Companion Vector-Borne Pathogens and Associated Risk Factors in Apparently Healthy Pet Animals (Dogs and Cats) in Khukhot City Municipality, Pathum Thani Province, Thailand
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sample Collection
2.2. Molecular Detection of CVBPs in Dogs and Cats
2.3. Sequence and Phylogenetic Analysis
2.4. Statistical Analysis
3. Results
3.1. Prevalence of CVBPs in Pet Dogs and Cats
3.2. Genetic Characterization of CVBPs in Dogs and Cats
3.3. Phylogenetic Analysis
3.4. Risk Factors Associated with CVBP Infections in Dogs and Cats in Khukhot City Municipality, Pathum Thani, Thailand
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Olmos, M.B.; Bostik, V. Climate Change and Human Security-The Proliferation of Vector-Borne Diseases Due to Climate Change. Mil. Med. Sci. Lett. 2021, 90, 100–106. [Google Scholar] [CrossRef] [Scilit]
- Caminade, C.; McIntyre, K.M.; Jones, A.E. Impact of Recent and Future Climate Change on Vector-Borne diseases. Ann. N. Y. Acad. Sci. 2019, 1436, 157–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Otranto, D.; Dantas-Torres, F.; Fourie, J.J.; Lorusso, V.; Varloud, M.; Gradoni, L.; Drake, J.; Geurden, T.; Kaminsky, R.; Heckeroth, A.R. World Association for the Advancement of Veterinary Parasitology (WAAVP) guidelines for studies evaluating the efficacy of parasiticides in reducing the risk of vector-borne pathogen transmission in dogs and cats. Vet. Parasitol. 2021, 290, 109369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hii, S.F.; Kopp, S.R.; Thompson, M.F.; O’Leary, C.A.; Rees, R.L.; Traub, R.J. Canine vector-borne disease pathogens in dogs from south-east Queensland and north-east Northern Territory. Aust. Vet. J. 2012, 90, 130–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Defaye, B.; Moutailler, S.; Pasqualini, V.; Quilichini, Y. Distribution of Tick-Borne Pathogens in Domestic Animals and Their Ticks in the Countries of the Mediterranean Basin between 2000 and 2021: A Systematic Review. Microorganisms 2022, 10, 1236. [Google Scholar] [CrossRef] [Scilit]
- Azrizal-Wahid, N.; Sofian-Azirun, M.; Low, V.L. Flea-borne pathogens in the cat flea Ctenocephalides felis and their association with mtDNA diversity of the flea host. Comp. Immunol. Microbiol. Infect. Dis. 2021, 75, 101621. [Google Scholar] [CrossRef] [Scilit]
- dos Santos, A.P.; dos Santos, R.P.; Biondo, A.W.; Dora, J.M.; Goldani, L.Z.; de Oliveira, S.T.; de Sá Guimarães, A.M.; Timenetsky, J.; de Morais, H.A.; González, F.H.; et al. Hemoplasma infection in HIV-positive patient, Brazil. Emerg. Infect. Dis. 2008, 14, 1922–1924. [Google Scholar] [CrossRef] [Scilit]
- Otranto, D. Arthropod-borne pathogens of dogs and cats: From pathways and times of transmission to dis-ease control. Vet. Parasitol. 2018, 251, 68–77. [Google Scholar] [CrossRef] [Scilit]
- Chimnoi, W.; Pinyopanuwat, N.; Kengradomkij, C.; Inpankaew, T.; Sinking, P.; Saengow, S.; Yangtara, S.; Suraruangchai, D.; Sathaporn Jittapalapong, S. Prevalence of external parasites of stray cats and dogs residing in monasteries of Bangkok, Metropolitan Areas, Thailand. In Proceedings of the 55th Kasetsart University Annual Conference, Bangkok, Thailand, 31 January–3 February 2017. [Google Scholar]
- Do, T.; Kamyingkird, K.; Chimnoi, W.; Inpankaew, T. Evaluation of hematological alteration of vector-borne pathogens in cats from Bangkok, Thailand. BMC Vet. Res. 2021, 17, 28. [Google Scholar] [CrossRef] [Scilit]
- Groves, M.; Dennis, G.; Amyx, H.; Huxsoll, D. Transmission of Ehrlichia canis to dogs by ticks (Rhipicephalus sanguineus). Am. J. Vet. Res. 1975, 36, 937–940. [Google Scholar]
- Low, V.L.; Tan, T.K.; Khoo, J.J.; Lim, F.S.; AbuBakar, S. An overview of rickettsiae in Southeast Asia: Vec-tor-animal-human interface. Acta Trop. 2020, 202, 105282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maruyama, S.; Boonmar, S.; Morita, Y.; Sakai, T.; Tanaka, S.; Yamaguchi, F.; Kabeya, H.; Katsube, Y. Seroprevalence of Bartonella henselae and Toxoplasma gondii among healthy individuals in Thai-land. J. Vet. Med. Sci. 2000, 62, 635–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buddhachat, K.; Meerod, T.; Pradit, W.; Siengdee, P.; Chomdej, S.; Nganvongpanit, K. Simultaneous differential detection of canine blood parasites: Multiplex high-resolution melting analysis (mHRM). Ticks Tick Borne Dis. 2020, 11, 101370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Do, T.; Ngasaman, R.; Saechan, V.; Pitaksakulrat, O.; Liu, M.; Xuan, X.; Inpankaew, T. First Molecular Detection of Babesia gibsoni in Stray Dogs from Thailand. Pathogens 2021, 10, 639. [Google Scholar] [CrossRef] [Scilit]
- Huggins, L.G.; Koehler, A.V.; Ng-Nguyen, D.; Wilcox, S.; Schunack, B.; Inpankaew, T.; Traub, R.J. Assessment of a metabarcoding approach for the characterisation of vector-borne bacteria in canines from Bangkok, Thailand. Parasites Vectors 2019, 12, 17. [Google Scholar] [CrossRef] [Scilit]
- Piratae, S.; Senawong, P.; Chalermchat, P.; Harnarsa, W.; Sae-Chue, B. Molecular evidence of Ehrlichia canis and Anaplasma platys and the association of infections with hematological responses in naturally infected dogs in Kalasin, Thailand. Vet. World 2019, 12, 131–135. [Google Scholar] [CrossRef] [Scilit]
- Rucksaken, R.; Maneeruttanarungroj, C.; Maswanna, T.; Sussadee, M.; Kanbutra, P. Comparison of conventional polymerase chain reaction and routine blood smear for the detection of Babesia canis, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in Buriram Province, Thailand. Vet. World 2019, 12, 700–705. [Google Scholar] [CrossRef] [Scilit]
- Laummaunwai, P.; Sriraj, P.; Aukkanimart, R.; Boonmars, T.; Wonkchalee, N.; Boonjaraspinyo, S.; Sangmaneedet, S.; Mityodwong, T.; Potchimplee, P.; Khianman, P. Molecular detection and treatment of tick-borne pathogens in domestic dogs in Khon Kaen, northeastern Thailand. Southeast Asian J. Trop. Med. Public Health 2014, 45, 1157–1166. [Google Scholar]
- Bartlett, J.E.; Kotrlik, J.W.; Higgins, C.C. Organization Research: Determining appropriate sample size in survey research. Inf. Technol. Learn. Perform. J. 2001, 19, 43. [Google Scholar]
- Hilpertshauser, H.; Deplazes, P.; Schnyder, M.; Gern, L.; Mathis, A. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl. Environ. Microbiol. 2006, 72, 6503–6507. [Google Scholar] [CrossRef] [Scilit]
- Inokuma, H.; Fujii, K.; Okuda, M.; Onishi, T.; Beaufils, J.P.; Raoult, D.; Brouqui, P. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin. Diagn. Lab. Immunol. 2002, 9, 1132–1136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inokuma, H.; Brouqui, P.; Drancourt, M.; Raoult, D. Citrate synthase gene sequence: A new tool for phylogenetic analysis and identification of Ehrlichia. J. Clin. Microbiol. 2001, 39, 3031–3039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rolain, J.M.; Franc, M.; Davoust, B.; Raoult, D. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis, and Wolbachia pipientis in cat fleas, France. Emerg. Infect. Dis. 2003, 9, 338–342. [Google Scholar] [CrossRef] [Scilit]
- Criado-Fornelio, A.; Martinez-Marcos, A.; Buling-Saraña, A.; Barba-Carretero, J.C. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in cats from southern Europe: A molecular study. Vet. Microbiol. 2003, 93, 307–317. [Google Scholar] [CrossRef] [Scilit]
- Phoosangwalthong, P.; Hii, S.F.; Kamyingkird, K.; Kengradomkij, C.; Pinyopanuwat, N.; Chimnoi, W.; Traub, R.J.; Inpankaew, T. Cats as potential mammalian reservoirs for Rickettsia sp. genotype RF2125 in Bangkok, Thailand. Vet. Parasitol. Reg. Stud. Rep. 2018, 13, 188–192. [Google Scholar] [CrossRef] [Scilit]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.R-project.org/ (accessed on 9 December 2022).
- Colella, V.; Nguyen, V.L.; Tan, D.Y.; Lu, N.; Fang, F.; Zhijuan, Y.; Wang, J.; Liu, X.; Chen, X.; Dong, J.; et al. Zoonotic Vectorborne Pathogens and Ectoparasites of Dogs and Cats in Eastern and Southeast Asia. Emerg. Infect. Dis. 2020, 26, 1221–1233. [Google Scholar] [CrossRef] [Scilit]
- Thongsahuan, S.; Chethanond, U.; Wasiksiri, S.; Saechan, V.; Thongtako, W.; Musikacharoen, T. Hematological profile of blood parasitic infected dogs in Southern Thailand. Vet. World 2020, 13, 2388–2394. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Ruttayaporn, N.; Saechan, V.; Jirapattharasate, C.; Vudriko, P.; Moumouni, P.F.A.; Cao, S.; Inpankaew, T.; Ybañez, A.P.; Suzuki, H. Molecular survey of canine vector-borne diseases in stray dogs in Thailand. Parasitol. Int. 2016, 65, 357–361. [Google Scholar] [CrossRef] [Scilit]
- Cevidanes, A.; Di Cataldo, S.; Muñoz-San Martín, C.; Latrofa, M.S.; Hernández, C.; Cattan, P.E.; Otranto, D.; Millán, J. Co-infection patterns of vector-borne zoonotic pathogens in owned free-ranging dogs in central Chile. Vet. Res. Commun. 2022; Online ahead of print. [CrossRef] [Scilit]
- Angelou, A.; Gelasakis, A.I.; Verde, N.; Pantchev, N.; Schaper, R.; Chandrashekar, R.; Papadopoulos, E. Prevalence and risk factors for selected canine vector-borne diseases in Greece. Parasites Vectors 2019, 12, 283. [Google Scholar] [CrossRef] [Scilit]
- Selim, A.; Alanazi, A.D.; Sazmand, A.; Otranto, D. Seroprevalence and associated risk factors for vector-borne pathogens in dogs from Egypt. Parasites Vectors 2021, 14, 175. [Google Scholar] [CrossRef] [Scilit]
- Díaz-Regañón, D.; Villaescusa, A.; Ayllón, T.; Rodríguez-Franco, F.; García-Sancho, M.; Agulla, B.; Sainz, Á. Epidemiological study of hemotropic mycoplasmas (hemoplasmas) in cats from central Spain. Parasites Vectors 2018, 11, 140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Persichetti, M.F.; Solano-Gallego, L.; Serrano, L.; Altet, L.; Reale, S.; Masucci, M.; Pennisi, M.G. Detection of vector-borne pathogens in cats and their ectoparasites in southern Italy. Parasites Vectors 2016, 9, 247. [Google Scholar] [CrossRef] [Scilit]
- érez-Arellano, J.L.; Fenollar, F.; Angel-Moreno, A.; Bolaños, M.; Hernández, M.; Santana, E.; Hemmersbach-Miller, M.; Martín, A.M.; Raoult, D. Human Rickettsia felis infection, Canary Islands, Spain. Emerg. Infect. Dis. 2005, 11, 1961–1964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, S.A.; Bora, T.; Richards, A.L. Human Rickettsia felis infection in India. J. Vector Borne Dis. 2020, 57, 187–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teng, Z.; Zhao, N.; Ren, R.; Zhang, X.; Du, Z.; Wang, P.; Qin, T. Human Rickettsia felis infections in Mainland China. Front. Cell. Infect. Microbiol. 2022, 12, 997315. [Google Scholar] [CrossRef] [Scilit]


| Pathogen | Target Genes | Primer Sequences (5′–3′) | Amplicon Size (bp) | References |
|---|---|---|---|---|
| Babesia | 18S rRNA | GTTTCTGMCCCATCAG CTGTATTGTTATTTCTTGTCACTACCTC | 422–440 | [21] |
| Anaplasma | groEL | AAGGCGAAAGAAGCAGTCTTA CATAGTCTGAAGTGGAGGAC | 724 | [22] |
| Ehrlichia | gltA | TTATCTGTTTATGTTATATAAGC CAGTACCTATGCATATCAATCC | 1251 | [23] |
| Hepatozoon | 18S rRNA | ATACATGAGCAAAATCTCAAC CTTATTATTCCATGCTGCAG | 666 | [24] |
| Bartonella | gltA | GGGGACCAGCTCATGGTGG AATGCAAAAAGAACAGTAACA | 379 | [25] |
| Mycoplasma | 16S rRNA | ATACGGCCCATATTCCTACG TGCTCCACCACTTGTTCA | 595–618 | [26] |
| Rickettsia | ompB | CGACGTTAACG GTTTCTCATTCT ACCGGTTTCTTTGT AGTTTTCGTC | 252 | [27] |
| Factor | Number of Dogs | Number of Positives (%) | Chi-Square χ2 | Odds Ratio (95% CI) | p-Value |
|---|---|---|---|---|---|
| Sex | 0.43 | 0.510 | |||
| Male | 44 | 2 (4.6) | 1.00 | ||
| Female | 51 | 4 (7.8) | 0.6 (0.1–3.2) | ||
| Age | 7.39 | 0.006 | |||
| ≤1 year | 21 | 4 (19.0) | 8.5 (1.4–50.1) | ||
| >1 year | 74 | 2 (2.7) | 1.00 | ||
| Breed | NA | NA | |||
| Pure | 22 | 0 | NA | ||
| Mixed | 73 | 6 (8.2) | NA | ||
| Free-roaming | 0.05 | 0.830 | |||
| Yes | 28 | 2 (7.1) | 0.8 (0.1–4.8) | ||
| No | 67 | 4 (6.0) | 1.00 | ||
| Ectoparasite infestation | 0.20 | 0.656 | |||
| Yes | 72 | 5 (6.9) | 0.6 (0.1–5.5) | ||
| No | 23 | 1 (4.4) | 1.00 | ||
| Tri-monthly application of ectoparasiticides | 5.03 | 0.025 | |||
| Yes | 16 | 3 (18.6) | 5.8 (1.1–32.2) | ||
| No | 79 | 3 (3.8) | 1.00 |
| Factor | Number of Cats | Number of Positives (%) | Chi-Square χ2 | Odds Ratio (95% CI) | p-Value |
|---|---|---|---|---|---|
| Sex | 0.56 | 0.453 | |||
| Male | 34 | 6 (17.6) | 1.00 | ||
| Female | 81 | 10 (12.3) | 0.7 (0.2–2.0) | ||
| Age | 4.33 | 0.038 | |||
| ≤1 year | 49 | 3 (6.1) | 1.00 | ||
| >1 year | 66 | 13 (19.7) | 3.8 (1.0–14.0) | ||
| Breed | 0.43 | 0.514 | |||
| Pure | 4 | 1 (25.0) | 1.00 | ||
| Mixed | 111 | 15 (13.5) | 0.5 (0.1–4.8) | ||
| Free-roaming | 1.21 | 0.271 | |||
| Yes | 91 | 11 (12.1) | 1.00 | ||
| No | 24 | 5 (20.8) | 1.9 (0.6–6.2) | ||
| Ectoparasite infestation | 1.07 | 0.300 | |||
| No | 98 | 15 (15.3) | 1.00 | ||
| Yes | 17 | 1 (5.9) | 0.3 (0.1–2.8) | ||
| Tri-monthly application of ectoparasiticides | 0.61 | 0.435 | |||
| No | 101 | 15 (14.9) | 1.00 | ||
| Yes | 14 | 1 (7.1) | 0.4 (0.1–3.3) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luong, N.H.; Kamyingkird, K.; Thammasonthijarern, N.; Phasuk, J.; Nimsuphan, B.; Pattanatanang, K.; Chimnoi, W.; Kengradomkij, C.; Klinkaew, N.; Inpankaew, T. Companion Vector-Borne Pathogens and Associated Risk Factors in Apparently Healthy Pet Animals (Dogs and Cats) in Khukhot City Municipality, Pathum Thani Province, Thailand. Pathogens 2023, 12, 391. https://doi.org/10.3390/pathogens12030391
Luong NH, Kamyingkird K, Thammasonthijarern N, Phasuk J, Nimsuphan B, Pattanatanang K, Chimnoi W, Kengradomkij C, Klinkaew N, Inpankaew T. Companion Vector-Borne Pathogens and Associated Risk Factors in Apparently Healthy Pet Animals (Dogs and Cats) in Khukhot City Municipality, Pathum Thani Province, Thailand. Pathogens. 2023; 12(3):391. https://doi.org/10.3390/pathogens12030391
Chicago/Turabian StyleLuong, Nam Hung, Ketsarin Kamyingkird, Nipa Thammasonthijarern, Jumnongjit Phasuk, Burin Nimsuphan, Khampee Pattanatanang, Wissanuwat Chimnoi, Chanya Kengradomkij, Nutsuda Klinkaew, and Tawin Inpankaew. 2023. "Companion Vector-Borne Pathogens and Associated Risk Factors in Apparently Healthy Pet Animals (Dogs and Cats) in Khukhot City Municipality, Pathum Thani Province, Thailand" Pathogens 12, no. 3: 391. https://doi.org/10.3390/pathogens12030391
APA StyleLuong, N. H., Kamyingkird, K., Thammasonthijarern, N., Phasuk, J., Nimsuphan, B., Pattanatanang, K., Chimnoi, W., Kengradomkij, C., Klinkaew, N., & Inpankaew, T. (2023). Companion Vector-Borne Pathogens and Associated Risk Factors in Apparently Healthy Pet Animals (Dogs and Cats) in Khukhot City Municipality, Pathum Thani Province, Thailand. Pathogens, 12(3), 391. https://doi.org/10.3390/pathogens12030391

