Next Article in Journal
Neutrophils Expressing Programmed Death-Ligand 1 Play an Indispensable Role in Effective Bacterial Elimination and Resolving Inflammation in Methicillin-Resistant Staphylococcus aureus Infection
Previous Article in Journal
Comparative Minimum Inhibitory and Mutant Prevention Drug Concentrations for Pradofloxacin and Seven Other Antimicrobial Agents Tested against Bovine Isolates of Mannheimia haemolytica and Pasteurella multocida
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam

1
Department of Veterinary Public Health, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
2
Veterinary Hospital, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
3
Department of Anatomy and Histology, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
4
G.A. Flory Consulting, Mt. Crawford, VA 22841, USA
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(5), 400; https://doi.org/10.3390/pathogens13050400
Submission received: 27 April 2024 / Revised: 6 May 2024 / Accepted: 9 May 2024 / Published: 10 May 2024
(This article belongs to the Section Bacterial Pathogens)

Abstract

Clostridium perfringens is one of the most important zoonotic pathogens as it can cause food poisoning in humans and necrotic enteritis in both animals and humans. Meat, especially pork and chicken meat, is considered the main vehicle for the transmission of C. perfringens from animals to humans. The purpose of this study was to determine the prevalence, toxinotype, and antimicrobial resistance profile of C. perfringens isolated from pork and chicken meat sold in Vietnam. The isolation results showed that 15/50 (30%) of pork samples and 8/50 (16%) of chicken meat samples were contaminated with C. perfringens. The isolates exhibited their highest resistance rate to tetracycline (21/23; 91.30%) and clindamycin (10/23; 43.48%). On the contrary, their lowest resistance rates were observed in response to imipenem (2/23; 8.70%) and cefoxitin (1/23; 4.35%). In particular, 34.78% (8/23) of C. perfringens isolates were identified to be multidrug-resistant strains. The results of toxin genotyping indicated that all isolates were positive for the cpa gene and belonged to type A.

1. Introduction

Clostridium perfringens is a Gram-positive, anaerobic, non-motile, spore-forming pathogen commonly found in soil, sewage, food, and the gastrointestinal tract of warm-blooded animals, including humans [1,2,3]. This bacterium has been recognized as a public health concern as it can cause numerous diseases in humans and animals, including food poisoning [4,5,6]. In the United States, C. perfringens has been recognized as the second most common bacterial cause of foodborne infection, causing one million illnesses annually. From 1998 to 2010, 289 outbreaks of C. perfringens infections were confirmed, resulting in 15,208 illnesses, 83 hospitalizations, and 8 deaths [7]. In Europe, C. perfringens is the fourth most common bacterial cause of foodborne illness, infecting over 1500 people per year [3]. In Japan, C. perfrigens was responsible for about 20 to 40 outbreaks of food-borne diseases from 2000 to 2005 and approximately 4000 illness cases each year [8]. In other countries (Australia, England, and Wales), C. perfringens is also counted among the main causes of bacterial foodborne outbreaks [9,10]. Outbreaks of C. perfringens infections are often linked to the consumption of contaminated meat, particularly chicken meat [11].
C. perfringens is capable of producing 20 different toxins and extracellular enzymes [12]. Based on the production of six major toxins, Alpha (CPA), Beta (CPB), Epsilon (ETX), Iota (ETX), Enterotoxin (CPE), and necrotic enteritis-β-like toxin (NetB), this bacterium is categorized into seven toxinotypes (A to G) [2,13]. All seven toxigenic types of C. perfringens produce CPA. Type A produces only CPA, while type B produces two additional toxins, including CPB and ETX. Types C, D, E, F, and G have been found to produce another single toxin in addition to CPA, namely CPB, ETX, ITX, CPE, or NetB, respectively [2,14]. Each specific toxinotype is known to be associated with certain diseases. For example, C. perfringens type A is frequently responsible for clostridial myonecrosis or gas gangrene and food poisoning in humans, but it is also associated with enterocolitis in pigs and horses or necrotic enteritis in chickens [13,15]. Type B is involved in dysentery, enteritis, and enterotoxemia in animals. Type C is a causative agent of necrotic enteritis in humans and animals. Type D is linked to pulpy kidney disease in humans and type E is known to cause enteritis in animals [15]. Type F is responsible for food poisoning in humans [15]. Type G is considered the main cause of necrotic enteritis in poultry [16] Therefore, the toxin typing of isolated C. perfringens strains is necessary to determine the potential hazard of these isolates and to identify the source of contamination across different steps of food production.
Antibiotics are known to be the most effective means for treating bacterial infections; however, they are losing their efficacy due to the rise of antibiotic-resistant strains [17]. The overuse and misuse of antibiotics have been attributed to the development of antibiotic resistance [18,19]. In Vietnam, antibiotics have been used in livestock for various purposes such as disease prevention, treatment, and growth promotion [20,21]. As a result, Vietnam has been classified by the WHO as one of the countries with the highest level of antibiotic resistance [22]. However, studies on antibiotic resistance in Vietnam are limited and just focus only on a few pathogens such as Escherichia coli and Salmonella [23,24]. Reports on the antibiotic resistance profile of C. perfringens in Vietnam are scarce. The aim of this study is to (1) investigate the prevalence and toxigenic type of the C. perfringens isolated from pork and chicken meat sold in Hanoi, Vietnam, and (2) determine the antibiotic resistance profile of these C. perfringens isolates.

2. Materials and Methods

2.1. Sample Collection

A total of 100 raw meat samples (50 pork and 50 chicken meat; 100 grams/sample) were obtained from various retail stores in Gia Lam district, Hanoi city, Vietnam, from 2022 to 2023. All collected samples were stored in an ice box and brought back to the laboratory within 24 hours for the isolation of C. perfringens.

2.2. Isolation and Identification of C. perfringens from Pork and Chicken Meat

The isolation and identification of C. perfringens from pork and chicken meat samples were carried out according to the previously described method of the American Public Health Association (APHA) [25]. Briefly, a sample (25 g) was added to a bag (Seward Ltd, Worthing, UK) containing 225 mL of 0.1% Peptone Water (Oxoid Ltd, Hants, UK), homogenized by a Seward stomacher 400 circulator (Seward Ltd, Worthing, UK), and incubated for 24 h under anaerobic conditions at 37 °C. After incubation, the homogenate was serially diluted and 1 mL of an appropriate dilution was mixed with soft tryptose sulfite cycloserine agar (Oxoid Ltd, Hants, UK), supplemented with 5% egg yolk and perfringens selective supplement, and then poured on a Petri dish. After solidification, the plate was overlayed with a second TSC layer and incubated anaerobically for 24 h at 37 °C. Colonies with a black color and white halo were considered presumptive C. perfringens. Well-separated colonies were picked up for biochemical testing using an API 20A kit (Biome’rieux, Marcy I’ Etoile, France). For further confirmation, up to five single colonies per each plate were selected to detect the species-specific 16S-rRNA gene using the method previously described by Tonooka et al. (2005) [26]. All C. perfringens strains were stored at −86 ˚C for further experiments.

2.3. Detection of Toxin Genes of C. perfringens Isolated from Pork and Chicken Meat

The toxin genes (cpa, cpb, etx, iap, cpe) of isolated C. perfringens strains were detected by multiplex PCR following the previous method described by [27], while the netB gene was detected by a simple PCR assay [28]. For DNA extraction, C. perfringens isolates were grown in 5 mL of brain heart infusion (BHI, Oxoid, Hants, UK) and incubated under anaerobic conditions at 37 °C for 24 h. The bacterial culture was then used for DNA extraction using a GeneJet Genomic DNA purification kit (Thermoscientific, Vilnius, Lithuania) according to the instruction of the manufacturer. The extracted DNA was stored at −20 °C until used for PCR reactions. The primers used in this study for the detection of the toxin genes of C. perfringens isolates are shown in Table 1.
A multiplex PCR reaction was performed in a total reaction volume of 25 µL containing 2.5 μL of 10 × PCR Buffer, 10 µL of 1 mM dNTPs, 5 µL of 1U Taq polymerase, 0.25 µL of 25 μM of each primer, 2μL of DNA template, and 2.5 µL of deionized water. A thermal cycling machine (Biorad T100, BioRad Laboratories, Hercules, CA, USA) was used to carry out a PCR amplification program consisting of initial denaturation at 94 °C for 2 min, followed by 34 cycles at 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min, and a final elongation at 72 °C for 10 min. The amplified PCR product was separated by electrophoresis on a 2% agarose gel and visualized under ultraviolet light by a BioRad Molecular Imager® GelDocTM XR (BioRad Laboratories, Hercules, CA, USA).
The amplification of the netB gene was performed on a 25 µL reaction volume comprising 2.5 μL of 10 × PCR Buffer, 5 µL of 1 mM dNTPs, 5 µL of 1U Taq polymerase, 1 µL of 5 μM of each primer, 2μL of DNA template, and 8.5 µL of deionized water. The amplification program is composed of an initial denaturation at 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, followed by a final extension at 72 °C for 12 min. The PCR product was analyzed according to the method mentioned above.

2.4. Antimicrobial Susceptibility of C. perfringens Isolates

The antimicrobial susceptibility of isolated C. perfringens strains was tested using the agar dilution method, following the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [29]. The lowest concentration of an antimicrobial that inhibited the isolates’ growth visibly on Brucella agar supplemented with hemin (5 µg/mL), vitamin K1 (1 µg/mL), and laked sheep blood (5%, v/v), after 48 h of incubation at 37 °C, was defined as the minimum inhibitory concentration (MIC). A total of 7 antibiotics from 4 classes (Beta-lactams, Tetracyclines, Phenicols, and Lincosamides) were selected for this test, including ampicillin, cefoxitin, cefotaxime, imipenem, tetracycline, chloramphenicol, and clindamycin. The quality control strain used for the test was Clostridium difficile ATCC 700057 [29]. Isolates that showed a resistance to at least 1 antibiotic from 3 or more antibiotic classes were identified as multidrug-resistant strains.

3. Results

3.1. The Isolation and Identification of C. perfringens from Pork and Chicken Meat

A total of 23 (23%) C. perfringens strains were isolated from 50 pork and 50 chicken meat samples. The occurrence of C. perfringens in pork and chicken meat samples collected from traditional markets in Hanoi, Vietnam, were 15/50 (30%) and 8/50 (16%), respectively, indicating that the higher prevalence of C. perfringens in pork than chicken meat.

3.2. Detection of the Toxin Genes of C. perfringens Isolates

A multiplex PCR was used to classify the C. perfringens isolates into seven toxinotypes (A-G). The result revealed that all 23 isolated strains harbored only the cpa gene (Figure 1), indicating that they all belong to type A.

3.3. Antimicrobial Resistance Profile of C. perfringens Isolated from Pork and Chicken Meat

Seven antibiotics from four classes were used for the antibiotic resistance test of C. perfringens. The results in Table 2 showed that the highest antibiotic resistance rate of C. perfringens isolates was to tetracycline (21/23; 91.30%), followed by clindamycin (10/23; 43.48%), ampicillin (8/23; 34.78%), chloramphenicol (7/23; 30.43%), and cefotaxime (5/23; 21.74%). In contrast, the lowest antibiotic resistance rates were observed with imipenem (2/23; 8.70%) and cefoxitin (1/23; 4.35%).
The phenotypic antibiotic resistance of the isolated C. perfringens strains is shown in Table 3 and Table 4. All isolates were found to be resistant to at least one antibiotic class. A total of 11 antibiotic resistance patterns were detected. Among them, tetracycline resistance (TET) was the most common pattern, accounting for 43.48% (10/23) of strains, followed by TET-CHL, AMP-CTX-TET-CLI, and AMP-TET-CHL-CLI, with the same rate of 8.7% (2/23). The findings in Table 3 and Table 4 also showed that eight (34.78%) C. perfringens isolates were resistant to at least three antibiotic classes and identified as multidrug-resistant strains (MDR).

4. Discussion

C. perfringens has been recognized as one of the most important foodborne pathogens [30]. The bacterium can produce many dangerous toxins including enterotoxin, which can cause food poisoning [31,32,33]. In addition, C. perfringens is capable of forming spores that allow this pathogen to survive under stressful conditions, such as high temperatures and aerobic environments, and eventually grow to such an extent that it can cause food poisoning [34,35,36]. C. perfringens is also known as a causative of necrotic enteritis in poultry and pigs. In this case, the bacterium infects, colonizes, and damages the intestinal tract of animals. During slaughter, C. perfringens may escape from the intestinal tract and contaminate the meat. Therefore, meat, especially pork and chicken, is considered to be one of the main vehicles for the transmission of C. perfringens from chickens and pigs to humans [37,38,39,40,41].
To date, studies on the occurrence and antimicrobial resistance of C. perfrigens isolates have mainly focused on humans and food-producing animals [42,43,44,45]. There are only a few publications on C. perfringens of food origin [46,47]. To the best of our knowledge, this is the first report on the prevalence and antimicrobial resistance profile of C. perfringens isolated from pork and chicken meat in Vietnam. In our study, a total of 23 (23%) out of 100 meat samples were positive for C. perfringens. The prevalence of C. perfringens in meat found in the present study was relatively lower than in some previous studies. For example, a study conducted by Wen and McClane showed that the prevalence of C. perfringens in retail pork and chicken meat was 38% and 27%, respectively [11]. Another study found that the prevalence of C. perfringens in chicken meat was 31% [48]. Jang et al. reported that 33% of retail chicken meat in Korea was positive for C. perfringens [47]. The findings of this study also showed that the rate of C. perfringens contamination in pork samples (30%, 15/50) was higher than in chicken meat samples (16%, 8/50), suggesting that the consumption of pork may lead to a higher likelihood of C. perfringens infection that chicken meat. On the contrary, a study in Korea reported that the highest prevalence of C. perfringens was recorded in chicken meat (33%, 33/100), followed by beef (5%, 5/50), while all pork samples (50) were negative for C. perfringens. The occurrence of C. perfringens in pork has been previously reported in Korea (5.0%) [49] and India (5.8 %) [50]. The different disinfection conditions during the handling, processing, and distribution of meat may influence these differences in the prevalence of C. perfringens [51]. In addition, sample size, sample type, sampling season, isolation techniques, and location can also affect the prevalence of C. perfringens [52].
C. perfringens type A has been previously reported to be the most common toxigenic type of bacterium associated with food poisoning in the United States, Europe, and Japan [8,53]. The results of our study are in line with previous studies, showing that all C. perfringens strains were identified as type A. Similar results were obtained in a study conducted by Zhang et al. in China, according to which the majority of their 168 C. perfringens isolates belonged to type A [54]. In Turkey, type A was also the only toxinotype found in turkey meat samples [53]. In Belgium, 71 C. perfringens strains isolated from broiler caeca were all categorized as type A [55]. In addition, a study performed in Korea revealed that the C. perfringens strains recovered from chicken meat and beef were all type A [47]. The opposite results were observed in a study conducted in Iran, which reported that type C was the most common type of strain in broiler meat samples [56]. In this study, all C. perfringens isolates carried only the cpa gene. It has previously been suggested that this gene may be universal in C. perfringens isolates of a meat origin [2]. The reason for the high prevalence of the cpa gene could be that the gene is located on the chromosome of C. perfringens. In contrast, its other toxin genes, cpb, etx and itx, are in plasmids, while cpe encoded for enterotoxin can be detected on either the plasmids or the chromosome [13]. A plasmid containing toxin genes is a mobile element and can be lost. This could explain the absence of other toxin genes in the C. perfringens strains isolated in this study. In addition, previous studies have already shown that the cpe gene is rarely detected in type A and that only 1–5% of C. perfringens isolates carried the cpe gene [8,11,57]. Although only cpe-negative type A was detected, the meat contaminated with C. perfringens isolates in this study was still risky to consume, as a previous study recently reported that cpe-negative type A C. perfringens can cause septicemia with intravascular hemolysis, with a mortality rate of 80% [58].
In Vietnam, veterinarians and even farmers have been using antibiotics for decades to prevent and treat animal diseases [59]. In the chicken and swine industries, a large amount of antibiotics is used for prevention without specific diagnoses [60]. It was also reported that about 43.7% of commercial animal feed sold in Vietnam contained at least one antibiotic [61]. Necrotic enteritis (NE), caused by C. perfringens, is one of the most important diseases in the poultry and swine industries. The use of antibiotics at low concentrations for prophylactic prevention is considered the most effective measure to control NE [62]. However, this consequently led to the emergence of antibiotic-resistant C. perfringens clones [62]. The results of our study showed that the C. perfringens from meat were highly resistant to tetracycline (21/23; 91.30%) and clindamycin (10/23; 43.48%). These findings are not surprising as these antibiotics have been widely used in many countries, including Vietnam, for the prevention of NE and other diseases in chickens and pigs [20,62]. Our results are in agreement with previous studies showing a high resistance rate of C. perfringens to tetracycline and clindamycin. In a study conducted by Beres et al. in Romania, it was reported that the resistance rate of C. perfringens isolated from food-producing animals to tetracycline was 71.4% [63]. A study performed by Jang et al. in Korea found that 100% of C. perfringens isolated from meat were tetracycline-resistant strains [47]. A study in Belgium obtained similar results and reported that the resistance rate of C. perfringens from broilers to tetracycline was 66.6% [55]. Another study in China has shown that 61.1% and 72.2% of meat-derived C. perfringens isolates were resistant to tetracycline and clindamycin, respectively [54]. The lowest resistance rates to tetracycline and clindamycin were also observed in a study conducted in Canada. C. perfringes isolated from poultry in that study were 50% and 40% resistant to tetracycline and clindamycin, respectively [42]. Our study also revealed that the resistance rate of C. perfringens to cefoxitin (4.35%) and imipenem (8.7%) was still low. This could be due to the fact that these antibiotics have not been commonly used in livestock, especially to prevent and treat the diseases caused by C. perfringens. Similar results were also found in earlier studies [64,65].

5. Conclusions

The emergence of antimicrobial resistance in foodborne pathogens has become a global problem. Our study is the first report on the prevalence and antibiotic resistance profile of C. perfringens isolated from meat in Vietnam. The results showed that pork and chicken meat was contaminated with cpe-negative C. perfringens type A. The C. perfringens isolates in this study exhibited their highest resistance rate to tetracycline and clindamycin. A large proportion of C. perfringens isolates were identified as multidrug-resistant strains, indicating a potential risk to human health.

Author Contributions

Conceptualization, H.M.D.; methodology, H.M.D.; software, H.M.D.; validation, H.M.D. and H.M.S.; formal analysis, T.T.K.H. and H.M.D., investigation, H.M.D., H.M.S. and T.T.K.H.; resources, H.M.D.; data curation, H.M.S.; writing—original draft preparation, H.M.D.; writing—review and editing, G.A.F., N.V.T.; L.V.H., C.T.T.H. and H.M.S.; visualization, H.M.D.; supervision, H.M.D.; project administration, H.M.D. and H.M.S.; funding acquisition, H.M.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

The authors are grateful for the support of the Vietnam National University of Agriculture (VNUA).

Conflicts of Interest

Gary A. Flory is employed by G.A. Flory Consulting. All other authors declare no conflicts of interest.

References

  1. Hustá, M.; Ducatelle, R.; Haesebrouck, F.; Van Immerseel, F.; Goossens, E. A Comparative Study on the Use of Selective Media for the Enumeration of Clostridium perfringens in Poultry Faeces. Anaerobe 2020, 63, 102205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Petit, L.; Gibert, M.; Popoff, M.R. Clostridium perfringens: Toxinotype and Genotype. Trends Microbiol. 1999, 7, 104–110. [Google Scholar] [CrossRef] [Scilit]
  3. Abdelrahim, A.M.; Radomski, N.; Delannoy, S.; Djellal, S.; Le Négrate, M.; Hadjab, K.; Fach, P.; Hennekinne, J.A.; Mistou, M.Y.; Firmesse, O. Large-Scale Genomic Analyses and Toxinotyping of Clostridium Perfringens Implicated in Foodborne Outbreaks in France. Front. Microbiol. 2019, 10, 777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Tansuphasiri, U.; Matra, W.; Sangsuk, L. Antimicrobial Resistance among Clostridium perfringens Isolated from Various Sources in Thailand. Southeast. Asian J. Trop. Med. Public. Health 2005, 36, 954–961. [Google Scholar] [PubMed]
  5. Guran, H.S.; Oksuztepe, G. Detection and Typing of Clostridium perfringens from Retail Chicken Meat Parts. Lett. Appl. Microbiol. 2013, 57, 77–82. [Google Scholar] [CrossRef] [Scilit]
  6. Ghoneim, N.H.; Hamza, D.A. Epidemiological Studies on Clostridium perfringens Food Poisoning in Retail Foods. Sci. Tech. Rev. 2017, 36, 1025–1032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Grass, J.E.; Gould, L.H.; Mahon, B.E. Epidemiology of Foodborne Disease Outbreaks Caused by Clostridium perfringens, United States, 1998–2010. Foodborne Pathog. Dis. 2013, 10, 131–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Miki, Y.; Miyamoto, K.; Kaneko-Hirano, I.; Fujiuchi, K.; Akimoto, S. Prevalence and Characterization of Enterotoxin Gene-Carrying Clostridium perfringens Isolates from Retail Meat Products in Japan. Appl. Environ. Microbiol. 2008, 74, 5366–5372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Dalton, C.B.; Gregory, J.; Kirk, M.D.; Stafford, R.J.; Givney, R.; Kraa, E.; Gould, D. Foodborne Disease Outbreaks in Australia, 1995 to 2000. Commun. Dis. Intell. 2004, 28, 211–224. [Google Scholar]
  10. Gormley, F.J.; Little, C.L.; Rawal, N.; Gillespie, I.A.; Lebaigue, S.; Adak, G.K. A 17-Year Review of Foodborne Outbreaks: Describing the Continuing Decline in England and Wales (1992–2008). Epidemiol. Infect. 2011, 139, 688–699. [Google Scholar] [CrossRef] [Scilit]
  11. Wen, Q.; McClane, B.A. Detection of Enterotoxigenic Clostridium perfringens Type A Isolates in American Retail Foods. Appl. Environ. Microbiol. 2004, 70, 2685–2691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Revitt-Mills, S.A.; Rood, J.I.; Adams, V. Clostridium perfringens Extracellular Toxins and Enzymes: 20 and Counting. Microbiol. Aust. 2015, 36, 114. [Google Scholar] [CrossRef] [Scilit]
  13. Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens Toxin-Based Typing Scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef] [Scilit]
  14. Titball, R.W.; Naylor, C.E.; Basak, A.K. The Clostridium perfringens α-Toxin. Anaerobe 1999, 5, 51–64. [Google Scholar] [CrossRef] [Scilit]
  15. Bhunia, A.K. Foodborne Microbial Pathogens: Mechanisms and Pathogenesis; Springer: Berlin/Heidelberg, Germany, 2008; ISBN 9780387745367. [Google Scholar]
  16. Rood, J.I.; Keyburn, A.L.; Moore, R.J. NetB and Necrotic Enteritis: The Hole Movable Story. Avian Pathol. 2016, 45, 295–301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Terreni, M.; Taccani, M.; Pregnolato, M. New Antibiotics for Multidrug-Resistant Bacterial Strains: Latest Research Developments and Future Perspectives. Molecules 2021, 26, 2671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Laxminarayan, R.; Duse, A.; Wattal, C.; Zaidi, A.K.M.; Wertheim, H.F.L.; Sumpradit, N.; Vlieghe, E.; Hara, G.L.; Gould, I.M.; Goossens, H.; et al. Antibiotic Resistance-the Need for Global Solutions. Lancet Infect. Dis. 2013, 13, 1057–1098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Bengtsson, B.; Greko, C. Antibiotic Resistance-Consequences for Animal Health, Welfare, and Food Production. Ups. J. Med. Sci. 2014, 119, 96–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Di, K.N.; Pham, D.T.; Tee, T.S.; Binh, Q.A.; Nguyen, T.C. Antibiotic Usage and Resistance in Animal Production in Vietnam: A Review of Existing Literature. Trop. Anim. Health Prod. 2021, 53, 340. [Google Scholar] [CrossRef] [Scilit]
  21. Pham-Duc, P.; Cook, M.A.; Cong-Hong, H.; Nguyen-Thuy, H.; Padungtod, P.; Nguyen-Thi, H.; Dang-Xuan, S. Knowledge, Attitudes and Practices of Livestock and Aquaculture Producers Regarding Antimicrobial Use and Resistance in Vietnam. PLoS ONE 2019, 14, e0223115. [Google Scholar] [CrossRef] [Scilit]
  22. Antimicrobial Resistance: Global Report on Surveillance. Available online: https://apps.who.int/iris/handle/10665/112642 (accessed on 14 August 2023).
  23. Nhung, N.T.; Cuong, N.V.; Campbell, J.; Hoa, N.T.; Bryant, J.E.; Truc, V.N.T.; Kiet, B.T.; Jombart, T.; Trung, N.V.; Hien, V.B. High Levels of Antimicrobial Resistance among Escherichia coli Isolates from Livestock Farms and Synanthropic Rats and Shrews in the Mekong Delta of Vietnam. Appl. Env. Microbiol. 2015, 81, 812–820. [Google Scholar] [CrossRef] [Scilit]
  24. Trung, N.V.; Carrique-Mas, J.J.; Nghia, N.H.; Tu, L.T.P.; Mai, H.H.; Tuyen, H.T.; Campbell, J.; Nhung, N.T.; Nhung, H.N.; Minh, P.V.; et al. Non-Typhoidal Salmonella Colonization in Chickens and Humans in the Mekong Delta of Vietnam. Zoonoses Public. Health 2017, 64, 94–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. da Silva, N.; Taniwaki, M.H.; Junqueira, V.C.A.; Silveira, N.; Okazaki, M.M.; Romeiro Gomes, R.A. Microbiological Examination Methods of Food and Water: A Laboratory Manual; CRC Press: Boca Raton, FL, USA, 2012. [Google Scholar]
  26. Tonooka, T.; Sakata, S.; Kitahara, M.; Hanai, M.; Ishizeki, S.; Takada, M.; Sakamoto, M.; Benno, Y. Detection and Quantification of Four Species of the Genus Clostridium in Infant Feces. Microbiol. Immunol. 2005, 49, 987–992. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Meer, R.R.; Songer, J.G. Multiplex Polymerase Chain Reaction Assay for Genotyping Clostridium perfringens. Am. J. Vet. Res. 1997, 58, 702–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Keyburn, A.L.; Boyce, J.D.; Vaz, P.; Bannam, T.L.; Ford, M.E.; Parker, D.; Di Rubbo, A.; Rood, J.I.; Moore, R.J. NetB, a New Toxin That Is Associated with Avian Necrotic Enteritis Caused by Clostridium perfringens. PLoS Pathog. 2008, 4, e26. [Google Scholar] [CrossRef] [Scilit]
  29. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 29th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2019. [Google Scholar]
  30. Nagpal, R.; Ogata, K.; Tsuji, H.; Matsuda, K.; Takahashi, T.; Nomoto, K.; Suzuki, Y.; Kawashima, K.; Nagata, S.; Yamashiro, Y. Sensitive Quantification of Clostridium perfringens in Human Feces by Quantitative Real-Time PCR Targeting Alpha-Toxin and Enterotoxin Genes. BMC Microbiol. 2015, 15, 219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Labbe, R.; Juneja, V.K.; Blaschek, H.P. Clostridium: Clostridium Perfringens, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2014; Volume 1, ISBN 9780123847331. [Google Scholar]
  32. Miyamoto, K.; Nagahama, M. Clostridium: Food Poisoning by Clostridium Perfringens, 1st ed.; Elsevier Ltd.: Amsterdam, The Netherlands, 2015; ISBN 9780123849533. [Google Scholar]
  33. Popoff, M.R. Clostridium: Detection of Enterotoxin of Clostridium perfringens. In Encyclopedia of Food Microbiology, 2nd ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2014; pp. 474–480. ISBN 9780123847331. [Google Scholar]
  34. McClane, B.A.; Robertson, S.L.; Li, J. Clostridium perfringens. In Food Microbiology: Fundamentals and Frontiers; Wiley: Hoboken, NJ, USA, 2012; pp. 465–489. [Google Scholar] [CrossRef] [Scilit]
  35. Brynestad, S.; Granum, E. Clostridium perfringens and Foodborne Infections. Int. J. Food Microbiol. 2002, 74, 195–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Shrestha, A.; Uzal, F.A.; McClane, B.A. Enterotoxic Clostridia: Clostridium perfringens Enteric Diseases. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. McDevitt, R.M.; Brooker, J.D.; Acamovic, T.; Sparks, N.H.C. Necrotic Enteritis; a Continuing Challenge for the Poultry Industry. World’s Poult. Sci. J. 2006, 62, 221–247. [Google Scholar] [CrossRef] [Scilit]
  38. Wade, B.; Keyburn, A. The True Cost of Necrotic Enteritis. Poult. World 2015, 31, 16–17. [Google Scholar]
  39. Posthaus, H.; Kittl, S.; Tarek, B.; Bruggisser, J. Clostridium perfringens Type C Necrotic Enteritis in Pigs: Diagnosis, Pathogenesis, and Prevention. J. Vet. Diagn. Investig. 2020, 32, 203–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Hosny, R.A.; Gaber, A.F.; Sorour, H.K. Bacteriophage Mediated Control of Necrotic Enteritis Caused by C. perfringens in Broiler Chickens. Vet. Res. Commun. 2021, 45, 409–421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Caly, D.L.; D’Inca, R.; Auclair, E.; Drider, D. Alternatives to Antibiotics to Prevent Necrotic Enteritis in Broiler Chickens: A Microbiologist’s Perspective. Front. Microbiol. 2015, 6, 1336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. García-Vela, S.; Martínez-Sancho, A.; Ben Said, L.; Torres, C.; Fliss, I. Pathogenicity and Antibiotic Resistance Diversity in Clostridium perfringens Isolates from Poultry Affected by Necrotic Enteritis in Canada. Pathogens 2023, 12, 905. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Mohiuddin, M.; Iqbal, Z.; Siddique, A.; Liao, S.; Salamat, M.K.F.; Qi, N.; Din, A.M.; Sun, M. Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan. Toxins 2020, 12, 657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Nguyen, T.T.; Vu-Khac, H.; Nguyen, T.D. Isolation and Characterization of Clostridium perfringens Strains Isolated from Ostriches (Struthio camelus) in Vietnam. Vet. World 2020, 13, 1679–1684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Lee, K.E.; Lim, S.I.; Shin, S.H.; Kwon, Y.K.; Kim, H.Y.; Song, J.Y.; An, D.J. Distribution of Clostridium perfringens Isolates from Piglets in South Korea. J. Vet. Med. Sci. 2014, 76, 745–749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Hassani, S.; Pakbin, B.; Brück, W.M.; Mahmoudi, R.; Mousavi, S. Prevalence, Antibiotic Resistance, Toxin-Typing and Genotyping of Clostridium perfringens in Raw Beef Meats Obtained from Qazvin City, Iran. Antibiotics 2022, 11, 340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Jang, Y.S.; Kim, D.H.; Bae, D.; Kim, S.H.; Kim, H.; Moon, J.S.; Song, K.Y.; Chon, J.W.; Seo, K.H. Prevalence, Toxin-Typing, and Antimicrobial Susceptibility of Clostridium perfringens from Retail Meats in Seoul, Korea. Anaerobe 2020, 64, 102235. [Google Scholar] [CrossRef] [Scilit]
  48. Aras, Z.; Hadimli, H.H. Detection and Molecular Typing of Clostridium Perfringens Isolates from Beef, Chicken and Turkey Meats. Anaerobe 2015, 32, 15–17. [Google Scholar] [CrossRef] [Scilit]
  49. Hu, W.S.; Kim, H.; Koo, O.K. Molecular Genotyping, Biofilm Formation and Antibiotic Resistance of Enterotoxigenic Clostridium perfringens Isolated from Meat Supplied to School Cafeterias in South Korea. Anaerobe 2018, 52, 115–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Yadav, J.P.; Das, S.C.; Dhaka, P.; Vijay, D.; Kumar, M.; Mukhopadhyay, A.K.; Chowdhury, G.; Chauhan, P.; Singh, R.; Dhama, K.; et al. Molecular Characterization and Antimicrobial Resistance Profile of Clostridium perfringens Type A Isolates from Humans, Animals, Fish and Their Environment. Anaerobe 2017, 47, 120–124. [Google Scholar] [CrossRef] [Scilit]
  51. Ramírez, Á.; de la Morena, A.; Sánchez, N.; Peñuela, L.; Sánchez-Carretero, A.; Muñoz, M.; Llanos, J. Formation of Disinfection By-Products within the Drinking Water Production System and Distribution Network of a Real Case Study. Appl. Water Sci. 2023, 13, 186. [Google Scholar] [CrossRef] [Scilit]
  52. Khan, M.; Nazir, J.; Anjum, A.A.; Ahmad, M.-U.; Nawaz, M.; Shabbir, M.Z. Toxinotyping and Antimicrobial Susceptibility of Enterotoxigenic Clostridium perfringens Isolates from Mutton, Beef and Chicken Meat. J. Food Sci. Technol. 2015, 52, 5323–5328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Erol, I.; Goncuoglu, M.; Ayaz, N.D.; Bilir Ormanci, F.S.; Hildebrandt, G. Molecular Typing of Clostridium perfringens Isolated from Turkey Meat by Multiplex PCR. Lett. Appl. Microbiol. 2008, 47, 31–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Zhang, T.; Zhang, W.; Ai, D.; Zhang, R.; Lu, Q.; Luo, Q.; Shao, H. Prevalence and Characterization of Clostridium perfringens in Broiler Chickens and Retail Chicken Meat in Central China. Anaerobe 2018, 54, 100–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Gholamiandehkordi, A.; Eeckhaut, V.; Lanckriet, A.; Timbermont, L.; Bjerrum, L.; Ducatelle, R.; Haesebrouck, F.; Van Immerseel, F. Antimicrobial Resistance in Clostridium perfringens Isolates from Broilers in Belgium. Vet. Res. Commun. 2009, 33, 1031–1037. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Afshari, A.; Jamshidi, A.; Razmyar, J.; Rad, M. Genotyping of Clostridium perfringens Isolated from Broiler Meat in Northeastern of Iran. Vet. Res. Forum 2015, 6, 279. [Google Scholar] [PubMed]
  57. Freedman, J.C.; Shrestha, A.; McClane, B.A. Clostridium perfringens Enterotoxin: Action, Genetics, and Translational Applications. Toxins 2016, 8, 73. [Google Scholar] [CrossRef] [Scilit]
  58. Woittiez, N.J.C.; van Prehn, J.; van Immerseel, F.; Goossens, E.; Bauer, M.P.; Ramspek, C.L.; Slangen, R.M.E.; Purmer, I.M.; Ludikhuize, J. Toxinotype A Clostridium perfringens Causing Septicaemia with Intravascular Haemolysis: Two Cases and Review of the Literature. Int. J. Infect. Dis. 2022, 115, 224–228. [Google Scholar] [CrossRef] [Scilit]
  59. Pham Kim, D.; Saegerman, C.; Douny, C.; Vu Dinh, T.; Ha Xuan, B.; Dang Vu, B.; Pham Hong, N.; Scippo, M.-L. First Survey on the Use of Antibiotics in Pig and Poultry Production in the Red River Delta Region of Vietnam. Food Public Health 2013, 3, 247–256. [Google Scholar]
  60. Nhung, N.T.; Cuong, N.V.; Thwaites, G.; Carrique-Mas, J. Antimicrobial Usage and Antimicrobial Resistance in Animal Production in Southeast Asia: A Review. Antibiotics 2016, 5, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Carrique-Mas, J.J.; Trung, N.V.; Hoa, N.T.; Mai, H.H.; Thanh, T.H.; Campbell, J.I.; Wagenaar, J.A.; Hardon, A.; Hieu, T.Q.; Schultsz, C. Antimicrobial Usage in Chicken Production in the Mekong Delta of Vietnam. Zoonoses Public Health 2015, 62, 70–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Fathima, S.; Al Hakeem, W.G.; Shanmugasundaram, R.; Selvaraj, R.K. Necrotic Enteritis in Broiler Chickens: A Review on the Pathogen, Pathogenesis, and Prevention. Microorganisms 2022, 10, 1958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Beres, C.; Colobatiu, L.; Tabaran, A.; Mihaiu, R.; Mihaiu, M. Prevalence and Characterisation of Clostridium Perfringens Isolates in Food-Producing Animals in Romania. Microorganisms 2023, 11, 1373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Xiu, L.; Liu, Y.; Wu, W.; Chen, S.; Zhong, Z.; Wang, H. Prevalence and Multilocus Sequence Typing of Clostridium Perfringens Isolated from 4 Duck Farms in Shandong Province, China. Poult. Sci. 2020, 99, 5105–5117. [Google Scholar] [CrossRef] [Scilit]
  65. Zhong, J.; Zheng, H.; Wang, Y.; Bai, L.; Du, X.; Wu, Y.; Lu, J. Molecular Characteristics and Phylogenetic Analysis of Clostridium perfringens from Different Regions in China, from 2013 to 2021. Front Microbiol 2023, 14, 1195083. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Multiplex PCR detecting toxin genes of C. perfringens. M: marker; Lane 1: negative control; Lane 2–24: isolated C. perfringens strains.
Figure 1. Multiplex PCR detecting toxin genes of C. perfringens. M: marker; Lane 1: negative control; Lane 2–24: isolated C. perfringens strains.
Pathogens 13 00400 g001
Table 1. Primers for the detection of the 16S-rRNA gene and toxin genes of C. perfringens isolated from pork and chicken meat.
Table 1. Primers for the detection of the 16S-rRNA gene and toxin genes of C. perfringens isolated from pork and chicken meat.
Target GenePrimer NamePrimer Sequence (5′–3′)Amplicon Size (bp)Reference
16S-rRNA16S-FTAACCTGCCTCATAGAGT481[26]
16S-RTTTCACATCCCACTTAATC
cpacpa-FGCTAATGTTACTGCCGTTGA324[27]
cpa-RCCTCTGATACATCGTGTAAG
cpbcpb-FGCGAATATGCTGAATCATCTA196
cpb-RGCAGGAACATTAGTATATCTTC
cpb2cpb2-F AGATTTTAAATATGATCCTAACC567
cpb2-RCAATACCCTTCACCAAATACTC
cpecpe-FGGAGATGGTTGGATATTAGG233
cpe-RGGACCAGCAGTTGTAGATA
etxetx-FGCGGTGATATCCATCTATTC655
etx-RCCACTTACTTGTCCTACTAAC
iapiap-F ACTACTCTCAGACAAGACAG446
iap-RCTTTCCTTCTATTACTATACG
netBNetB-FGCTGGTGCTGGAATAAATGC384[28]
NetB-RTCGCCATTGAGTAGTTTCCC
Table 2. Antimicrobial resistance profile of C. perfringens isolated from pork and chicken meat.
Table 2. Antimicrobial resistance profile of C. perfringens isolated from pork and chicken meat.
Antibiotic ClassAntibiotic AgentNo. C. perfringen Isolates (%)
Chicken Meat
(n = 8)
Pork
(n = 15)
Total
(n = 23)
Beta-lactamsPenicillinsampicillin (AMP)3 (37.5)5 (33.33)8 (34.78)
Cephalosporinscefoxitin (FOX)0 (0)1 (6.67)1 (4.35)
cefotaxime (CTX)2 (25)3 (20)5 (21.74)
Carbapenemimipenem (IPM)0 (0)2 (13.33)2 (8.7)
Tetracyclines tetracycline (TET)8 (100)13 (86.67)21 (91.3)
Phenicols chloramphenicol (CHL)2 (25)5 (33.33)7 (30.43)
Lincosamides clindamycin (CLI)4 (50)6 (40)10 (43.48)
Table 3. Antibiotic resistance patterns of C. perfringens isolated from pork and chicken meat.
Table 3. Antibiotic resistance patterns of C. perfringens isolated from pork and chicken meat.
No. of AntibioticsResistance PatternNo. C. perfringen Isolates (%)
Chicken Meat (n = 8)Pork (n = 15)Total (n = 23)
1TET4 (50)6 (40)10 (43.48)
CLI0 (0)1 (6.67)1 (4.35)
2TET-CLI1 (12.5)0 (0)1 (4.35)
CHL-CLI0 (0)1 (6.67)1 (4.35)
TET-CHL0 (0)2 (13.33)2 (8.7)
3AMP-TET-CLI0 (0)1 (6.67)1 (4.35)
4AMP-CTX-TET-CLI1 (12.5)1 (6.67)2 (8.7)
AMP-TET-CHL-CLI1 (12.5)1 (6.67)2 (8.7)
5AMP-CTX-TET-CHL-CLI1 (12.5)0 (0)1 (4.35)
AMP-FOX-CTX-IPM-TET0 (0)1 (6.67)1 (4.35)
6AMP-CTX-IPM-TET-CHL-CLI0 (0)1 (6.67)1 (4.35)
AMP, ampicillin; FOX, cefoxitin; CTX, cefotaxime; IMP, imipenem; TET, tetracycline; CHL, chloramphenicol; CLI, clindamycin.
Table 4. Antibiotic resistance phenotype, toxin genes, and toxinotype of C. perfringens isolated from pork and chicken meat.
Table 4. Antibiotic resistance phenotype, toxin genes, and toxinotype of C. perfringens isolated from pork and chicken meat.
No. SampleIsolate IDIsolate SourceResistance PhenotypeToxin GenesToxin Type
1CC1Chicken meatAMP-CTX-TET-CLIcpaA
2CC8Chicken meatAMP-TET-CHL-CLIcpaA
3CC17Chicken meatTETcpaA
4CC23Chicken meatTET-CLIcpaA
5CC39Chicken meatTETcpaA
6CC42Chicken meatTETcpaA
7CC46Chicken meatAMP-CTX-TET-CHL-CLIcpaA
8CC50Chicken meatTETcpaA
9CP2PorkTETcpaA
10CP5PorkAMP-TET-CHL-CLIcpaA
11CP8PorkTETcpaA
12CP11PorkAMP-CTX-IPM-TET-CHL-CLIcpaA
13CP14PorkTETcpaA
14CP19PorkAMP-CTX-TET-CLIcpaA
15CP24PorkCHL-CLIcpaA
16CP26PorkTETcpaA
17CP28PorkTETcpaA
18CP33PorkTETcpaA
19CP35PorkAMP-FOX-CTX-IPM-TETcpaA
20CP39PorkAMP-TET-CLIcpaA
21CP40PorkTET-CHLcpaA
22CP44PorkCLIcpaA
23CP47PorkTET-CHLcpaA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Duc, H.M.; Hoa, T.T.K.; Ha, C.T.T.; Van Hung, L.; Van Thang, N.; Minh Son, H.; Flory, G.A. Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam. Pathogens 2024, 13, 400. https://doi.org/10.3390/pathogens13050400

AMA Style

Duc HM, Hoa TTK, Ha CTT, Van Hung L, Van Thang N, Minh Son H, Flory GA. Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam. Pathogens. 2024; 13(5):400. https://doi.org/10.3390/pathogens13050400

Chicago/Turabian Style

Duc, Hoang Minh, Tran Thi Khanh Hoa, Cam Thi Thu Ha, Le Van Hung, Nguyen Van Thang, Hoang Minh Son, and Gary A. Flory. 2024. "Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam" Pathogens 13, no. 5: 400. https://doi.org/10.3390/pathogens13050400

APA Style

Duc, H. M., Hoa, T. T. K., Ha, C. T. T., Van Hung, L., Van Thang, N., Minh Son, H., & Flory, G. A. (2024). Prevalence and Antibiotic Resistance Profile of Clostridium perfringens Isolated from Pork and Chicken Meat in Vietnam. Pathogens, 13(5), 400. https://doi.org/10.3390/pathogens13050400

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop