Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation and Identification of C. perfringens from Pork and Chicken Meat
2.3. Detection of Toxin Genes of C. perfringens Isolated from Pork and Chicken Meat
2.4. Antimicrobial Susceptibility of C. perfringens Isolates
3. Results
3.1. The Isolation and Identification of C. perfringens from Pork and Chicken Meat
3.2. Detection of the Toxin Genes of C. perfringens Isolates
3.3. Antimicrobial Resistance Profile of C. perfringens Isolated from Pork and Chicken Meat
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hustá, M.; Ducatelle, R.; Haesebrouck, F.; Van Immerseel, F.; Goossens, E. A Comparative Study on the Use of Selective Media for the Enumeration of Clostridium perfringens in Poultry Faeces. Anaerobe 2020, 63, 102205. [Google Scholar] [CrossRef] [PubMed]
- Petit, L.; Gibert, M.; Popoff, M.R. Clostridium perfringens: Toxinotype and Genotype. Trends Microbiol. 1999, 7, 104–110. [Google Scholar] [CrossRef]
- Abdelrahim, A.M.; Radomski, N.; Delannoy, S.; Djellal, S.; Le Négrate, M.; Hadjab, K.; Fach, P.; Hennekinne, J.A.; Mistou, M.Y.; Firmesse, O. Large-Scale Genomic Analyses and Toxinotyping of Clostridium Perfringens Implicated in Foodborne Outbreaks in France. Front. Microbiol. 2019, 10, 777. [Google Scholar] [CrossRef] [PubMed]
- Tansuphasiri, U.; Matra, W.; Sangsuk, L. Antimicrobial Resistance among Clostridium perfringens Isolated from Various Sources in Thailand. Southeast. Asian J. Trop. Med. Public. Health 2005, 36, 954–961. [Google Scholar] [PubMed]
- Guran, H.S.; Oksuztepe, G. Detection and Typing of Clostridium perfringens from Retail Chicken Meat Parts. Lett. Appl. Microbiol. 2013, 57, 77–82. [Google Scholar] [CrossRef]
- Ghoneim, N.H.; Hamza, D.A. Epidemiological Studies on Clostridium perfringens Food Poisoning in Retail Foods. Sci. Tech. Rev. 2017, 36, 1025–1032. [Google Scholar] [CrossRef] [PubMed]
- Grass, J.E.; Gould, L.H.; Mahon, B.E. Epidemiology of Foodborne Disease Outbreaks Caused by Clostridium perfringens, United States, 1998–2010. Foodborne Pathog. Dis. 2013, 10, 131–136. [Google Scholar] [CrossRef] [PubMed]
- Miki, Y.; Miyamoto, K.; Kaneko-Hirano, I.; Fujiuchi, K.; Akimoto, S. Prevalence and Characterization of Enterotoxin Gene-Carrying Clostridium perfringens Isolates from Retail Meat Products in Japan. Appl. Environ. Microbiol. 2008, 74, 5366–5372. [Google Scholar] [CrossRef] [PubMed]
- Dalton, C.B.; Gregory, J.; Kirk, M.D.; Stafford, R.J.; Givney, R.; Kraa, E.; Gould, D. Foodborne Disease Outbreaks in Australia, 1995 to 2000. Commun. Dis. Intell. 2004, 28, 211–224. [Google Scholar]
- Gormley, F.J.; Little, C.L.; Rawal, N.; Gillespie, I.A.; Lebaigue, S.; Adak, G.K. A 17-Year Review of Foodborne Outbreaks: Describing the Continuing Decline in England and Wales (1992–2008). Epidemiol. Infect. 2011, 139, 688–699. [Google Scholar] [CrossRef]
- Wen, Q.; McClane, B.A. Detection of Enterotoxigenic Clostridium perfringens Type A Isolates in American Retail Foods. Appl. Environ. Microbiol. 2004, 70, 2685–2691. [Google Scholar] [CrossRef] [PubMed]
- Revitt-Mills, S.A.; Rood, J.I.; Adams, V. Clostridium perfringens Extracellular Toxins and Enzymes: 20 and Counting. Microbiol. Aust. 2015, 36, 114. [Google Scholar] [CrossRef]
- Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens Toxin-Based Typing Scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef]
- Titball, R.W.; Naylor, C.E.; Basak, A.K. The Clostridium perfringens α-Toxin. Anaerobe 1999, 5, 51–64. [Google Scholar] [CrossRef]
- Bhunia, A.K. Foodborne Microbial Pathogens: Mechanisms and Pathogenesis; Springer: Berlin/Heidelberg, Germany, 2008; ISBN 9780387745367. [Google Scholar]
- Rood, J.I.; Keyburn, A.L.; Moore, R.J. NetB and Necrotic Enteritis: The Hole Movable Story. Avian Pathol. 2016, 45, 295–301. [Google Scholar] [CrossRef] [PubMed]
- Terreni, M.; Taccani, M.; Pregnolato, M. New Antibiotics for Multidrug-Resistant Bacterial Strains: Latest Research Developments and Future Perspectives. Molecules 2021, 26, 2671. [Google Scholar] [CrossRef] [PubMed]
- Laxminarayan, R.; Duse, A.; Wattal, C.; Zaidi, A.K.M.; Wertheim, H.F.L.; Sumpradit, N.; Vlieghe, E.; Hara, G.L.; Gould, I.M.; Goossens, H.; et al. Antibiotic Resistance-the Need for Global Solutions. Lancet Infect. Dis. 2013, 13, 1057–1098. [Google Scholar] [CrossRef] [PubMed]
- Bengtsson, B.; Greko, C. Antibiotic Resistance-Consequences for Animal Health, Welfare, and Food Production. Ups. J. Med. Sci. 2014, 119, 96–102. [Google Scholar] [CrossRef] [PubMed]
- Di, K.N.; Pham, D.T.; Tee, T.S.; Binh, Q.A.; Nguyen, T.C. Antibiotic Usage and Resistance in Animal Production in Vietnam: A Review of Existing Literature. Trop. Anim. Health Prod. 2021, 53, 340. [Google Scholar] [CrossRef]
- Pham-Duc, P.; Cook, M.A.; Cong-Hong, H.; Nguyen-Thuy, H.; Padungtod, P.; Nguyen-Thi, H.; Dang-Xuan, S. Knowledge, Attitudes and Practices of Livestock and Aquaculture Producers Regarding Antimicrobial Use and Resistance in Vietnam. PLoS ONE 2019, 14, e0223115. [Google Scholar] [CrossRef]
- Antimicrobial Resistance: Global Report on Surveillance. Available online: https://apps.who.int/iris/handle/10665/112642 (accessed on 14 August 2023).
- Nhung, N.T.; Cuong, N.V.; Campbell, J.; Hoa, N.T.; Bryant, J.E.; Truc, V.N.T.; Kiet, B.T.; Jombart, T.; Trung, N.V.; Hien, V.B. High Levels of Antimicrobial Resistance among Escherichia coli Isolates from Livestock Farms and Synanthropic Rats and Shrews in the Mekong Delta of Vietnam. Appl. Env. Microbiol. 2015, 81, 812–820. [Google Scholar] [CrossRef]
- Trung, N.V.; Carrique-Mas, J.J.; Nghia, N.H.; Tu, L.T.P.; Mai, H.H.; Tuyen, H.T.; Campbell, J.; Nhung, N.T.; Nhung, H.N.; Minh, P.V.; et al. Non-Typhoidal Salmonella Colonization in Chickens and Humans in the Mekong Delta of Vietnam. Zoonoses Public. Health 2017, 64, 94–99. [Google Scholar] [CrossRef] [PubMed]
- da Silva, N.; Taniwaki, M.H.; Junqueira, V.C.A.; Silveira, N.; Okazaki, M.M.; Romeiro Gomes, R.A. Microbiological Examination Methods of Food and Water: A Laboratory Manual; CRC Press: Boca Raton, FL, USA, 2012. [Google Scholar]
- Tonooka, T.; Sakata, S.; Kitahara, M.; Hanai, M.; Ishizeki, S.; Takada, M.; Sakamoto, M.; Benno, Y. Detection and Quantification of Four Species of the Genus Clostridium in Infant Feces. Microbiol. Immunol. 2005, 49, 987–992. [Google Scholar] [CrossRef] [PubMed]
- Meer, R.R.; Songer, J.G. Multiplex Polymerase Chain Reaction Assay for Genotyping Clostridium perfringens. Am. J. Vet. Res. 1997, 58, 702–705. [Google Scholar] [CrossRef] [PubMed]
- Keyburn, A.L.; Boyce, J.D.; Vaz, P.; Bannam, T.L.; Ford, M.E.; Parker, D.; Di Rubbo, A.; Rood, J.I.; Moore, R.J. NetB, a New Toxin That Is Associated with Avian Necrotic Enteritis Caused by Clostridium perfringens. PLoS Pathog. 2008, 4, e26. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 29th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2019. [Google Scholar]
- Nagpal, R.; Ogata, K.; Tsuji, H.; Matsuda, K.; Takahashi, T.; Nomoto, K.; Suzuki, Y.; Kawashima, K.; Nagata, S.; Yamashiro, Y. Sensitive Quantification of Clostridium perfringens in Human Feces by Quantitative Real-Time PCR Targeting Alpha-Toxin and Enterotoxin Genes. BMC Microbiol. 2015, 15, 219. [Google Scholar] [CrossRef] [PubMed]
- Labbe, R.; Juneja, V.K.; Blaschek, H.P. Clostridium: Clostridium Perfringens, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2014; Volume 1, ISBN 9780123847331. [Google Scholar]
- Miyamoto, K.; Nagahama, M. Clostridium: Food Poisoning by Clostridium Perfringens, 1st ed.; Elsevier Ltd.: Amsterdam, The Netherlands, 2015; ISBN 9780123849533. [Google Scholar]
- Popoff, M.R. Clostridium: Detection of Enterotoxin of Clostridium perfringens. In Encyclopedia of Food Microbiology, 2nd ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2014; pp. 474–480. ISBN 9780123847331. [Google Scholar]
- McClane, B.A.; Robertson, S.L.; Li, J. Clostridium perfringens. In Food Microbiology: Fundamentals and Frontiers; Wiley: Hoboken, NJ, USA, 2012; pp. 465–489. [Google Scholar] [CrossRef]
- Brynestad, S.; Granum, E. Clostridium perfringens and Foodborne Infections. Int. J. Food Microbiol. 2002, 74, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, A.; Uzal, F.A.; McClane, B.A. Enterotoxic Clostridia: Clostridium perfringens Enteric Diseases. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [PubMed]
- McDevitt, R.M.; Brooker, J.D.; Acamovic, T.; Sparks, N.H.C. Necrotic Enteritis; a Continuing Challenge for the Poultry Industry. World’s Poult. Sci. J. 2006, 62, 221–247. [Google Scholar] [CrossRef]
- Wade, B.; Keyburn, A. The True Cost of Necrotic Enteritis. Poult. World 2015, 31, 16–17. [Google Scholar]
- Posthaus, H.; Kittl, S.; Tarek, B.; Bruggisser, J. Clostridium perfringens Type C Necrotic Enteritis in Pigs: Diagnosis, Pathogenesis, and Prevention. J. Vet. Diagn. Investig. 2020, 32, 203–212. [Google Scholar] [CrossRef] [PubMed]
- Hosny, R.A.; Gaber, A.F.; Sorour, H.K. Bacteriophage Mediated Control of Necrotic Enteritis Caused by C. perfringens in Broiler Chickens. Vet. Res. Commun. 2021, 45, 409–421. [Google Scholar] [CrossRef] [PubMed]
- Caly, D.L.; D’Inca, R.; Auclair, E.; Drider, D. Alternatives to Antibiotics to Prevent Necrotic Enteritis in Broiler Chickens: A Microbiologist’s Perspective. Front. Microbiol. 2015, 6, 1336. [Google Scholar] [CrossRef] [PubMed]
- García-Vela, S.; Martínez-Sancho, A.; Ben Said, L.; Torres, C.; Fliss, I. Pathogenicity and Antibiotic Resistance Diversity in Clostridium perfringens Isolates from Poultry Affected by Necrotic Enteritis in Canada. Pathogens 2023, 12, 905. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.; Iqbal, Z.; Siddique, A.; Liao, S.; Salamat, M.K.F.; Qi, N.; Din, A.M.; Sun, M. Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan. Toxins 2020, 12, 657. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.T.; Vu-Khac, H.; Nguyen, T.D. Isolation and Characterization of Clostridium perfringens Strains Isolated from Ostriches (Struthio camelus) in Vietnam. Vet. World 2020, 13, 1679–1684. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.E.; Lim, S.I.; Shin, S.H.; Kwon, Y.K.; Kim, H.Y.; Song, J.Y.; An, D.J. Distribution of Clostridium perfringens Isolates from Piglets in South Korea. J. Vet. Med. Sci. 2014, 76, 745–749. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hassani, S.; Pakbin, B.; Brück, W.M.; Mahmoudi, R.; Mousavi, S. Prevalence, Antibiotic Resistance, Toxin-Typing and Genotyping of Clostridium perfringens in Raw Beef Meats Obtained from Qazvin City, Iran. Antibiotics 2022, 11, 340. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.S.; Kim, D.H.; Bae, D.; Kim, S.H.; Kim, H.; Moon, J.S.; Song, K.Y.; Chon, J.W.; Seo, K.H. Prevalence, Toxin-Typing, and Antimicrobial Susceptibility of Clostridium perfringens from Retail Meats in Seoul, Korea. Anaerobe 2020, 64, 102235. [Google Scholar] [CrossRef]
- Aras, Z.; Hadimli, H.H. Detection and Molecular Typing of Clostridium Perfringens Isolates from Beef, Chicken and Turkey Meats. Anaerobe 2015, 32, 15–17. [Google Scholar] [CrossRef]
- Hu, W.S.; Kim, H.; Koo, O.K. Molecular Genotyping, Biofilm Formation and Antibiotic Resistance of Enterotoxigenic Clostridium perfringens Isolated from Meat Supplied to School Cafeterias in South Korea. Anaerobe 2018, 52, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Yadav, J.P.; Das, S.C.; Dhaka, P.; Vijay, D.; Kumar, M.; Mukhopadhyay, A.K.; Chowdhury, G.; Chauhan, P.; Singh, R.; Dhama, K.; et al. Molecular Characterization and Antimicrobial Resistance Profile of Clostridium perfringens Type A Isolates from Humans, Animals, Fish and Their Environment. Anaerobe 2017, 47, 120–124. [Google Scholar] [CrossRef]
- Ramírez, Á.; de la Morena, A.; Sánchez, N.; Peñuela, L.; Sánchez-Carretero, A.; Muñoz, M.; Llanos, J. Formation of Disinfection By-Products within the Drinking Water Production System and Distribution Network of a Real Case Study. Appl. Water Sci. 2023, 13, 186. [Google Scholar] [CrossRef]
- Khan, M.; Nazir, J.; Anjum, A.A.; Ahmad, M.-U.; Nawaz, M.; Shabbir, M.Z. Toxinotyping and Antimicrobial Susceptibility of Enterotoxigenic Clostridium perfringens Isolates from Mutton, Beef and Chicken Meat. J. Food Sci. Technol. 2015, 52, 5323–5328. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Erol, I.; Goncuoglu, M.; Ayaz, N.D.; Bilir Ormanci, F.S.; Hildebrandt, G. Molecular Typing of Clostridium perfringens Isolated from Turkey Meat by Multiplex PCR. Lett. Appl. Microbiol. 2008, 47, 31–34. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Zhang, W.; Ai, D.; Zhang, R.; Lu, Q.; Luo, Q.; Shao, H. Prevalence and Characterization of Clostridium perfringens in Broiler Chickens and Retail Chicken Meat in Central China. Anaerobe 2018, 54, 100–103. [Google Scholar] [CrossRef] [PubMed]
- Gholamiandehkordi, A.; Eeckhaut, V.; Lanckriet, A.; Timbermont, L.; Bjerrum, L.; Ducatelle, R.; Haesebrouck, F.; Van Immerseel, F. Antimicrobial Resistance in Clostridium perfringens Isolates from Broilers in Belgium. Vet. Res. Commun. 2009, 33, 1031–1037. [Google Scholar] [CrossRef] [PubMed]
- Afshari, A.; Jamshidi, A.; Razmyar, J.; Rad, M. Genotyping of Clostridium perfringens Isolated from Broiler Meat in Northeastern of Iran. Vet. Res. Forum 2015, 6, 279. [Google Scholar] [PubMed]
- Freedman, J.C.; Shrestha, A.; McClane, B.A. Clostridium perfringens Enterotoxin: Action, Genetics, and Translational Applications. Toxins 2016, 8, 73. [Google Scholar] [CrossRef]
- Woittiez, N.J.C.; van Prehn, J.; van Immerseel, F.; Goossens, E.; Bauer, M.P.; Ramspek, C.L.; Slangen, R.M.E.; Purmer, I.M.; Ludikhuize, J. Toxinotype A Clostridium perfringens Causing Septicaemia with Intravascular Haemolysis: Two Cases and Review of the Literature. Int. J. Infect. Dis. 2022, 115, 224–228. [Google Scholar] [CrossRef]
- Pham Kim, D.; Saegerman, C.; Douny, C.; Vu Dinh, T.; Ha Xuan, B.; Dang Vu, B.; Pham Hong, N.; Scippo, M.-L. First Survey on the Use of Antibiotics in Pig and Poultry Production in the Red River Delta Region of Vietnam. Food Public Health 2013, 3, 247–256. [Google Scholar]
- Nhung, N.T.; Cuong, N.V.; Thwaites, G.; Carrique-Mas, J. Antimicrobial Usage and Antimicrobial Resistance in Animal Production in Southeast Asia: A Review. Antibiotics 2016, 5, 37. [Google Scholar] [CrossRef] [PubMed]
- Carrique-Mas, J.J.; Trung, N.V.; Hoa, N.T.; Mai, H.H.; Thanh, T.H.; Campbell, J.I.; Wagenaar, J.A.; Hardon, A.; Hieu, T.Q.; Schultsz, C. Antimicrobial Usage in Chicken Production in the Mekong Delta of Vietnam. Zoonoses Public Health 2015, 62, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Fathima, S.; Al Hakeem, W.G.; Shanmugasundaram, R.; Selvaraj, R.K. Necrotic Enteritis in Broiler Chickens: A Review on the Pathogen, Pathogenesis, and Prevention. Microorganisms 2022, 10, 1958. [Google Scholar] [CrossRef] [PubMed]
- Beres, C.; Colobatiu, L.; Tabaran, A.; Mihaiu, R.; Mihaiu, M. Prevalence and Characterisation of Clostridium Perfringens Isolates in Food-Producing Animals in Romania. Microorganisms 2023, 11, 1373. [Google Scholar] [CrossRef] [PubMed]
- Xiu, L.; Liu, Y.; Wu, W.; Chen, S.; Zhong, Z.; Wang, H. Prevalence and Multilocus Sequence Typing of Clostridium Perfringens Isolated from 4 Duck Farms in Shandong Province, China. Poult. Sci. 2020, 99, 5105–5117. [Google Scholar] [CrossRef]
- Zhong, J.; Zheng, H.; Wang, Y.; Bai, L.; Du, X.; Wu, Y.; Lu, J. Molecular Characteristics and Phylogenetic Analysis of Clostridium perfringens from Different Regions in China, from 2013 to 2021. Front Microbiol 2023, 14, 1195083. [Google Scholar] [CrossRef]
Target Gene | Primer Name | Primer Sequence (5′–3′) | Amplicon Size (bp) | Reference |
---|---|---|---|---|
16S-rRNA | 16S-F | TAACCTGCCTCATAGAGT | 481 | [26] |
16S-R | TTTCACATCCCACTTAATC | |||
cpa | cpa-F | GCTAATGTTACTGCCGTTGA | 324 | [27] |
cpa-R | CCTCTGATACATCGTGTAAG | |||
cpb | cpb-F | GCGAATATGCTGAATCATCTA | 196 | |
cpb-R | GCAGGAACATTAGTATATCTTC | |||
cpb2 | cpb2-F | AGATTTTAAATATGATCCTAACC | 567 | |
cpb2-R | CAATACCCTTCACCAAATACTC | |||
cpe | cpe-F | GGAGATGGTTGGATATTAGG | 233 | |
cpe-R | GGACCAGCAGTTGTAGATA | |||
etx | etx-F | GCGGTGATATCCATCTATTC | 655 | |
etx-R | CCACTTACTTGTCCTACTAAC | |||
iap | iap-F | ACTACTCTCAGACAAGACAG | 446 | |
iap-R | CTTTCCTTCTATTACTATACG | |||
netB | NetB-F | GCTGGTGCTGGAATAAATGC | 384 | [28] |
NetB-R | TCGCCATTGAGTAGTTTCCC |
Antibiotic Class | Antibiotic Agent | No. C. perfringen Isolates (%) | |||
---|---|---|---|---|---|
Chicken Meat (n = 8) | Pork (n = 15) | Total (n = 23) | |||
Beta-lactams | Penicillins | ampicillin (AMP) | 3 (37.5) | 5 (33.33) | 8 (34.78) |
Cephalosporins | cefoxitin (FOX) | 0 (0) | 1 (6.67) | 1 (4.35) | |
cefotaxime (CTX) | 2 (25) | 3 (20) | 5 (21.74) | ||
Carbapenem | imipenem (IPM) | 0 (0) | 2 (13.33) | 2 (8.7) | |
Tetracyclines | tetracycline (TET) | 8 (100) | 13 (86.67) | 21 (91.3) | |
Phenicols | chloramphenicol (CHL) | 2 (25) | 5 (33.33) | 7 (30.43) | |
Lincosamides | clindamycin (CLI) | 4 (50) | 6 (40) | 10 (43.48) |
No. of Antibiotics | Resistance Pattern | No. C. perfringen Isolates (%) | ||
---|---|---|---|---|
Chicken Meat (n = 8) | Pork (n = 15) | Total (n = 23) | ||
1 | TET | 4 (50) | 6 (40) | 10 (43.48) |
CLI | 0 (0) | 1 (6.67) | 1 (4.35) | |
2 | TET-CLI | 1 (12.5) | 0 (0) | 1 (4.35) |
CHL-CLI | 0 (0) | 1 (6.67) | 1 (4.35) | |
TET-CHL | 0 (0) | 2 (13.33) | 2 (8.7) | |
3 | AMP-TET-CLI | 0 (0) | 1 (6.67) | 1 (4.35) |
4 | AMP-CTX-TET-CLI | 1 (12.5) | 1 (6.67) | 2 (8.7) |
AMP-TET-CHL-CLI | 1 (12.5) | 1 (6.67) | 2 (8.7) | |
5 | AMP-CTX-TET-CHL-CLI | 1 (12.5) | 0 (0) | 1 (4.35) |
AMP-FOX-CTX-IPM-TET | 0 (0) | 1 (6.67) | 1 (4.35) | |
6 | AMP-CTX-IPM-TET-CHL-CLI | 0 (0) | 1 (6.67) | 1 (4.35) |
No. Sample | Isolate ID | Isolate Source | Resistance Phenotype | Toxin Genes | Toxin Type |
---|---|---|---|---|---|
1 | CC1 | Chicken meat | AMP-CTX-TET-CLI | cpa | A |
2 | CC8 | Chicken meat | AMP-TET-CHL-CLI | cpa | A |
3 | CC17 | Chicken meat | TET | cpa | A |
4 | CC23 | Chicken meat | TET-CLI | cpa | A |
5 | CC39 | Chicken meat | TET | cpa | A |
6 | CC42 | Chicken meat | TET | cpa | A |
7 | CC46 | Chicken meat | AMP-CTX-TET-CHL-CLI | cpa | A |
8 | CC50 | Chicken meat | TET | cpa | A |
9 | CP2 | Pork | TET | cpa | A |
10 | CP5 | Pork | AMP-TET-CHL-CLI | cpa | A |
11 | CP8 | Pork | TET | cpa | A |
12 | CP11 | Pork | AMP-CTX-IPM-TET-CHL-CLI | cpa | A |
13 | CP14 | Pork | TET | cpa | A |
14 | CP19 | Pork | AMP-CTX-TET-CLI | cpa | A |
15 | CP24 | Pork | CHL-CLI | cpa | A |
16 | CP26 | Pork | TET | cpa | A |
17 | CP28 | Pork | TET | cpa | A |
18 | CP33 | Pork | TET | cpa | A |
19 | CP35 | Pork | AMP-FOX-CTX-IPM-TET | cpa | A |
20 | CP39 | Pork | AMP-TET-CLI | cpa | A |
21 | CP40 | Pork | TET-CHL | cpa | A |
22 | CP44 | Pork | CLI | cpa | A |
23 | CP47 | Pork | TET-CHL | cpa | A |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duc, H.M.; Hoa, T.T.K.; Ha, C.T.T.; Van Hung, L.; Van Thang, N.; Minh Son, H.; Flory, G.A. Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam. Pathogens 2024, 13, 400. https://doi.org/10.3390/pathogens13050400
Duc HM, Hoa TTK, Ha CTT, Van Hung L, Van Thang N, Minh Son H, Flory GA. Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam. Pathogens. 2024; 13(5):400. https://doi.org/10.3390/pathogens13050400
Chicago/Turabian StyleDuc, Hoang Minh, Tran Thi Khanh Hoa, Cam Thi Thu Ha, Le Van Hung, Nguyen Van Thang, Hoang Minh Son, and Gary A. Flory. 2024. "Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam" Pathogens 13, no. 5: 400. https://doi.org/10.3390/pathogens13050400
APA StyleDuc, H. M., Hoa, T. T. K., Ha, C. T. T., Van Hung, L., Van Thang, N., Minh Son, H., & Flory, G. A. (2024). Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam. Pathogens, 13(5), 400. https://doi.org/10.3390/pathogens13050400