CrossRef] [PubMed]
- Geng, Y.; Zhao, C.; Fan, J.; Harrison, T.J.; Zhang, H.; Lian, H.; Geng, K.; Wang, Y. Genotype analysis of hepatitis E virus from sporadic hepatitis E cases in northern China. Infect. Genet. Evol. 2013, 20, 413–417. [Google Scholar] [CrossRef]
- Di Martino, B.; Di Profio, F.; Melegari, I.; Sarchese, V.; Robetto, S.; Marsilio, F.; Martella, V. Detection of hepatitis E virus (HEV) in goats. Virus Res. 2016, 225, 69–72. [Google Scholar] [CrossRef]
- Khuroo, M.S.; Khuroo, M.S.; Khuroo, N.S. Transmission of Hepatitis E Virus in Developing Countries. Viruses 2016, 8, 253. [Google Scholar] [CrossRef]
- Priemer, G.; Cierniak, F.; Wolf, C.; Ulrich, R.G.; Groschup, M.H.; Eiden, M. Co-Circulation of Different Hepatitis E Virus Genotype 3 Subtypes in Pigs and Wild Boar in North-East Germany, 2019. Pathogens 2022, 11, 773. [Google Scholar] [CrossRef]
- Izopet, J.; Tremeaux, P.; Marion, O.; Migueres, M.; Capelli, N.; Chapuy-Regaud, S.; Mansuy, J.M.; Abravanel, F.; Kamar, N.; Lhomme, S. Hepatitis E virus infections in Europe. J. Clin. Virol. 2019, 120, 20–26. [Google Scholar] [CrossRef]
- Baechlein, C.; Becher, P. No evidence for zoonotic hepatitis E virus infection through dairy milk in Germany. Hepatology 2017, 65, 394–395. [Google Scholar] [CrossRef]
- Vercouter, A.S.; Sayed, I.M.; Lipkens, Z.; De Bleecker, K.; De Vliegher, S.; Colman, R.; Koppelman, M.; Supré, K.; Meuleman, P. Absence of zoonotic hepatitis E virus infection in Flemish dairy cows. Int. J. Food Microbiol. 2018, 281, 54–59. [Google Scholar] [CrossRef] [PubMed]
- Geng, Y.; Zhao, C.; Huang, W.; Wang, X.; Xu, Y.; Wu, D.; Du, Y.; Liu, H.; Wang, Y. Hepatitis E virus was not detected in feces and milk of cows in Hebei province of China: No evidence for HEV prevalence in cows. Int. J. Food Microbiol. 2019, 291, 5–9. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Geng, K.; Wang, C.; Shi, T.; Zhang, H.; Zhao, C.; Geng, Y. Epidemiological study of hepatitis E virus infection among students and workers in Hebei Province of China. Zoonoses Public Health 2024, 71, 799–806. [Google Scholar] [CrossRef] [PubMed]


| Location | Animal Species | Breeds | Area | Number of Samples | Total |
|---|---|---|---|---|---|
| Shijiazhuang | Cow | Holstein Cow | Street vendors | 6 | 12 |
| Goat | Boer Goat | Rural | 6 | ||
| Baoding | Cow | Holstein Cow | Farms | 57 | 69 |
| Goat | Boer Goat | Rural | 1 | ||
| Sheep | Small-Tailed Han Sheep | Rural | 11 | ||
| Hengshui | Cow | Holstein Cow | Farm | 20 | 39 |
| Goat | Boer Goat | Rural | 12 | ||
| Sheep | Small-Tailed Han Sheep | Rural | 7 | ||
| Xingtai | Cow | Holstein Cow | Farm | 19 | 19 |
| Qinhuangdao | Goat | Cashmere Goat | Farm | 10 | 10 |
| Tangshan | Goat | Saanen Goat | Farm | 30 | 30 |
| Total | - | - | - | - | 179 |
| Amplified Region | Primer/Probes Designation | Sequences (5′-3′) | Nucleotide Region Spanning | Product Length (bp) | Reference |
|---|---|---|---|---|---|
| ORF3 | JVHEVF | GGTGGTTTCTGGGGTGAC | 5310–5327 | 70 | [28] |
| JVHEVR | AGGGGTTGGTTGGATGAA | 5362–5379 | |||
| JVHEVP | FAM-TGATTCTCAGCCCTTCGC-MGB | 5333–5350 | |||
| ORF2 | 3156NF | AATTATGCYCAGTAYCGRGTTG 2 | 5736–5757 | 731 | [29] |
| 3157NR | CCCTTRTCYTGCTGMGCATTCTC 2 | 6444–6466 | |||
| 3158NF | GTWATGCTYTGCATWCATGGCT 2 | 6021–6040 | 348 | ||
| 3159NR | AGCCGACGAAATCAATTCTGTC | 6347–6366 |
| Location | Cow | Goat | Sheep | Total |
|---|---|---|---|---|
| Shijiazhuang | 0.00 (0/6) | 0.00 (0/6) | - | 0.00 (0/12) |
| Baoding | 0.00 (0/57) | 0.00 (0/1) | 27.27 (3/11) | 4.35 (3/69) |
| Hengshui | 0.00 (0/20) | 8.33 (1/12) | 0.00 (0/7) | 2.56 (1/39) |
| Xingtai | 0.00 (0/19) | - | - | 0.00 (0/19) |
| Qinhuangdao | - | 0.00 (0/10) | - | 0.00 (0/10) |
| Tangshan | - | 0.00 (0/30) | - | 0.00 (0/30) |
| Total | 0.00 (0/102) | 1.69 (1/59) | 16.67 (3/18) | 2.23 (4/179) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, X.; Wang, J.; Wang, Y.; Yuan, W.; Wang, J.; Xu, X. Detection and Characterization of Paslahepevirus balayani (Hepatitis E Virus) in Dairy Products from Hebei Province, China. Pathogens 2025, 14, 564. https://doi.org/10.3390/pathogens14060564
Hu X, Wang J, Wang Y, Yuan W, Wang J, Xu X. Detection and Characterization of Paslahepevirus balayani (Hepatitis E Virus) in Dairy Products from Hebei Province, China. Pathogens. 2025; 14(6):564. https://doi.org/10.3390/pathogens14060564
Chicago/Turabian StyleHu, Xinyue, Jinfeng Wang, Yinuo Wang, Wanzhe Yuan, Jianchang Wang, and Xiangdong Xu. 2025. "Detection and Characterization of Paslahepevirus balayani (Hepatitis E Virus) in Dairy Products from Hebei Province, China" Pathogens 14, no. 6: 564. https://doi.org/10.3390/pathogens14060564
APA StyleHu, X., Wang, J., Wang, Y., Yuan, W., Wang, J., & Xu, X. (2025). Detection and Characterization of Paslahepevirus balayani (Hepatitis E Virus) in Dairy Products from Hebei Province, China. Pathogens, 14(6), 564. https://doi.org/10.3390/pathogens14060564

