Viability and Desiccation Resistance of Bartonella henselae in Biological and Non-Biological Fluids: Evidence for Pathogen Environmental Stability
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Type and Source of Fluid Matrices
2.3. Pre-Inoculation Evaluation of Fluid Matrices for Bartonella Species DNA and Bacterial Growth
2.4. Preparation of Bacterial Stock for Inoculation of Fluid Matrices
- BsppITS325s: 5′CCTCAGATGATGATCCCAAGCCTTCTGGCG 3′ and
- BsppITS543as: 5′AATTGGTGGGCCTGGGAGGACTTG 3′.
2.5. Culture, DNA Extraction, and qPCR Evaluation of the Inoculated Fluid Matrices
2.6. Desiccation of the Inoculated and Un-Inoculated Fluid Matrices
2.7. Statistical Analysis
3. Results
3.1. Pre-Inoculation Evaluation of the Fluid Matrices for Bh SA2 DNA and Bacterial Growth
3.2. Bartonella Henselae SA2 Viability and Stability in Six Fluid Matrices
3.3. Bartonella henselae SA2 Viability and Stability in Fluid Matrices after Culture Enrichment with Brugge Media
3.4. Bh SA2 Viability and Stability after Desiccation of Inoculated Fluid Matrices and Reconstitution with Brugge Growth Medium
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Bouhsira, E.; Franc, M.; Boulouis, H.J.; Jacquiet, P.; Raymond-Letron, I.; Liénard, E. Assessment of persistence of Bartonella henselae in Ctenocephalides felis. Appl. Environ. Microbiol. 2013, 79, 7439–7444. [Google Scholar] [CrossRef]
- Mazurek, Ł.; Winiarczyk, S.; Skrzypczak, M.; Adaszek, L. Cats as a reservoir of Bartonella henselae for dogs. Ann. Agric. Environ. Med. 2019, 26, 669–671. [Google Scholar] [CrossRef]
- Álvarez-Fernández, A.; Breitschwerdt, E.B.; Solano-Gallego, L. Bartonella infections in cats and dogs including zoonotic aspects. Parasit. Vectors 2018, 11, 624. [Google Scholar] [CrossRef]
- Osikowicz, L.M.; Horiuchi, K.; Goodrich, I.; Breitschwerdt, E.B.; Chomel, B.; Biggerstaff, B.J.; Kosoy, M. Exposure of Domestic Cats to Three Zoonotic Bartonella Species in the United States. Pathogens 2021, 10, 354. [Google Scholar] [CrossRef]
- Saba, N.; Balwan, W.K. Potential threat of emerging and re-emerging zoonotic disease. Ann. Rom. Soc. Cell. Biol. 2021, 25, 29–36. [Google Scholar]
- Okaro, U.; Addisu, A.; Casanas, B.; Anderson, B. Bartonella species, an emerging cause of blood-culture-negative endocarditis. CMR 2017, 30, 709–746. [Google Scholar] [CrossRef]
- Cheslock, M.A.; Embers, M.E. Human Bartonellosis: An underappreciated public health problem? Trop. Med. Infect. Dis. 2019, 4, 69. [Google Scholar] [CrossRef]
- Scutera, S.; Mitola, S.; Sparti, R.; Salvi, V.; Grillo, E.; Piersigilli, G.; Bugatti, M.; Alotto, D.; Schioppa, T.; Sozzani, S.; et al. Bartonella henselae Persistence within Mesenchymal Stromal Cells Enhances Endothelial Cell Activation and Infectibility That Amplifies the Angiogenic Process. Infect. Immun. 2021, 89, e00141-21. [Google Scholar] [CrossRef]
- Berrich, M.; Kieda, C.; Grillon, C.; Monteil, M.; Lamerant, N.; Gavard, J.; Boulouis, H.J.; Haddad, N. Differential effects of Bartonella henselae on human and feline macro- and micro-vascular endothelial cells. PLoS ONE 2011, 6, e20204. [Google Scholar] [CrossRef]
- Vieira-Damiani, G.; Ericson, M.E.; da Silva, M.N.; Gupta, K.; Soares, T.B.; de Almeida, A.R.; Pelegati, V.B.; Baratti, M.O.; Cesar, C.L.; Cintra, M.L.; et al. Bartonella henselae initial infection of mature human erythrocytes observed in real time using bacterial endogenous fluorescence. J. Trop. Dis. Public Health 2016, 4, 207. [Google Scholar] [CrossRef]
- Vayssier-Taussat, M.; Le Rhun, D.; Deng, H.K.; Biville, F.; Cescau, S.; Danchin, A.; Marignac, G.; Lenaour, E.; Boulouis, H.J.; Mavris, M.; et al. The Trw type IV secretion system of Bartonella mediates host-specific adhesion to erythrocytes. PLoS Pathog. 2010, 6, e1000946. [Google Scholar] [CrossRef]
- McCormick, D.W.; Rowan, S.E.; Pappert, R.; Yockey, B.; Dietrich, E.A.; Petersen, J.M.; Hinckley, A.F.; Marx, G.E. Bartonella Seroreactivity among Persons Experiencing Homelessness During an Outbreak of Bartonella quintana in Denver, Colorado, 2020. Open Forum Infect. Dis. 2021, 8, ofab230. [Google Scholar] [CrossRef]
- Koehler, J.E.; Sanchez, M.A.; Garrido, C.S.; Whitfeld, M.J.; Chen, F.M.; Berger, T.G.; Rodriguez-Barradas, M.C.; LeBoit, P.E.; Tappero, J.W. Molecular epidemiology of Bartonella infections in patients with bacillary angiomatosis-peliosis. N. Engl. J. Med. 1997, 337, 1876–1883. [Google Scholar] [CrossRef]
- Mitchell, B.M.; Font, R.L. Molecular detection of Bartonella henselae for the diagnosis of cat scratch disease and bacillary angiomatosis of the conjunctiva. Cornea 2011, 30, 807–814. [Google Scholar] [CrossRef]
- Breitschwerdt, E.B. Bartonellosis, One Health and all creatures great and small. Vet. Dermatol. 2017, 28, 96-e21. [Google Scholar] [CrossRef]
- Mändle, T.; Einsele, H.; Schaller, M.; Neumann, D.; Vogel, W.; Autenrieth, I.B.; Kempf, V.A. Infection of human CD34+ progenitor cells with Bartonella henselae results in intraerythrocytic presence of B. henselae. Blood 2005, 106, 1215–1222. [Google Scholar] [CrossRef][Green Version]
- Musso, T.; Badolato, R.; Ravarino, D.; Stornello, S.; Panzanelli, P.; Merlino, C.; Savoia, D.; Cavallo, R.; Ponzi, A.N.; Zucca, M. Interaction of Bartonella henselae with the murine macrophage cell line J774: Infection and proinflammatory response. Infect. Immun. 2001, 69, 5974–5980. [Google Scholar] [CrossRef]
- Lins, K.A.; Drummond, M.R.; Velho, P.E.N.F. Cutaneous manifestations of bartonellosis. An. Bras. Dermatol. 2019, 94, 594–602. [Google Scholar] [CrossRef]
- Hicks, L.D.; Minnick, M.F. Human vascular endothelial cells express epithelial growth factor in response to infection by Bartonella bacilliformis. PLoS Negl. Trop. Dis. 2020, 14, e0008236. [Google Scholar] [CrossRef]
- Arvand, M.; Ignatius, R.; Regnath, T.; Hahn, H.; Mielke, M.E.A. Bartonella henselae-specific cell-mediated immune responses display a predominantly Th1 phenotype in experimentally infected C57BL/6 mice. Infect. Immun. 2001, 69, 6427–6433. [Google Scholar] [CrossRef]
- Harms, A.; Dehio, C. Intruders below the Radar: Molecular pathogenesis of Bartonella spp. Clin. Micro Rev. 2012, 25, 42–78. [Google Scholar] [CrossRef]
- Drummond, M.R.; de Almeida, A.R.; Valandro, L.; Pavan, M.H.P.; Stucchi, R.S.B.; Aoki, F.H.; Velho, P.E.N.F. Bartonella henselae endocarditis in an elderly patient. PLoS Negl. Trop. Dis. 2020, 14, e0008376. [Google Scholar] [CrossRef]
- Ghidoni, J.J. Role of Bartonella henselae endocarditis in the nucleation of aortic valvular calcification. Ann. Thorac. Surg. 2004, 77, 704–706. [Google Scholar] [CrossRef]
- Dai, Y.N.; Ren, Z.Z.; Song, W.Y.; Huang, H.J.; Yang, D.H.; Wang, M.S.; Huang, Y.C.; Chen, M.J.; Zhang, J.J.; Tong, Y.X.; et al. Peliosis hepatis: 2 case reports of a rare liver disorder and its differential diagnosis. Medicine 2017, 96, e6471. [Google Scholar] [CrossRef]
- Mathews, D.M.; Vance, K.M.; McMahon, P.M.; Boston, C.; Bolton, M.T. An Atypical Case of Bartonella henselae Osteomyelitis and Hepatic Disease. Case Rep. Pediatr. 2018, 2018, 2750275. [Google Scholar] [CrossRef]
- Puri, K.; Kreppel, A.J.; Schlaudecker, E.P. Bartonella Osteomyelitis of the Acetabulum: Case Report and Review of the Literature. Vector Borne Zoonotic Dis. 2015, 15, 463–467. [Google Scholar] [CrossRef]
- Wu, A.M.; Zhao, P.Y.; Wubben, T.J.; Hyde, R.A.; Paulus, Y.M.; Johnson, M.W. Serology negative Bartonella neuroretinitis in an immunocompromised patient. Retin. Cases Brief Rep. 2022, 16, 36–39. [Google Scholar] [CrossRef]
- Grando, D.; Sullivan, L.J.; Flexman, J.P.; Watson, M.W.; Andrew, J.H. Bartonella henselae associated with Parinaud’s oculoglandular syndrome. Clin. Infect. Dis. 1999, 28, 1156–1158. [Google Scholar] [CrossRef]
- Menezes, A.S.; Ribeiro, D.; Lima, A.F. Cat-scratch Disease with Parinaud’s Oculoglandular Syndrome. Turk. Arch. Otorhinolaryngol. 2020, 58, 48–51. [Google Scholar] [CrossRef]
- Samarkos, M.; Antoniadou, V.; Vaiopoulos, A.G.; Psichogiou, M. Encephalopathy in an adult with cat-scratch disease. BMJ Case Rep. 2018, 2018, bcr2017223647. [Google Scholar] [CrossRef]
- Fan, J.; Ali, H. Cat scratch disease causing encephalitis. Proc. Bayl. Univ. Med. Cent. 2020, 33, 440–441. [Google Scholar] [CrossRef]
- Rosas, L.; Rao, K.; McGough, C.; Becker, A. A Rare Case of Bartonella Encephalitis with Hemiplegia. Child Neurol. Open 2019, 6. [Google Scholar] [CrossRef]
- James, L.; Keshwani, N.; Haffner, D.; Zahlanie, Y.; Golla, S.; Agharokh, L. Scratching Past Lymphadenopathy: A Case of Bartonella henselae Encephalitis. Pediatr. Ann. 2020, 49, e359–e362. [Google Scholar] [CrossRef]
- Sendi, P.; Hirzel, C.; Bloch, A.; Fischer, U.; Jeannet, N.; Berlinger, L.; Krestel, H. Bartonella-Associated Transverse Myelitis. Emerg. Infect. Dis. 2017, 23, 712–713. [Google Scholar] [CrossRef]
- Rissardo, J.P.; Caprara, A.L.F. Transverse Myelitis and Guillain-Barré Syndrome Overlap Secondary to Bartonella henselae: Case Report. Prague Med. Rep. 2019, 120, 131–137. [Google Scholar] [CrossRef]
- Breitschwerdt, E.B.; Maggi, R.G.; Nicholson, W.L.; Cherry, N.A.; Woods, C.W. Bartonella sp. bacteremia in patients with neurological and neurocognitive dysfunction. J. Clin. Microbiol. 2008, 46, 2856–2861. [Google Scholar] [CrossRef]
- Rising, T.; Fulton, N.; Vasavada, P. Splenorenal Manifestations of Bartonella henselae Infection in a Pediatric Patient. Case Rep. Radiol. 2016, 2016, 7803832. [Google Scholar] [CrossRef]
- Eremeeva, M.E.; Gerns, H.L.; Lydy, S.L.; Goo, J.S.; Ryan, E.T.; Mathew, S.S.; Ferraro, M.J.; Holden, J.M.; Nicholson, W.L.; Dasch, G.A.; et al. Bacteremia, fever, and splenomegaly caused by a newly recognized Bartonella species. N. Engl. J. Med. 2007, 356, 2381–2387. [Google Scholar] [CrossRef]
- Bookman, I.; Scholey, J.W.; Jassal, S.V.; Lajoie, G.; Herzenberg, A.M. Necrotizing glomerulonephritis caused by Bartonella henselae endocarditis. Am. J. Kidney Dis. 2004, 43, e25–e30. [Google Scholar] [CrossRef]
- Guo, S.; Pottanat, N.D.; Herrmann, J.L.; Schamberger, M.S. Bartonella endocarditis and diffuse crescentic proliferative glomerulonephritis with a full-house pattern of immune complex deposition. BMC Nephrol. 2022, 23, 181. [Google Scholar] [CrossRef]
- Breitschwerdt, E.B.; Greenberg, R.; Maggi, R.G.; Mozayeni, B.R.; Lewis, A.; Bradley, J.M. Bartonella henselae Bloodstream Infection in a Boy with Pediatric Acute-Onset Neuropsychiatric Syndrome. J. Cent. Nerv. Syst. Dis. 2019, 11. [Google Scholar] [CrossRef]
- Lashnits, E.; Maggi, R.; Jarskog, F.; Bradley, J.; Breitschwerdt, E.; Frohlich, F. Schizophrenia and Bartonella spp. Infection: A Pilot Case-Control Study. Vector Borne Zoonotic Dis. 2021, 21, 413–421. [Google Scholar] [CrossRef]
- Ericson, M.E.; Breitschwerdt, E.B.; Reicherter, P.; Maxwell, C.; Maggi, R.G.; Melvin, R.G.; Maluki, A.H.; Bradley, J.M.; Miller, J.C.; Simmons, G.E., Jr.; et al. Bartonella henselae Detected in Malignant Melanoma, a Preliminary Study. Pathogens 2021, 10, 326. [Google Scholar] [CrossRef]
- Banerjee, S.; Tian, T.; Wei, Z.; Shih, N.; Feldman, M.D.; Peck, K.N.; DeMichele, A.M.; Alwine, J.C.; Robertson, E.S. Distinct Microbial Signatures Associated with Different Breast Cancer Types. Front. Microbiol. 2018, 9, 951. [Google Scholar] [CrossRef]
- Breitschwerdt, E.B.; Kordick, D.L. Bartonella infection in animals: Carriership, reservoir potential, pathogenicity, and zoonotic potential for human infection. Clin. Microbiol. Rev. 2000, 13, 428–438. [Google Scholar] [CrossRef]
- Chomel, B.B.; Kasten, R.W.; Henn, J.B.; Molia, S. Bartonella infection in domestic cats and wild felids. Ann. N. Y. Acad. Sci. 2006, 1078, 410–415. [Google Scholar] [CrossRef]
- Bevins, S.N.; Carver, S.; Boydston, E.E.; Lyren, L.M.; Alldredge, M.; Logan, K.A.; Riley, S.P.; Fisher, R.N.; Vickers, T.W.; Boyce, W.; et al. Three pathogens in sympatric populations of pumas, bobcats, and domestic cats: Implications for infectious disease transmission. PLoS ONE 2012, 7, e31403. [Google Scholar] [CrossRef]
- Hwang, J.; Gottdenker, N.L. Bartonella species in raccoons and feral cats, Georgia, USA. Emerg. Infect. Dis. 2013, 19, 1167–1168. [Google Scholar] [CrossRef]
- Lashnits, E.; Neupane, P.; Maggi, R.G.; Linder, K.E.; Bradley, J.M.; Balakrishnan, N.; Southern, B.L.; McKeon, G.P.; Chandrashekar, R.; Breitschwerdt, E.B. Detection of Bartonella spp. in dogs after infection with Rickettsia rickettsii. J. Vet. Intern. Med. 2020, 34, 145–159. [Google Scholar] [CrossRef]
- Cherry, N.A.; Jones, S.L.; Maggi, R.G.; Davis, J.L.; Breitschwerdt, E.B. Bartonella spp. infection in healthy and sick horses and foals from the southeastern United States. J. Vet. Intern. Med. 2012, 26, 1408–1412. [Google Scholar] [CrossRef]
- Gutiérrez, R.; Cohen, L.; Morick, D.; Mumcuoglu, K.Y.; Harrus, S.; Gottlieb, Y. Identification of different Bartonella species in the cattle tail louse (Haematopinus quadripertusus) and in cattle blood. Appl. Environ. Microbiol. 2014, 80, 5477–5483. [Google Scholar] [CrossRef]
- Cherry, N.A.; Maggi, R.G.; Cannedy, A.L.; Breitschwerdt, E.B. PCR detection of Bartonella bovis and Bartonella henselae in the blood of beef cattle. Vet. Microbiol. 2009, 1354, 308–312. [Google Scholar] [CrossRef]
- Beard, A.W.; Maggi, R.G.; Kennedy-Stoskopf, S.; Cherry, N.A.; Sandfoss, M.R.; DePerno, C.S.; Breitschwerdt, E.B. Bartonella spp. in feral pigs, southeastern United States. Emerg. Infect. Dis. 2011, 17, 893–895. [Google Scholar] [CrossRef]
- Eskow, E.; Rao, R.-V.S.; Mordechai, E. Concurrent Infection of the Central Nervous System by Borrelia burgdorferi and Bartonella henselae Evidence for a Novel Tick-borne Disease Complex. Arch. Neurol. 2001, 58, 1357–1363. [Google Scholar] [CrossRef]
- Sacristán, C.; das Neves, C.G.; Suhel, F.; Sacristán, I.; Tengs, T.; Hamnes, I.S.; Madslien, K. Bartonella spp. detection in ticks, Culicoides biting midges and wild cervids from Norway. Transbound. Emerg. Dis. 2021, 68, 941–951. [Google Scholar] [CrossRef]
- Maggi, R.G.; Ericson, M.; Mascarelli, P.E.; Bradley, J.M.; Breitschwerdt, E.B. Bartonella henselae bacteremia in a mother and son potentially associated with tick exposure. Parasit. Vectors 2013, 6, 101. [Google Scholar] [CrossRef]
- Wechtaisong, W.; Bonnet, S.I.; Lien, Y.Y.; Chuang, S.t.; Tsai, Y.L. Transmission of Bartonella henselae within rhipicephalus sanguineus: Data on the potential vector role of the tick. PLoS Negl. Trop. Dis. 2020, 14, e0008664. [Google Scholar] [CrossRef]
- Guru, P.K.; Agarwal, A.; Fritz, A. A miraculous recovery: Bartonella henselae infection following a red ant bite. BMJ Case Rep. 2018, 2018, bcr2017222326. [Google Scholar] [CrossRef]
- Mascarelli, P.E.; Maggi, R.G.; Hopkins, S.; Mozayeni, B.R.; Trull, C.L.; Bradley, J.M.; Hegarty, B.C.; Breitschwerdt, E.B. Bartonella henselae infection in a family experiencing neurological and neurocognitive abnormalities after woodlouse hunter spider bites. Parasit. Vectors 2013, 6, 98. [Google Scholar] [CrossRef]
- Regier, Y.; Órourke, F.; Kempf, V.A. Bartonella spp.—A chance to establish One Health concepts in veterinary and human medicine. Parasit. Vectors 2016, 9, 261. [Google Scholar] [CrossRef]
- Oliveira, A.M.; Maggi, R.G.; Woods, C.W.; Breitschwerdt, E.B. Suspected needle stick transmission of Bartonella vinsonii subspecies berkhoffii to a veterinarian. J. Vet. Intern. Med. 2010, 24, 1229–1232. [Google Scholar] [CrossRef]
- Vieira-Damiani, G.; Diniz, P.P.; Pitassi, L.H.; Sowy, S.; Scorpio, D.G.; Lania, B.G.; Drummond, M.R.; Soares, T.C.; Barjas-Castro Mde, L.; Breitschwerdt, E.B.; et al. Bartonella clarridgeiae bacteremia detected in an asymptomatic blood donor. J. Clin. Microbiol. 2015, 53, 352–356. [Google Scholar] [CrossRef]
- Magalhães, R.F.; Pitassi, L.H.; Salvadego, M.; de Moraes, A.M.; Barjas-Castro, M.L.; Velho, P.E. Bartonella henselae survives after the storage period of red blood cell units: Is it transmissible by transfusion? Transfus. Med. 2008, 18, 287–291. [Google Scholar] [CrossRef]
- Oskouizadeh, K.; Zahraei-Salehi, T.; Aledavood, S. Detection of Bartonella henselae in domestic cats’ saliva. Iran. J. Microbiol. 2010, 2, 80–84. [Google Scholar]
- Duncan, A.W.; Maggi, R.G.; Breitschwerdt, E.B. Bartonella DNA in dog saliva. Emerg. Infect. Dis. 2007, 13, 1948–1950. [Google Scholar] [CrossRef]
- Harms, C.A.; Maggi, R.G.; Breitschwerdt, E.B.; Clemons-Chevis, C.L.; Solangi, M.; Rotstein, D.S.; Fair, P.A.; Hansen, L.J.; Hohn, A.A.; Lovewell, G.N.; et al. Bartonella species detection in captive, stranded and free-ranging cetaceans. Vet. Res. 2008, 39, 59. [Google Scholar] [CrossRef]
- Maggi, R.G.; Raverty, S.A.; Lester, S.J.; Huff, D.G.; Haulena, M.; Ford, S.L.; Nielsen, O.; Robinson, J.H.; Breitschwerdt, E.B. Bartonella henselae in captive and hunter-harvested beluga (Delphinapterus leucas). J. Wildl. Dis. 2008, 44, 871–877. [Google Scholar] [CrossRef]
- Carrasco, S.E.; Chomel, B.B.; Gill, V.A.; Kasten, R.W.; Maggi, R.G.; Breitschwerdt, E.B.; Byrne, B.A.; Burek-Huntington, K.A.; Miller, M.A.; Goldstein, T.; et al. Novel Bartonella infection in northern and southern sea otters (Enhydra lutris kenyoni and Enhydra lutris nereis). Vet. Microbiol. 2014, 170, 325–334. [Google Scholar] [CrossRef]
- Morick, D.; Osinga, N.; Gruys, E.; Harrus, S. Identification of a Bartonella species in the harbor seal (Phoca vitulina) and in seal lice (Echinophtirius horridus). Vector Borne Zoonotic Dis. 2009, 9, 751–753. [Google Scholar] [CrossRef]
- Maggi, R.G.; Harms, C.A.; Hohn, A.A.; Pabst, D.A.; McLellan, W.A.; Walton, W.J.; Rotstein, D.S.; Breitschwerdt, E.B. Bartonella henselae in porpoise blood. Emerg. Infect. Dis. 2005, 11, 1894–1898. [Google Scholar] [CrossRef]
- Shapiro, K.; VanWormer, E.; Packham, A.; Dodd, E.; Conrad, P.A.; Miller, M. Type X strains of Toxoplasma gondii are virulent for southern sea otters (Enhydra lutris nereis) and present in felids from nearby watersheds. Proc. Biol. Sci. 2019, 286, 20191334. [Google Scholar] [CrossRef]
- O’Byrne, A.M.; Lambourn, D.M.; Rejmanek, D.; Haman, K.; O’Byrne, M.; VanWormer, E.; Shapiro, K. Sarcocystis neurona Transmission from Opossums to Marine Mammals in the Pacific Northwest. Ecohealth 2021, 18, 84–94. [Google Scholar] [CrossRef]
- Burgess, T.L.; Tinker, M.T.; Miller, M.A.; Smith, W.A.; Bodkin, J.L.; Murray, M.J.; Nichol, L.M.; Saarinen, J.A.; Larson, S.; Tomoleoni, J.A.; et al. Spatial epidemiological patterns suggest mechanisms of land-sea transmission for Sarcocystis neurona in a coastal marine mammal. Sci. Rep. 2020, 10, 3683. [Google Scholar] [CrossRef]
- Buhnerkempe, M.G.; Prager, K.C.; Strelioff, C.C.; Greig, D.J.; Laake, J.L.; Melin, S.R.; DeLong, R.L.; Gulland, F.M.; Lloyd-Smith, J.O. Detecting signals of chronic shedding to explain pathogen persistence: Leptospira interrogans in California sea lions. J. Anim. Ecol. 2017, 86, 460–472. [Google Scholar] [CrossRef]
- Cilia, G.; Bertelloni, F.; Albini, S.; Fratini, F. Insight into the Epidemiology of Leptospirosis: A Review of Leptospira Isolations from ‘Unconventional’ Hosts. Animals 2021, 11, 191. [Google Scholar] [CrossRef]
- Cameron, C.E.; Zuerner, R.L.; Raverty, S.; Colegrove, K.M.; Norman, S.A.; Lambourn, D.M.; Jeffries, S.J.; Gulland, F.M. Detection of pathogenic Leptospira bacteria in pinniped populations via PCR and identification of a source of transmission for zoonotic leptospirosis in the marine environment. J. Clin. Microbiol. 2008, 46, 1728–1733. [Google Scholar] [CrossRef]
- Piredda, I.; Palmas, B.; Noworol, M.; Tola, S.; Longheu, C.; Bertasio, C.; Scaltriti, E.; Denurra, D.; Cherchi, M.; Picardeau, M.; et al. Isolation of Leptospira interrogans from a Bottlenose Dolphin (Tursiops truncatus) in the Mediterranean Sea. J. Wildl. Dis. 2020, 56, 727–729. [Google Scholar] [CrossRef]
- Kordick, D.L.; Wilson, K.H.; Sexton, D.J.; Hadfield, T.L.; Berkhoff, H.A.; Breitschwerdt, E.B. Prolonged Bartonella bacteremia in cats associated with cat-scratch disease patients. J. Clin. Microbiol. 1995, 33, 3245–3251. [Google Scholar] [CrossRef]
- Liedig, C.; Neupane, P.; Lashnits, E.; Breitschwerdt, E.B.; Maggi, R.G. Blood supplementation enhances Bartonella henselae growth and molecular detection of bacterial DNA in liquid culture. Microbiol. Spectr. 2023, 11, e0512622. [Google Scholar] [CrossRef]
- Byam, M.W.; Carroll, C.J.; Churchill, L.J.; Dimond, C.L.; Lloyd, L.L.; Sorapure, C.V.; Wilson, L.R. Trench fever—A Louse-Borne disease. Trans. R. Soc. Trop. Med. Hyg. 1918, 11, 237–284. [Google Scholar] [CrossRef]
- Maggi, R.G.; Mascarelli, P.E.; Pultorak, E.L.; Hegarty, B.C.; Bradley, J.M.; Mozayeni, B.R.; Breitschwerdt, E.B. Bartonella spp. bacteremia in high-risk immunocompetent patients. Diagn. Microbiol. Infect. Dis. 2011, 71, 430–437. [Google Scholar] [CrossRef]
- Leibovitz, K.; Pearce, L.; Brewer, M.; Lappin, M.R. Bartonella species antibodies and DNA in cerebral spinal fluid of cats with central nervous system disease. J. Feline Med. Surg. 2008, 10, 332–337. [Google Scholar] [CrossRef]
- Kassab, I.; Isada, C.; Azar, M.M.; Sarsam, N.; Jiang, M.; Camelo-Piragua, S.; Kaul, D.; Malinis, M. Into the unknown: Diagnosing mysterious brain lesions. Transpl. Infect. Dis. 2022, 24, e13829. [Google Scholar] [CrossRef]
- Duncan, A.W.; Marr, H.S.; Birkenheuer, A.J.; Maggi, R.G.; Williams, L.E.; Correa, M.T.; Breitschwerdt, E.B. Bartonella DNA in the blood and lymph nodes of Golden Retrievers with lymphoma and in healthy controls. J. Vet. Intern. Med. 2008, 22, 89–95. [Google Scholar] [CrossRef]
- Lappin, M.R.; Kordick, D.L.; Breitschwerdt, E.B. Bartonella spp antibodies and DNA in aqueous humour of cats. J. Feline Med. Surg. 2000, 2, 61–68. [Google Scholar] [CrossRef]
- Lacout, A.; Mas, M.; Pajaud, J.; Perronne, V.; Lequette, Y.; Franck, M.; Perronne, C. Real time micro-organisms PCR in 104 patients with polymorphic signs and symptoms that may be related to a tick bite. Eur. J. Microbiol. Immunol. 2021, 11, 62–75. [Google Scholar] [CrossRef]
- Namekata, D.Y.; Kasten, R.W.; Boman, D.A.; Straub, M.H.; Siperstein-Cook, L.; Couvelaire, K.; Chomel, B.B. Oral shedding of Bartonella in cats: Correlation with bacteremia and seropositivity. Vet. Microbiol. 2010, 146, 371–375. [Google Scholar] [CrossRef]
- Boyce, S.; Peña, J.R.; Davis, D.A. An ulcerated nodule associated with lymphadenopathy. Arch. Dermatol. 1999, 135, 985–988. [Google Scholar] [CrossRef]
- Orellana-Rios, J.; Verdaguer-Diaz, J.I.; Opazo, G.; Leong, B.C.S.; Zett, C.; Smith, R.T.; Freund, K.B. Not cat-scratch disease: Bartonella henselae neuroretinitis associated with non-feline pet mammals. IDCases 2020, 22, e00978. [Google Scholar] [CrossRef]
- Garland, H.; Stoll, S.; Patel, S.; Mogal, R. A case of Bartonellosis presenting as a puzzling multisystem disorder complicated by nosocomial COVID-19 infection. BMJ Case Rep. 2021, 14, e244002. [Google Scholar] [CrossRef]
- Spinella, A.; Lumetti, F.; Sandri, G.; Cestelli, V.; Mascia, M.T. Beyond cat scratch disease: A case report of Bartonella infection mimicking vasculitic disorder. Case Rep. Infect. Dis. 2012, 2012, 354625. [Google Scholar] [CrossRef]
- Lantos, P.M.; Maggi, R.G.; Ferguson, B.; Varkey, J.; Park, L.P.; Breitschwerdt, E.B.; Woods, C.W. Detection of Bartonella species in the blood of veterinarians and veterinary technicians: A newly recognized occupational hazard? Vector Borne Zoonotic Dis. 2014, 14, 563–570. [Google Scholar] [CrossRef]
- Kim, J.Y.; Yi, M.H.; Lee, S.; Lee, I.Y.; Yong, D.; Yoon, S.S.; Yong, T.S. Microbiome and mycobiome interaction in house dust mites and impact on airway cells. Clin. Exp. Allergy 2021, 51, 1592–1602. [Google Scholar] [CrossRef]
- Saha, G.K. House dust mite allergy—An environmental enigma. In Dust Allergy: Cause & Concern; Springer: Singapore, 2016. [Google Scholar]
- Avidor, B.; Graidy, M.; Efrat, G.; Leibowitz, C.; Shapira, G.; Schattner, A.; Zimhony, O.; Giladi, M. Bartonella koehlerae, a new cat-associated agent of culture-negative human endocarditis. J. Clin. Microbiol. 2004, 42, 3462–3468. [Google Scholar] [CrossRef]
- Breitschwerdt, E.B.; Maggi, R.G.; Robert Mozayeni, B.; Hegarty, B.C.; Bradley, J.M.; Mascarelli, P.E. PCR amplification of Bartonella koehlerae from human blood and enrichment blood cultures. Parasit. Vectors 2010, 3, 76. [Google Scholar] [CrossRef]
- Dubey, J.P.; Bhatia, C.R.; Lappin, M.R.; Ferreira, L.R.; Thorn, A.; Kwok, O.C. Seroprevalence of Toxoplasma gondii and Bartonella spp. antibodies in cats from Pennsylvania. J. Parasitol. 2009, 95, 578–580. [Google Scholar] [CrossRef]
- Bennett, A.D.; Gunn-Moore, D.A.; Brewer, M.; Lappin, M.R. Prevalence of Bartonella species, haemoplasmas and Toxoplasma gondii in cats in Scotland. J. Feline Med. Surg. 2011, 13, 553–557. [Google Scholar] [CrossRef]
- Nutter, F.B.; Dubey, J.P.; Levine, J.F.; Breitschwerdt, E.B.; Ford, R.B.; Stoskopf, M.K. Seroprevalences of antibodies against Bartonella henselae and Toxoplasma gondii and fecal shedding of Cryptosporidium spp., Giardia spp., and Toxocara cati in feral and pet domestic cats. J. Am. Vet. Med. Assoc. 2004, 225, 1394–1398. [Google Scholar] [CrossRef]
- Potts, M. Desiccation tolerance of prokaryotes. Microbiol. Rev. 1994, 58, 755–805. [Google Scholar] [CrossRef]
- Drancourt, M.; Tran-Hung, L.; Courtin, J.; Lumley, H.d.; Raoult, D. Bartonella quintana in a 4000-year-old human tooth. J. Infect. Dis. 2005, 191, 607–611. [Google Scholar] [CrossRef]
- Okaro, U.; George, S.; Anderson, B. What Is in a Cat Scratch? Growth of Bartonella henselae in a Biofilm. Microorganisms 2021, 9, 835. [Google Scholar] [CrossRef]
- Mazur-Melewska, K.; Mania, A.; Kemnitz, P.; Figlerowicz, M.; Służewski, W. Cat-scratch disease: A wide spectrum of clinical pictures. Postep. Dermatol. Alergol. 2015, 32, 216–220. [Google Scholar] [CrossRef]
- Nawrocki, C.C.; Max, R.J.; Marzec, N.S.; Nelson, C.A. Atypical Manifestations of Cat-Scratch Disease, United States, 2005–2014. Emerg. Infect. Dis. 2020, 26, 1438–1446. [Google Scholar] [CrossRef]
- Panthawong, A.; Grieco, J.P.; Ngoen-Klan, R.; Chao, C.C.; Chareonviriyaphap, T. Detection of Anaplasma spp. and Bartonella spp. from wild-caught rodents and their ectoparasites in Nakhon Ratchasima Province, Thailand. J. Vector Ecol. 2020, 45, 241–253. [Google Scholar] [CrossRef]
- Greco, G.; Zarea, A.A.K.; Sgroi, G.; Tempesta, M.; D’Alessio, N.; Lanave, G.; Bezerra-Santos, M.A.; Iatta, R.; Veneziano, V.; Otranto, D.; et al. Zoonotic Bartonella species in Eurasian wolves and other free-ranging wild mammals from Italy. Zoonoses Public Health 2021, 68, 316–326. [Google Scholar] [CrossRef]
- Gutiérrez, R.; Shalit, T.; Markus, B.; Yuan, C.; Nachum-Biala, Y.; Elad, D.; Harrus, S. Bartonella kosoyi sp. nov. and Bartonella krasnovii sp. nov., two novel species closely related to the zoonotic Bartonella elizabethae, isolated from black rats and wild desert rodent-fleas. Int. J. Syst. Evol. Microbiol. 2020, 70, 1656–1665. [Google Scholar] [CrossRef]
- Souza, U.A.; Webster, A.; Dall’Agnol, B.; Morel, A.P.; Peters, F.B.; Favarini, M.O.; Mazim, F.D.; Soares, J.B.G.; Tirelli, F.P.; Tortato, M.A.; et al. Molecular and Serological Survey of the Cat-Scratch Disease Agent (Bartonella henselae) in Free-Ranging Leopardus geoffroyi and Leopardus wiedii (Carnivora: Felidae) From Pampa Biome, Brazil. Microb. Ecol. 2021, 81, 483–492. [Google Scholar] [CrossRef]
- Wilke, A.B.B.; Beier, J.C.; Benelli, G. Complexity of the relationship between global warming and urbanization—An obscure future for predicting increases in vector-borne infectious diseases. Curr. Opin. Insect Sci. 2019, 35, 1–9. [Google Scholar] [CrossRef]
- Fouque, F.; Reeder, J.C. Impact of past and on-going changes on climate and weather on vector-borne diseases transmission: A look at the evidence. Infect. Dis. Poverty 2019, 8, 51. [Google Scholar] [CrossRef]
- Zell, R. Global climate change and the emergence/re-emergence of infectious diseases. Int. J. Med. Microbiol. 2004, 293 (Suppl. S37), 16–26. [Google Scholar] [CrossRef]




| Time Bh SA2 Incubated in Fluid Matrix | |||||
|---|---|---|---|---|---|
| Inoculated Fluid Matrix | 0 h | 24 h | 48 h | 96 h | 7 d |
| Blood | + | + | + | + | + |
| Serum | + | + | + | + | + |
| Urine | + | + | |||
| Milk | + | + | + | + | + |
| Saline | + | + | + | + | + |
| Brugge | + | + | + | + | + |
| Inoculated Fluid Matrix | p-Value |
|---|---|
| Blood | 0.001 |
| Urine | 0.0001 |
| Milk | 0.0004 |
| Saline | 0.0005 |
| Brugge | 0.0007 |
| Time Bh SA2 Incubated in Original Fluid Matrix | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Inoculated Fluid Matrix | 0 h | 24 h | 48 h | 96 h | 7 d | 0 h | 24 h | 48 h | 96 h | 7 d | 0 h | 24 h | 48 h | 96 h | 7 d |
| Time Incubated in Brugge Enrichment Medium | |||||||||||||||
| 7 days | 14 days | 21 days | |||||||||||||
| Blood | + | + | + | + | + | + | + | + | + | + | + | + | + | ||
| Serum | + | + | + | + | + | + | |||||||||
| Urine | + | ||||||||||||||
| Milk | + | + | + | + | + | + | + | + | + | + | + | + | |||
| Saline | + | + | + | + | + | + | + | + | |||||||
| Brugge | + | + | + | + | + | + | + | + | + | + | + | + | |||
| Time Bh SA2 Incubated in Original Fluid Matrix | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Inoculated Fluid Matrix | 0 h | 24 h | 48 h | 96 h | 7 d | 0 h | 24 h | 48 h | 96 h | 7 d | 0 h | 24 h | 48 h | 96 h | 7 d |
| 7-day desiccation period at ambient temperature | |||||||||||||||
| 7 days post-reconstitution | 14 days post-reconstitution | 21 days post-reconstitution | |||||||||||||
| Blood | + | ++ | + | + | + | ++ | + | + | + | + | ++ | + | ++ | ||
| Serum | ++ | ++ | ++ | ++ | + | + | + | ++ | + | ||||||
| Urine | + | ||||||||||||||
| Milk | + | + | ++ | + | + | + | + | ++ | |||||||
| Saline | + | ++ | + | + | |||||||||||
| Brugge | ++ | ++ | + | + | + | ||||||||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bush, J.C.; Maggi, R.G.; Breitschwerdt, E.B. Viability and Desiccation Resistance of Bartonella henselae in Biological and Non-Biological Fluids: Evidence for Pathogen Environmental Stability. Pathogens 2023, 12, 950. https://doi.org/10.3390/pathogens12070950
Bush JC, Maggi RG, Breitschwerdt EB. Viability and Desiccation Resistance of Bartonella henselae in Biological and Non-Biological Fluids: Evidence for Pathogen Environmental Stability. Pathogens. 2023; 12(7):950. https://doi.org/10.3390/pathogens12070950
Chicago/Turabian StyleBush, Janice C., Ricardo G. Maggi, and Edward B. Breitschwerdt. 2023. "Viability and Desiccation Resistance of Bartonella henselae in Biological and Non-Biological Fluids: Evidence for Pathogen Environmental Stability" Pathogens 12, no. 7: 950. https://doi.org/10.3390/pathogens12070950
APA StyleBush, J. C., Maggi, R. G., & Breitschwerdt, E. B. (2023). Viability and Desiccation Resistance of Bartonella henselae in Biological and Non-Biological Fluids: Evidence for Pathogen Environmental Stability. Pathogens, 12(7), 950. https://doi.org/10.3390/pathogens12070950

