Generation of Stable Cell Lines Expressing Akabane Virus N Protein and Insight into Its Function in Viral Replication
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines, Cell Culture and Viruses
2.2. Antibodies and Plasmids
2.3. Generation of the Recombinant Plasmid and the Recombinant Lentiviruses
2.4. Transduction and Puromycin Selection of BHK-21 Cells
2.5. Western Blot
2.6. Immunofluorescence Assay (IFA)
2.7. RT-PCR Assays
2.8. qRT-PCR Assays
2.9. Growth Kinetics of AKAV in Different Cell Lines
2.10. The Sensitivity of Sera Detection with Purified AKAV N Protein
2.11. Statistical Analysis
3. Results
3.1. Establishment of Stable BHK-21 Cell Lines for Constitutively Expressing the AKAV N Protein
3.2. Characterization of the Established Cell Lines
3.3. The Replication Efficiency of AKAV Was Temporarily Inhibited in the Established Cell Lines
3.4. AKAV mRNAs Expression Is Reduced in the Established Cell Lines
3.5. The Sensitivity of Sera Detection with Purified AKAV N Protein
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Charles, J.A. Akabane virus. Vet. Clin. N. Am. Food Anim. Pract. 1994, 10, 525–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cybinski, D.H.; St, G.T.; Paull, N.I. Antibodies to Akabane virus in Australia. Aust. Vet. J. 1978, 54, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, W.P.; Mellor, P.S. The distribution of Akabane virus in the Middle East. Epidemiol. Infect. 1994, 113, 175–185. [Google Scholar] [CrossRef] [Scilit]
- Kurogi, H.; Inaba, Y.; Goto, Y.; Miura, Y.; Takahashi, H. Serologic evidence for etiologic role of Akabane virus in epizootic abortion-arthrogryposis-hydranencephaly in cattle in Japan, 1972–1974. Arch. Virol. 1975, 47, 71–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurogi, H.; Inaba, Y.; Takahashi, E.; Sato, K.; Satoda, K. Congenital abnormalities in newborn calves after inoculation of pregnant cows with Akabane virus. Infect. Immun. 1977, 17, 338–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oya, A.; Okuno, T.; Ogata, T.; Kobayashii, I.; Matsuyama, T. Akabane, a new arbor virus isolated in Japan. Jpn. J. Med. Sci. Biol. 1961, 14, 101–108. [Google Scholar] [CrossRef] [Scilit]
- Kinney, R.M.; Calisher, C.H. Antigenic relationships among Simbu serogroup (Bunyaviridae) viruses. Am. J. Trop. Med. Hyg. 1981, 30, 1307–1318. [Google Scholar] [CrossRef] [Scilit]
- Kirkland, P.D. Akabane virus infection. Rev. Sci. Tech. 2015, 34, 403–410. [Google Scholar] [CrossRef] [Scilit]
- Walter, C.T.; Barr, J.N. Recent advances in the molecular and cellular biology of bunyaviruses. J. Gen. Virol. 2011, 92, 2467–2484. [Google Scholar] [CrossRef] [Scilit]
- Elliott, R.M. Orthobunyaviruses: Recent genetic and structural insights. Nat. Rev. Microbiol. 2014, 12, 673–685. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Scarano, F.; Shope, R.E.; Calisher, C.E.; Nathanson, N. Characterization of monoclonal antibodies against the G1 and N proteins of LaCrosse and Tahyna, two California serogroup bunyaviruses. Virology 1982, 120, 42–53. [Google Scholar] [CrossRef] [Scilit]
- Wernike, K.; Nikolin, V.M.; Hechinger, S.; Hoffmann, B.; Beer, M. Inactivated Schmallenberg virus prototype vaccines. Vaccine 2013, 31, 3558–3563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wernike, K.; Aebischer, A.; Roman-Sosa, G.; Beer, M. The N-terminal domain of Schmallenberg virus envelope protein Gc is highly immunogenic and can provide protection from infection. Sci. Rep. 2017, 7, 42500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saeed, M.F.; Li, L.; Wang, H.; Weaver, S.C.; Barrett, A. Phylogeny of the Simbu serogroup of the genus Bunyavirus. J. Gen. Virol. 2001, 82, 2173–2181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yanase, T.; Kato, T.; Aizawa, M.; Shuto, Y.; Shirafuji, H.; Yamakawa, M.; Tsuda, T. Genetic reassortment between Sathuperi and Shamonda viruses of the genus Orthobunyavirus in nature: Implications for their genetic relationship to Schmallenberg virus. Arch. Virol. 2012, 157, 1611–1616. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Wu, S.; Wang, J.; Wernike, K.; Lv, J.; Feng, C.; Zhang, J.; Wang, C.; Deng, J.; Yuan, X.; et al. Expression and purification of the nucleocapsid protein of Schmallenberg virus, and preparation and characterization of a monoclonal antibody against this protein. Protein Expr. Purif. 2013, 92, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Briese, T.; Calisher, C.H.; Higgs, S. Viruses of the family Bunyaviridae: Are all available isolates reassortants? Virology 2013, 446, 207–216. [Google Scholar] [CrossRef] [Scilit]
- Bilk, S.; Schulze, C.; Fischer, M.; Beer, M.; Hlinak, A.; Hoffmann, B. Organ distribution of Schmallenberg virus RNA in malformed newborns. Vet. Microbiol. 2012, 159, 236–238. [Google Scholar] [CrossRef] [Scilit]
- Breard, E.; Lara, E.; Comtet, L.; Viarouge, C.; Doceul, V.; Desprat, A.; Vitour, D.; Pozzi, N.; Cay, A.B.; De Regge, N.; et al. Validation of a commercially available indirect ELISA using a nucleocapside recombinant protein for detection of Schmallenberg virus antibodies. PLoS ONE 2013, 8, e53446. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Li, P.; Elliott, R.M.; Dong, C. Structure of Schmallenberg orthobunyavirus nucleoprotein suggests a novel mechanism of genome encapsidation. J. Virol. 2013, 87, 5593–5601. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Wang, D.; Wei, F.; Kong, Y.; Deng, J.; Lin, X.; Wu, S. Characterization and reverse genetic establishment of cattle derived Akabane virus in China. BMC Vet. Res. 2021, 17, 349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; Wang, J.; Wei, F.; Jing, H.; Wang, D.; Zhang, Z.; Lin, X.; Wu, S. Characterization and double antibody sandwich ELISA application of a monoclonal antibody against Akabane virus nucleocapsid protein. J. Aoac. Int. 2023, 106, 931–938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Wu, S.; Song, S.; Lv, J.; Feng, C.; Lin, X. Preparation and characterization of a stable BHK-21 cell line constitutively expressing the Schmallenberg virus nucleocapsid protein. Mol. Cell Probes. 2015, 29, 244–253. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Blasdell, K.R.; Yin, H.; Walker, P.J. A large-scale serological survey of Akabane virus infection in cattle, yak, sheep and goats in China. Vet. Microbiol. 2017, 207, 7–12. [Google Scholar] [CrossRef] [Scilit]
- Akashi, H.; Onuma, S.; Nagano, H.; Ohta, M.; Fukutomi, T. Detection and differentiation of Aino and Akabane Simbu serogroup bunyaviruses by nested polymerase chain reaction. Arch. Virol. 1999, 144, 2101–2109. [Google Scholar] [CrossRef] [Scilit]
- Cardoso, B.F.; Serra, O.P.; Heinen, L.B.; Zuchi, N.; Souza, V.C.; Naveca, F.G.; Santos, M.A.; Slhessarenko, R.D. Detection of Oropouche virus segment S in patients and inCulex quinquefasciatus in the state of Mato Grosso, Brazil. Mem. Inst. Oswaldo. Cruz. 2015, 110, 745–754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.H.; Seo, H.J.; Park, J.Y.; Kim, S.H.; Cho, Y.S.; Kim, Y.J.; Cho, I.S.; Jeoung, H.Y. Detection and differentiation of Schmallenberg, Akabane and Aino viruses by one-step multiplex reverse-transcriptase quantitative PCR assay. BMC Vet. Res. 2015, 11, 270. [Google Scholar] [CrossRef] [Scilit]
- Ter Horst, S.; Conceicao-Neto, N.; Neyts, J.; Rocha-Pereira, J. Structural and functional similarities in bunyaviruses: Perspectives for pan-bunya antivirals. Rev. Med. Virol. 2019, 29, e2039. [Google Scholar] [CrossRef] [Scilit]
- Overby, A.K.; Pettersson, R.F.; Neve, E.P. The glycoprotein cytoplasmic tail of Uukuniemi virus (Bunyaviridae) interacts with ribonucleoproteins and is critical for genome packaging. J. Virol. 2007, 81, 3198–3205. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.; Kohl, A.; Li, P.; Elliott, R.M. Role of the cytoplasmic tail domains of Bunyamwera orthobunyavirus glycoproteins Gn and Gc in virus assembly and morphogenesis. J. Virol. 2007, 81, 10151–10160. [Google Scholar] [CrossRef] [Scilit]
- Snippe, M.; Willem, B.J.; Goldbach, R.; Kormelink, R. Tomato spotted wilt virus Gc and N proteins interact in vivo. Virology 2007, 357, 115–123. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, D.; Borst, J.W.; Goldbach, R.; Kormelink, R. Tomato spotted wilt virus nucleocapsid protein interacts with both viral glycoproteins Gn and Gc in planta. Virology 2009, 383, 121–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hepojoki, J.; Strandin, T.; Wang, H.; Vapalahti, O.; Vaheri, A.; Lankinen, H. Cytoplasmic tails of hantavirus glycoproteins interact with the nucleocapsid protein. J. Gen. Virol. 2010, 91, 2341–2350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmaljohn, C.S.; Nichol, S.T. Bunyaviridae, 5th ed.; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2006; Volume 2, pp. 1741–1789. [Google Scholar]
- Billecocq, A.; Vazeille-Falcoz, M.; Rodhain, F.; Bouloy, M. Pathogen-specific resistance to Rift Valley fever virus infection is induced in mosquito cells by expression of the recombinant nucleoprotein but not NSs non-structural protein sequences. J. Gen. Virol. 2000, 81, 2161–2166. [Google Scholar] [CrossRef] [Scilit]
- Geib, T.; Sauder, C.; Venturelli, S.; Hassler, C.; Staeheli, P.; Schwemmle, M. Selective virus resistance conferred by expression of Borna disease virus nucleocapsid components. J. Virol. 2003, 77, 4283–4290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lemm, J.A.; Rice, C.M. Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcription. J. Virol. 1993, 67, 1916–1926. [Google Scholar] [CrossRef] [Scilit]
- Lemm, J.A.; Rumenapf, T.; Strauss, E.G.; Strauss, J.H.; Rice, C.M. Polypeptide requirements for assembly of functional Sindbis virus replication complexes: A model for the temporal regulation of minus- and plus-strand RNA synthesis. EMBO J. 1994, 13, 2925–2934. [Google Scholar] [CrossRef] [Scilit]
- Shirako, Y.; Strauss, J.H. Regulation of Sindbis virus RNA replication: Uncleaved P123 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from P123 are required for efficient plus-strand RNA synthesis. J. Virol. 1994, 68, 1874–1885. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Hong, H.; Yue, J.; Wu, Y.; Li, X.; Jiang, L.; Li, L.; Li, Q.; Gao, G.; Yang, X. Inhibitory effect of small interfering RNA on dengue virus replication in mosquito cells. Virol. J. 2010, 7, 270. [Google Scholar] [CrossRef] [Scilit]
- Pijlman, G.P. Flavivirus RNAi suppression: Decoding non-coding RNA. Curr. Opin. Virol. 2014, 7, 55–60. [Google Scholar] [CrossRef] [Scilit]
- Nunes, F.M.; Aleixo, A.C.; Barchuk, A.R.; Bomtorin, A.D.; Grozinger, C.M.; Simoes, Z.L. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays. Insects 2013, 4, 90–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flenniken, M.L.; Andino, R. Non-specific dsRNA-mediated antiviral response in the honey bee. PLoS ONE 2013, 8, e77263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, G.N.; Kang, C.Y. Utilization of homotypic and heterotypic proteins of vesicular stomatitis virus by defective interfering particle genomes for RNA replication and virion assembly: Implications for the mechanism of homologous viral interference. J. Virol. 2005, 79, 9588–9596. [Google Scholar] [CrossRef] [Scilit]
- Patterson, E.I.; Kautz, T.F.; Contreras-Gutierrez, M.A.; Guzman, H.; Tesh, R.B.; Hughes, G.L.; Forrester, N.L. Negeviruses Reduce Replication of Alphaviruses during Coinfection. J. Virol. 2021, 95, e43321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marcus, P.I.; Carver, D.H. Intrinsic interference: A new type of viral interference. J. Virol. 1967, 1, 334–343. [Google Scholar] [CrossRef] [Scilit]
- Zebovitz, E.; Brown, A. Interference among group A arboviruses. J. Virol. 1968, 2, 1283–1289. [Google Scholar] [CrossRef] [Scilit]
- Kenney, J.L.; Solberg, O.D.; Langevin, S.A.; Brault, A.C. Characterization of a novel insect-specific flavivirus from Brazil: Potential for inhibition of infection of arthropod cells with medically important flaviviruses. J. Gen. Virol. 2014, 95, 2796–2808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanthong, N.; Khemnu, N.; Sriurairatana, S.; Pattanakitsakul, S.N.; Malasit, P.; Flegel, T.W. Mosquito cells accommodate balanced, persistent co-infections with a densovirus and Dengue virus. Dev. Comp. Immunol. 2008, 32, 1063–1075. [Google Scholar] [CrossRef] [Scilit]









| Primers | Sequences(5′-3′) | Functions |
|---|---|---|
| N-F1 | GGTTCTAGAATGGCAAATCAATTCATTTTCAACGATGTTCCACAACGGAATGC | Fragment clone |
| N-R1 | TAACCCGGGTTAGATCTGGATACCAAATTGAGCCA | |
| N-F2 | CGATGTTCCACAACGGAATG | N detection (PCR) |
| N-R2 | AAGCTCTAGCTGCAGGTGAG | |
| Gc-qF | CAGCATAATGAGCAATGCACGG | Gc detection (qRT-PCR) |
| Gc-qR | CCGTACCTATCGCTAAGCAACC | |
| RdRp-qF | AGTAGCCTGTGCCAACAAC | RdRp detection(qRT-PCR) |
| RdRp-qR | GGTACAGATCACGCTGCAT | |
| GAPDH-qF | CCTTCCGTGTCCCTACTGCCAAC | GADPH detection(qRT-PCR) |
| GAPDH-qR | GACGCCTGCTTCACCACCTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Chen, D.; Wei, F.; Deng, J.; Su, J.; Lin, X.; Wu, S. Generation of Stable Cell Lines Expressing Akabane Virus N Protein and Insight into Its Function in Viral Replication. Pathogens 2023, 12, 1058. https://doi.org/10.3390/pathogens12081058
Wang J, Chen D, Wei F, Deng J, Su J, Lin X, Wu S. Generation of Stable Cell Lines Expressing Akabane Virus N Protein and Insight into Its Function in Viral Replication. Pathogens. 2023; 12(8):1058. https://doi.org/10.3390/pathogens12081058
Chicago/Turabian StyleWang, Jingjing, Dongjie Chen, Fang Wei, Junhua Deng, Jia Su, Xiangmei Lin, and Shaoqiang Wu. 2023. "Generation of Stable Cell Lines Expressing Akabane Virus N Protein and Insight into Its Function in Viral Replication" Pathogens 12, no. 8: 1058. https://doi.org/10.3390/pathogens12081058
APA StyleWang, J., Chen, D., Wei, F., Deng, J., Su, J., Lin, X., & Wu, S. (2023). Generation of Stable Cell Lines Expressing Akabane Virus N Protein and Insight into Its Function in Viral Replication. Pathogens, 12(8), 1058. https://doi.org/10.3390/pathogens12081058
