Oral Epithelial Cells Expressing Low or Undetectable Levels of Human Angiotensin-Converting Enzyme 2 Are Susceptible to SARS-CoV-2 Virus Infection In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Viral Infection Assay
2.3. Flow Cytometry
2.4. Real-Time RT-Quantitative PCR Analysis
2.5. Single-Molecule Fluorescence In Situ Hybridization (smFISH)
2.6. Statistical Analysis
3. Results
3.1. Expression of hACE2 and Alternative Receptors CD147 and AXL
3.2. Various Oral Epithelial Cell Lines Are Susceptible to SARS-CoV-2
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Available online: https://www.cdc.gov/museum/timeline/covid19.html (accessed on 12 June 2023).
- Available online: https://www.who.int/news/item/05-05-2023-statement-on-the-fifteenth-meeting-of-the-international-health-regulations-(2005)-emergency-committee-regarding-the-coronavirus-disease-(covid-19)-pandemic?adgroupsurvey={adgroupsurvey}&gclid=CjwKCAjw36GjBhAkEiwAKwIWySc5yoR-FeideiQ7-itrXvrL_X6gUVT0KWSxbDx4j73oHDD8R-TTZxoCqLEQAvD_BwE (accessed on 12 June 2023).
- Available online: https://www.cdc.gov/mmwr/volumes/72/wr/mm7219e1.htm?s_cid=mm7219e1_x (accessed on 12 June 2023).
- Callaway, E. Coronavirus variant XBB.1.5 rises in the United States—Is it a global threat? Nature 2023, 613, 222–223. [Google Scholar] [CrossRef]
- The, L. The COVID-19 pandemic in 2023: Far from over. Lancet 2023, 401, 79. [Google Scholar] [CrossRef]
- Pak, A.; Adegboye, O.A.; Adekunle, A.I.; Rahman, K.M.; McBryde, E.S.; Eisen, D.P. Economic Consequences of the COVID-19 Outbreak: The Need for Epidemic Preparedness. Front. Public Health 2020, 8, 241. [Google Scholar] [CrossRef] [PubMed]
- Rahman, S.; Rahman, M.M.; Miah, M.; Begum, M.N.; Sarmin, M.; Mahfuz, M.; Hossain, M.E.; Rahman, M.Z.; Chisti, M.J.; Ahmed, T.; et al. COVID-19 reinfections among naturally infected and vaccinated individuals. Sci. Rep. 2022, 12, 1438. [Google Scholar] [CrossRef]
- Jeffery-Smith, A.; Rowland, T.A.J.; Patel, M.; Whitaker, H.; Iyanger, N.; Williams, S.V.; Giddings, R.; Thompson, L.; Zavala, M.; Aiano, F.; et al. Reinfection with new variants of SARS-CoV-2 after natural infection: A prospective observational cohort in 13 care homes in England. Lancet Healthy Longev. 2021, 2, e811–e819. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, N.N.; Houhamdi, L.; Hoang, V.T.; Delerce, J.; Delorme, L.; Colson, P.; Brouqui, P.; Fournier, P.E.; Raoult, D.; Gautret, P. SARS-CoV-2 reinfection and COVID-19 severity. Emerg. Microbes Infect. 2022, 11, 894–901. [Google Scholar] [CrossRef] [PubMed]
- Jackson, C.B.; Farzan, M.; Chen, B.; Choe, H. Mechanisms of SARS-CoV-2 entry into cells. Nat. Rev. Mol. Cell Biol. 2022, 23, 3–20. [Google Scholar] [CrossRef]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280 e278. [Google Scholar] [CrossRef]
- Hansen, J.; Baum, A.; Pascal, K.E.; Russo, V.; Giordano, S.; Wloga, E.; Fulton, B.O.; Yan, Y.; Koon, K.; Patel, K.; et al. Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail. Science 2020, 369, 1010–1014. [Google Scholar] [CrossRef]
- Hoffmann, M.; Kleine-Weber, H.; Pöhlmann, S. A Multibasic Cleavage Site in the Spike Protein of SARS-CoV-2 Is Essential for Infection of Human Lung Cells. Mol. Cell 2020, 78, 779–784.e775. [Google Scholar] [CrossRef]
- Bestle, D.; Heindl, M.R.; Limburg, H.; Pilgram, O.; Moulton, H.; Stein, D.A.; Hardes, K.; Eickmann, M.; Dolnik, O.; Rohde, C.; et al. TMPRSS2 and furin are both essential for proteolytic activation of SARS-CoV-2 in human airway cells. Life Sci. Alliance 2020, 3, e202000786. [Google Scholar] [CrossRef]
- Zang, R.; Gomez Castro, M.F.; McCune, B.T.; Zeng, Q.; Rothlauf, P.W.; Sonnek, N.M.; Liu, Z.; Brulois, K.F.; Wang, X.; Greenberg, H.B.; et al. TMPRSS2 and TMPRSS4 promote SARS-CoV-2 infection of human small intestinal enterocytes. Sci. Immunol. 2020, 5, eabc3582. [Google Scholar] [CrossRef]
- Kim, Y.; Jang, G.; Lee, D.; Kim, N.; Seon, J.W.; Kim, Y.-h.; Lee, C. Trypsin enhances SARS-CoV-2 infection by facilitating viral entry. Arch. Virol. 2022, 167, 441–458. [Google Scholar] [CrossRef]
- Daly, J.L.; Simonetti, B.; Klein, K.; Chen, K.-E.; Williamson, M.K.; Antón-Plágaro, C.; Shoemark, D.K.; Simón-Gracia, L.; Bauer, M.; Hollandi, R.; et al. Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science 2020, 370, 861–865. [Google Scholar] [CrossRef]
- Cantuti-Castelvetri, L.; Ojha, R.; Pedro, L.D.; Djannatian, M.; Franz, J.; Kuivanen, S.; van der Meer, F.; Kallio, K.; Kaya, T.; Anastasina, M.; et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 2020, 370, 856–860. [Google Scholar] [CrossRef] [PubMed]
- Bayati, A.; Kumar, R.; Francis, V.; McPherson, P.S. SARS-CoV-2 infects cells after viral entry via clathrin-mediated endocytosis. J. Biol. Chem. 2021, 296, 100306. [Google Scholar] [CrossRef] [PubMed]
- Inoue, Y.; Tanaka, N.; Tanaka, Y.; Inoue, S.; Morita, K.; Zhuang, M.; Hattori, T.; Sugamura, K. Clathrin-dependent entry of severe acute respiratory syndrome coronavirus into target cells expressing ACE2 with the cytoplasmic tail deleted. J. Virol. 2007, 81, 8722–8729. [Google Scholar] [CrossRef]
- Nguyen, L.; McCord, K.A.; Bui, D.T.; Bouwman, K.M.; Kitova, E.N.; Elaish, M.; Kumawat, D.; Daskhan, G.C.; Tomris, I.; Han, L.; et al. Sialic acid-containing glycolipids mediate binding and viral entry of SARS-CoV-2. Nat. Chem. Biol. 2022, 18, 81–90. [Google Scholar] [CrossRef] [PubMed]
- Arrindell, J.; Abou Atmeh, P.; Jayet, L.; Sereme, Y.; Mege, J.L.; Desnues, B. Vimentin is an important ACE2 co-receptor for SARS-CoV-2 in epithelial cells. iScience 2022, 25, 105463. [Google Scholar] [CrossRef] [PubMed]
- Amraei, R.; Xia, C.; Olejnik, J.; White, M.R.; Napoleon, M.A.; Lotfollahzadeh, S.; Hauser, B.M.; Schmidt, A.G.; Chitalia, V.; Muhlberger, E.; et al. Extracellular vimentin is an attachment factor that facilitates SARS-CoV-2 entry into human endothelial cells. Proc. Natl. Acad. Sci. USA 2022, 119, e2113874119. [Google Scholar] [CrossRef]
- Clausen, T.M.; Sandoval, D.R.; Spliid, C.B.; Pihl, J.; Perrett, H.R.; Painter, C.D.; Narayanan, A.; Majowicz, S.A.; Kwong, E.M.; McVicar, R.N.; et al. SARS-CoV-2 Infection Depends on Cellular Heparan Sulfate and ACE2. Cell 2020, 183, 1043–1057.e1015. [Google Scholar] [CrossRef] [PubMed]
- Bohan, D.; Van Ert, H.; Ruggio, N.; Rogers, K.J.; Badreddine, M.; Aguilar Briseño, J.A.; Elliff, J.M.; Rojas Chavez, R.A.; Gao, B.; Stokowy, T.; et al. Phosphatidylserine receptors enhance SARS-CoV-2 infection. PLoS Pathog. 2021, 17, e1009743. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.; Zhang, M.; Chang, T.L. ACE2-independent alternative receptors for SARS-CoV-2. Viruses 2022, 14, 2535. [Google Scholar] [CrossRef]
- Christie, S.M.; Tada, T.; Yin, Y.; Bhardwaj, A.; Landau, N.R.; Rothenberg, E. Single-virus tracking reveals variant SARS-CoV-2 spike proteins induce ACE2-independent membrane interactions. Sci. Adv. 2022, 8, eabo3977. [Google Scholar] [CrossRef]
- Xu, C.; Wang, A.; Geng, K.; Honnen, W.; Wang, X.; Bruiners, N.; Singh, S.; Ferrara, F.; D’Angelo, S.; Bradbury, A.R.M.; et al. Human Immunodeficiency Viruses Pseudotyped with SARS-CoV-2 Spike Proteins Infect a Broad Spectrum of Human Cell Lines through Multiple Entry Mechanisms. Viruses 2021, 13, 953. [Google Scholar] [CrossRef]
- Rowan-Nash, A.D.; Korry, B.J.; Mylonakis, E.; Belenky, P. Cross-Domain and Viral Interactions in the Microbiome. Microbiol. Mol. Biol. Rev. 2019, 83, e00044-18. [Google Scholar] [CrossRef] [PubMed]
- Shah, M.; Woo, H.G. Omicron: A Heavily Mutated SARS-CoV-2 Variant Exhibits Stronger Binding to ACE2 and Potently Escapes Approved COVID-19 Therapeutic Antibodies. Front. Immunol. 2022, 12, 6031. [Google Scholar] [CrossRef]
- Nehlmeier, I.; Kempf, A.; Arora, P.; Cossmann, A.; Dopfer-Jablonka, A.; Stankov, M.V.; Schulz, S.R.; Jäck, H.-M.; Behrens, G.M.N.; Pöhlmann, S.; et al. Host cell entry and neutralisation sensitivity of the SARS-CoV-2 XBB.1.16 lineage. Cell. Mol. Immunol. 2023. [Google Scholar] [CrossRef]
- Meng, B.; Abdullahi, A.; Ferreira, I.; Goonawardane, N.; Saito, A.; Kimura, I.; Yamasoba, D.; Gerber, P.P.; Fatihi, S.; Rathore, S.; et al. Altered TMPRSS2 usage by SARS-CoV-2 Omicron impacts infectivity and fusogenicity. Nature 2022, 603, 706–714. [Google Scholar] [CrossRef]
- Willett, B.J.; Grove, J.; MacLean, O.A.; Wilkie, C.; De Lorenzo, G.; Furnon, W.; Cantoni, D.; Scott, S.; Logan, N.; Ashraf, S.; et al. SARS-CoV-2 Omicron is an immune escape variant with an altered cell entry pathway. Nat. Microbiol. 2022, 7, 1161–1179. [Google Scholar] [CrossRef]
- Pia, L.; Rowland-Jones, S. Omicron entry route. Nat. Rev. Immunol. 2022, 22, 144. [Google Scholar] [CrossRef]
- Peacock, T.P.; Brown, J.C.; Zhou, J.; Thakur, N.; Sukhova, K.; Newman, J.; Kugathasan, R.; Yan, A.W.C.; Furnon, W.; De Lorenzo, G.; et al. The altered entry pathway and antigenic distance of the SARS-CoV-2 Omicron variant map to separate domains of spike protein. bioRxiv 2022. [Google Scholar] [CrossRef]
- WHO. Transmission of SARS-CoV-2: Implication for Infection Prevention Precautions. World Health Organization. 2020. Available online: https://www.who.int/news-room/commentaries/detail/transmission-of-sars-cov-2-implications-for-infection-prevention-precautions (accessed on 12 June 2023).
- To, K.K.; Tsang, O.T.; Leung, W.S.; Tam, A.R.; Wu, T.C.; Lung, D.C.; Yip, C.C.; Cai, J.P.; Chan, J.M.; Chik, T.S.; et al. Temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by SARS-CoV-2: An observational cohort study. Lancet Infect. Dis. 2020, 20, 565–574. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Kim, T.; Lee, E.; Lee, C.; Kim, H.; Rhee, H.; Park, S.Y.; Son, H.-J.; Yu, S.; Park, J.W.; et al. Clinical Course and Molecular Viral Shedding among Asymptomatic and Symptomatic Patients With SARS-CoV-2 Infection in a Community Treatment Center in the Republic of Korea. JAMA Intern. Med. 2020, 180, 1447–1452. [Google Scholar] [CrossRef]
- Pijuan-Galito, S.; Tarantini, F.S.; Tomlin, H.; Jenkins, H.; Thompson, J.L.; Scales, D.; Stroud, A.; Tellechea Lopez, A.; Hassall, J.; McTernan, P.G.; et al. Saliva for COVID-19 Testing: Simple but Useless or an Undervalued Resource? Front. Virol. 2021, 1, 29. [Google Scholar] [CrossRef]
- Huang, N.; Pérez, P.; Kato, T.; Mikami, Y.; Okuda, K.; Gilmore, R.C.; Conde, C.D.; Gasmi, B.; Stein, S.; Beach, M.; et al. SARS-CoV-2 infection of the oral cavity and saliva. Nat. Med. 2021, 27, 892–903. [Google Scholar] [CrossRef]
- Xu, H.; Zhong, L.; Deng, J.; Peng, J.; Dan, H.; Zeng, X.; Li, T.; Chen, Q. High expression of ACE2 receptor of 2019-nCoV on the epithelial cells of oral mucosa. Int. J. Oral Sci. 2020, 12, 8. [Google Scholar] [CrossRef]
- Gupta, S.; Mohindra, R.; Chauhan, P.K.; Singla, V.; Goyal, K.; Sahni, V.; Gaur, R.; Verma, D.K.; Ghosh, A.; Soni, R.K.; et al. SARS-CoV-2 Detection in Gingival Crevicular Fluid. J. Dent. Res. 2021, 100, 187–193. [Google Scholar] [CrossRef]
- Gomes, S.C.; Fachin, S.; da Fonseca, J.G.; Angst, P.D.M.; Lamers, M.L.; da Silva, I.S.B.; Nunes, L.N. Dental biofilm of symptomatic COVID-19 patients harbours SARS-CoV-2. J. Clin. Periodontol. 2021, 48, 880–885. [Google Scholar] [CrossRef]
- Marques, B.B.F.; Guimarães, T.C.; Fischer, R.G.; Tinoco, J.M.M.; Pires, F.R.; Lima Junior, J.d.C.; Stevens, R.H.; Tinoco, E.M.B. Morphological alterations in tongue epithelial cells infected by SARS-CoV-2: A case–control study. Oral Dis. 2022, 28 (Suppl. S2), 2417–2422. [Google Scholar] [CrossRef]
- Xu, C.; Wang, A.; Hoskin, E.R.; Cugini, C.; Markowitz, K.; Chang, T.L.; Fine, D.H. Differential Effects of Antiseptic Mouth Rinses on SARS-CoV-2 Infectivity In Vitro. Pathogens 2021, 10, 272. [Google Scholar] [CrossRef]
- Xie, X.; Muruato, A.; Lokugamage, K.G.; Narayanan, K.; Zhang, X.; Zou, J.; Liu, J.; Schindewolf, C.; Bopp, N.E.; Aguilar, P.V.; et al. An Infectious cDNA Clone of SARS-CoV-2. Cell Host Microbe 2020, 27, 841–848e843. [Google Scholar] [CrossRef]
- Dikdan, R.J.; Marras, S.A.E.; Field, A.P.; Brownlee, A.; Cironi, A.; Hill, D.A.; Tyagi, S. Multiplex PCR Assays for Identifying all Major Severe Acute Respiratory Syndrome Coronavirus 2 Variants. J. Mol. Diagn. 2022, 24, 309–319. [Google Scholar] [CrossRef]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.; Bleicker, T.; Brunink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020, 25, 2000045. [Google Scholar] [CrossRef] [PubMed]
- Raj, A.; van den Bogaard, P.; Rifkin, S.A.; van Oudenaarden, A.; Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat. Methods 2008, 5, 877–879. [Google Scholar] [CrossRef] [PubMed]
- Raj, A.; Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 2010, 472, 365–386. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Chen, W.; Zhang, Z.; Deng, Y.; Lian, J.-Q.; Du, P.; Wei, D.; Zhang, Y.; Sun, X.-X.; Gong, L.; et al. CD147-spike protein is a novel route for SARS-CoV-2 infection to host cells. Signal. Transduct. Target. Ther. 2020, 5, 283. [Google Scholar] [CrossRef]
- Wang, S.; Qiu, Z.; Hou, Y.; Deng, X.; Xu, W.; Zheng, T.; Wu, P.; Xie, S.; Bian, W.; Zhang, C.; et al. AXL is a candidate receptor for SARS-CoV-2 that promotes infection of pulmonary and bronchial epithelial cells. Cell Res. 2021, 31, 126–140. [Google Scholar] [CrossRef]
Oligonucleotide | Sequence 5′ → 3′ |
---|---|
CoV-RdRP forward | GTGARATGGTCATGTGTGGCGG |
CoV-RdRP reverse | CARATGTTAAASACACTATTAGCATA |
CoV-RdRP molecular beacon | FAM - CGCAG GGTGGAACCTCATCAGGAGATGC CTGCG - BHQ-1 |
CoV-N forward | GACCCCAAAATCAGCGAAAT |
CoV-N reverse | TCTGGTTACTGCCAGTTGAATCTG |
CoV-N molecular beacon | CFR - CGCGAG ACCCCGCATTACGTTTGGTGGACC CTCGCG - BHQ-2 |
β-actin forward | CCCAGCACAATGAAGATCAAGATC |
β-actin reverse | AAGCATTTGCGGTGGACGAT |
β-actin molecular beacon | Q705 - CGCCCG GCAAGCAGGAGTATGACGAGTCCGG CGGGCG - BHQ-2 |
Primer | Forward | Reverse |
---|---|---|
Human GAPDH | 5′- GCACCACCAACTGCTTAGCAC-3′ | 5′-TCTTCTGGGTGGCAGTGATG-3′ |
Human ACE2 | 5′-CGAAGCCGAAGACCTGTTCTA-3′ | 5′-GGGCAAGTGTGGACTGTTCC-3′ |
Human TMPRSS2 | 5′-CAAGTGCTCCAACTCTGGGAT-3′ | 5′- AACACACCGATTCTCGTCCTC-3′ |
Human TMPRSS4 | 5′- CCAAGGACCGATCCACAC T-3′ | 5′- GTGAAGTTGTCGAAACAGGCA-3′; |
Human CD147 | 5′-GTC TTC CTC CCC GAG CCC-3′ | 5′-GGTGGCACGGACTCTGAC-3′ |
Human AXL | 5′-GTGGGCAACCCAGGGAATATC-3′ | 5′-GTACTG TCCCGTGTCG GAAAG-3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ebraham, L.; Xu, C.; Wang, A.; Hernandez, C.; Siclari, N.; Rajah, D.; Walter, L.; Marras, S.A.E.; Tyagi, S.; Fine, D.H.; et al. Oral Epithelial Cells Expressing Low or Undetectable Levels of Human Angiotensin-Converting Enzyme 2 Are Susceptible to SARS-CoV-2 Virus Infection In Vitro. Pathogens 2023, 12, 843. https://doi.org/10.3390/pathogens12060843
Ebraham L, Xu C, Wang A, Hernandez C, Siclari N, Rajah D, Walter L, Marras SAE, Tyagi S, Fine DH, et al. Oral Epithelial Cells Expressing Low or Undetectable Levels of Human Angiotensin-Converting Enzyme 2 Are Susceptible to SARS-CoV-2 Virus Infection In Vitro. Pathogens. 2023; 12(6):843. https://doi.org/10.3390/pathogens12060843
Chicago/Turabian StyleEbraham, Laith, Chuan Xu, Annie Wang, Cyril Hernandez, Nicholas Siclari, Divino Rajah, Lewins Walter, Salvatore A. E. Marras, Sanjay Tyagi, Daniel H. Fine, and et al. 2023. "Oral Epithelial Cells Expressing Low or Undetectable Levels of Human Angiotensin-Converting Enzyme 2 Are Susceptible to SARS-CoV-2 Virus Infection In Vitro" Pathogens 12, no. 6: 843. https://doi.org/10.3390/pathogens12060843
APA StyleEbraham, L., Xu, C., Wang, A., Hernandez, C., Siclari, N., Rajah, D., Walter, L., Marras, S. A. E., Tyagi, S., Fine, D. H., Daep, C. A., & Chang, T. L. (2023). Oral Epithelial Cells Expressing Low or Undetectable Levels of Human Angiotensin-Converting Enzyme 2 Are Susceptible to SARS-CoV-2 Virus Infection In Vitro. Pathogens, 12(6), 843. https://doi.org/10.3390/pathogens12060843