Prevalence and Molecular Characterization of Extended-Spectrum β-Lactamases and AmpC β-lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry
Abstract
:1. Introduction
2. Results
3. Discussion
4. Material and Methods
4.1. Ethical Declaration
4.2. Sample Collection
4.3. Isolation and Identification of ESBL- Producing Enterobacteriaceae
4.4. Testing for Susceptibility to Antimicrobials
4.5. Phenotypic Confirmation of ESBL
4.6. DNA Isolation and Detection of ESBL and AmpC Type β-lactamase Genes
4.7. DNA Sequencing
4.8. Phylogenetic Analysis of the Sequenced Genes
4.9. Statistical Analysis
Target Genes | Nucleotide Sequence (5'to 3') | Amplicon Size (bp) | Reference |
---|---|---|---|
Bla MOX-1, Bla MOX-2, bla CMY-1, bla CMY-8 TO bla CMY-11 | GCTGCTCAAGGAGCACAGGAT CACATGACATA GGTGTGGTGC | 520 | [42] |
Bla LAT-1 TO Bla LAT-4, Bla CMY-2 TO Bla CMY-7, Bla BIL-1 | TGGCCAGA CTGACAGGCAAA TTTCTCCTGAACGTG GCT GGC | 462 | |
Bla DHA-1, Bla DHA-2 | AACTTTCACAGGTGTGCTGGGT CCGTACGCATACTGG CTT TGC | 405 | |
Bla ACC | AACAGCCTCAGCAGCCGGTTA TTCGCCGCAATCATC CCT AGC | 346 | |
Bla MIR-1, Bla ACT-1 | TCGGTAAAGCCGATGTTGCGG CTTCCACTGCGGCTGCCAGTT | 302 | |
Bla FOX-1, Bla FOX-5 B | AACATGGGGTATCAGGGAGATG CAAAGCGCGTAACCGGATTGG | 190 | |
Bla SHV | ATGCGTTATATTCGCCTGTG TGCTTTGTTAT CGGGCCAA | 747 | [43] |
Bla TEM | TCGCCGCATACACTATTCTCG AATGA ACGCTCACCGGCTCCA GATTTAT | 445 | |
Bla CTXM | ATGTGCAGYACCAGTAARGTK ATGGC TGGGTRAARTARGTSACCAGAAYCAGCGG | 593 |
PCR Reaction Mixture | Reaction Volume | |
---|---|---|
Conventional PCR | Multiplex PCR | |
2x Taq Master Mix | 5 μL | 20 μL |
PCR grade water | 2 μL | 3 μL |
Forward primer | 1 μL | 6 μL |
Reverse primer | 1 μL | 6 μL |
Template DNA | 1 μL | 5 μL |
Total | 10 μL | 40 μL |
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khalifa, H.O.; Soliman, A.M.; Ahmed, A.M.; Shimamoto, T.; Nariya, H.; Matsumoto, T.; Shimamoto, T. High Prevalence of Antimicrobial Resistance in Gram-Negative Bacteria Isolated from Clinical Settings in Egypt: Recalling for Judicious Use of Conventional Antimicrobials in Developing Nations. Microb. Drug Resist. 2019, 25, 371–385. [Google Scholar] [CrossRef]
- Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wieler, L.H. “One Health”--linking human, animal and environmental health. Int. J. Med. Microbiol. IJMM 2014, 304, 775–776. [Google Scholar] [CrossRef] [PubMed]
- Rupp, M.E.; Fey, P.D. Extended spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae: Considerations for diagnosis, prevention and drug treatment. Drugs 2003, 63, 353–365. [Google Scholar] [CrossRef]
- Rodríguez, I.; Barownick, W.; Helmuth, R.; Mendoza, M.C.; Rodicio, M.R.; Schroeter, A.; Guerra, B. Extended-spectrum {beta}-lactamases and AmpC {beta}-lactamases in ceftiofur-resistant Salmonella enterica isolates from food and livestock obtained in Germany during 2003-07. J. Antimicrob. Chemother. 2009, 64, 301–309. [Google Scholar] [CrossRef] [Green Version]
- Peirano, G.; Pitout, J.D.D. Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae: Update on Molecular Epidemiology and Treatment Options. Drugs 2019, 79, 1529–1541. [Google Scholar] [CrossRef]
- Bevan, E.R.; Jones, A.M.; Hawkey, P.M. Global epidemiology of CTX-M β-lactamases: Temporal and geographical shifts in genotype. J. Antimicrob. Chemother. 2017, 72, 2145–2155. [Google Scholar] [CrossRef] [Green Version]
- Braun, S.D.; Ahmed, M.F.; El-Adawy, H.; Hotzel, H.; Engelmann, I.; Weiß, D.; Monecke, S.; Ehricht, R. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Dairy Cattle Farms in the Nile Delta, Egypt. Front. Microbiol. 2016, 7, 1020. [Google Scholar] [CrossRef] [Green Version]
- Dahshan, H.; Abd-Elall, A.M.M.; Megahed, A.M.; Abd-El-Kader, M.A.; Nabawy, E.E. Veterinary antibiotic resistance, residues, and ecological risks in environmental samples obtained from poultry farms, Egypt. Environ. Monit. Assess. 2015, 187, 1–10. [Google Scholar] [CrossRef]
- El-Sharkawy, H.; Tahoun, A.; El-Gohary, A.E.-G.A.; El-Abasy, M.; El-Khayat, F.; Gillespie, T.; Kitade, Y.; Hafez, H.M.; Neubauer, H.; El-Adawy, H. Epidemiological, molecular characterization and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog. 2017, 9, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moawad, A.A.; Hotzel, H.; Neubauer, H.; Ehricht, R.; Monecke, S.; Tomaso, H.; Hafez, H.M.; Roesler, U.; El-Adawy, H. Antimicrobial resistance in Enterobacteriaceae from healthy broilers in Egypt: Emergence of colistin-resistant and extended-spectrum β-lactamase-producing Escherichia coli. Gut Pathog. 2018, 10, 39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dahms, C.; Hübner, N.O.; Kossow, A.; Mellmann, A.; Dittmann, K.; Kramer, A. Occurrence of ESBL-Producing Escherichia coli in Livestock and Farm Workers in Mecklenburg-Western Pomerania, Germany. PLoS ONE 2015, 10, e0143326. [Google Scholar] [CrossRef] [PubMed]
- Schmid, A.; Hörmansdorfer, S.; Messelhäusser, U.; Käsbohrer, A.; Sauter-Louis, C.; Mansfeld, R. Prevalence of extended-spectrum β-lactamase-producing Escherichia coli on Bavarian dairy and beef cattle farms. Appl. Environ. Microbiol. 2013, 79, 3027–3032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramadan, H.; Jackson, C.R.; Frye, J.G.; Hiott, L.M.; Samir, M.; Awad, A.; Woodley, T.A. Antimicrobial resistance, genetic diversity and multilocus sequence typing of Escherichia coli from humans, retail chicken and ground beef in Egypt. Pathogens 2020, 9, 357. [Google Scholar] [CrossRef]
- Ramadan, H.; Soliman, A.M.; Hiott, L.M.; Elbediwi, M.; Woodley, T.A.; Chattaway, M.A.; Jenkins, C.; Frye, J.G.; Jackson, C.R. Emergence of multidrug-resistant Escherichia coli producing CTX-M, MCR-1, and FosA in retail food from Egypt. Front. Cell. Infect. Microbiol. 2021, 559. [Google Scholar] [CrossRef]
- Robinson, T.P.; Bu, D.P.; Carrique-Mas, J.; Fèvre, E.M.; Gilbert, M.; Grace, D.; Hay, S.I.; Jiwakanon, J.; Kakkar, M.; Kariuki, S.; et al. Antibiotic resistance is the quintessential One Health issue. Trans. R. Soc. Trop. Med. Hyg. 2016, 110, 377–380. [Google Scholar] [CrossRef]
- Tosh, P.K.; McDonald, L.C. Infection control in the multidrug-resistant era: Tending the human microbiome. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2012, 54, 707–713. [Google Scholar] [CrossRef] [Green Version]
- Bloomfield, S.F.; Stanwell-Smith, R.; Crevel, R.; Pickup, J. Too clean, or not too clean: The hygiene hypothesis and home hygiene. Clin. Exp. Allergy 2006, 36, 402–425. [Google Scholar] [CrossRef]
- Amelia, A.; Nugroho, A.; Harijanto, P.N. Diagnosis and Management of Infections Caused by Enterobacteriaceae Producing Extended-Spectrum β-Lactamase. Acta Med. Indones. 2016, 48, 156–166. [Google Scholar]
- Jacoby, G. AmpC B-Lactamases Clin. Microbiol. Rev. Jan. 2009, 22, 161–182. [Google Scholar] [CrossRef] [Green Version]
- Egbule, O.S.; Iweriebor, B.C.; Odum, E.I. Beta-Lactamase-Producing Escherichia coli Isolates Recovered from Pig Handlers in Retail Shops and Abattoirs in Selected Localities in Southern Nigeria: Implications for Public Health. Antibiotics 2021, 10, 9. [Google Scholar] [CrossRef] [PubMed]
- Mahamat, O.O.; Kempf, M.; Lounnas, M.; Tidjani, A.; Hide, M.; Benavides, J.A.; Carrière, C.; Bañuls, A.-L.; Jean-Pierre, H.; Ouedraogo, A.-S. Epidemiology and prevalence of extended-spectrum β-lactamase-and carbapenemase-producing Enterobacteriaceae in humans, animals and the environment in West and Central Africa. Int. J. Antimicrob. Agents 2021, 57, 106203. [Google Scholar] [CrossRef] [PubMed]
- Founou, L.L.; Founou, R.C.; Ntshobeni, N.; Govinden, U.; Bester, L.A.; Chenia, H.Y.; Djoko, C.F.; Essack, S.Y. Emergence and spread of extended spectrum β-lactamase producing Enterobacteriaceae (ESBL-PE) in pigs and exposed workers: A multicentre comparative study between Cameroon and South Africa. Pathogens 2019, 8, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cantón, R.; Novais, A.; Valverde, A.; Machado, E.; Peixe, L.; Baquero, F.; Coque, T.M. Prevalence and spread of extended-spectrum beta-lactamase-producing Enterobacteriaceae in Europe. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2008, 14 (Suppl. S1), 144–153. [Google Scholar] [CrossRef] [Green Version]
- Hartmann, A.; Locatelli, A.; Amoureux, L.; Depret, G.; Jolivet, C.; Gueneau, E.; Neuwirth, C. Occurrence of CTX-M Producing Escherichia coli in Soils, Cattle, and Farm Environment in France (Burgundy Region). Front. Microbiol. 2012, 3, 83. [Google Scholar] [CrossRef] [Green Version]
- Hamedelnil, F.; Eltayeb, H. Molecular detection of Extended Spectrum β-lactamases (ESBLs) genes in E. coli isolated from urine specimens. Int. J. Adv. Sci. Res. 2012, 5, 407–417. [Google Scholar]
- Bush, K.; Jacoby, G.A. Updated functional classification of β-lactamases. Antimicrob. Agents Chemother. 2010, 54, 969–976. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tshitshi, L.; Manganyi, M.C.; Montso, P.K.; Mbewe, M.; Ateba, C.N. Extended Spectrum Beta-Lactamase-Resistant Determinants among Carbapenem-Resistant Enterobacteriaceae from Beef Cattle in the North West Province, South Africa: A Critical Assessment of Their Possible Public Health Implications. Antibiotics 2020, 9, 820. [Google Scholar] [CrossRef]
- Agyare, C.; Boamah, V.E.; Zumbi, C.N.; Osei, F.B. Antibiotic use in poultry production and its effects on bacterial resistance. Antimicrob. Resist.—A Glob. Threat. 2018, 33–51. [Google Scholar] [CrossRef] [Green Version]
- Gazal, L.E.S.; Medeiros, L.P.; Dibo, M.; Nishio, E.K.; Koga, V.L.; Gonçalves, B.C.; Grassotti, T.T.; de Camargo, T.C.L.; Pinheiro, J.J.; Vespero, E.C.; et al. Detection of ESBL/AmpC-Producing and Fosfomycin-Resistant Escherichia coli From Different Sources in Poultry Production in Southern Brazil. Front. Microbiol. 2020, 11, 604544. [Google Scholar] [CrossRef]
- Hazards, E.P.o.B. Scientific Opinion on the public health risks of bacterial strains producing extended-spectrum β-lactamases and/or AmpC β-lactamases in food and food-producing animals. EFSA J. 2011, 9, 2322. [Google Scholar]
- Coque, T.M.; Novais, A.; Carattoli, A.; Poirel, L.; Pitout, J.; Peixe, L.; Baquero, F.; Cantón, R.; Nordmann, P. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerg. Infect. Dis. 2008, 14, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Peirano, G.; Richardson, D.; Nigrin, J.; McGeer, A.; Loo, V.; Toye, B.; Alfa, M.; Pienaar, C.; Kibsey, P.; Pitout, J.D. High prevalence of ST131 isolates producing CTX-M-15 and CTX-M-14 among extended-spectrum-beta-lactamase-producing Escherichia coli isolates from Canada. Antimicrob. Agents Chemother. 2010, 54, 1327–1330. [Google Scholar] [CrossRef] [Green Version]
- Khalaf, N.G.; Eletreby, M.M.; Hanson, N.D. Characterization of CTX-M ESBLs in Enterobacter cloacae, Escherichia coli and Klebsiella pneumoniae clinical isolates from Cairo, Egypt. BMC Infect. Dis. 2009, 9, 84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramadan, A.A.; Abdelaziz, N.A.; Amin, M.A.; Aziz, R.K. Novel bla CTX-M variants and genotype-phenotype correlations among clinical isolates of extended spectrum beta lactamase-producing Escherichia coli. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef]
- Cormier, A.; Zhang, P.L.; Chalmers, G.; Weese, J.S.; Deckert, A.; Mulvey, M.; McAllister, T.; Boerlin, P. Diversity of CTX-M-positive Escherichia coli recovered from animals in Canada. Vet. Microbiol. 2019, 231, 71–75. [Google Scholar] [CrossRef]
- Badr, H.; Reda, R.M.; Hagag, N.M.; Kamel, E.; Elnomrosy, S.M.; Mansour, A.I.; Shahein, M.A.; Ali, S.F.; Ali, H.R. Multidrug-Resistant and Genetic Characterization of Extended-Spectrum Beta-Lactamase-Producing E. coli Recovered from Chickens and Humans in Egypt. Animals 2022, 12, 346. [Google Scholar] [CrossRef]
- Wayne, P. Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2011. [Google Scholar]
- Drieux, L.; Brossier, F.; Sougakoff, W.; Jarlier, V. Phenotypic detection of extended-spectrum β-lactamase production in Enterobacteriaceae: Review and bench guide. Clin. Microbiol. Infect. 2008, 14, 90–103. [Google Scholar] [CrossRef] [Green Version]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Gupta, G.; Tak, V.; Mathur, P. Detection of AmpC β lactamases in gram-negative bacteria. J. Lab. Physicians 2014, 6, 001–006. [Google Scholar] [CrossRef]
- Monstein, H.J.; Ostholm-Balkhed, A.; Nilsson, M.V.; Nilsson, M.; Dornbusch, K.; Nilsson, L.E. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. Apmis 2007, 115, 1400–1408. [Google Scholar] [CrossRef] [PubMed]
Sources of samples | Samples | No. of samples | E. coli | Klebsiella | Total | |||
---|---|---|---|---|---|---|---|---|
Positive | % | Positive | % | Positive | % | |||
Farm workers samples | Fecal samples | 20 | 4 | 20.0 | 2 | 10.0 | 6 | 30.0 |
Total | 20 | 4 | 20.0 | 2 | 10.0 | 6 | 30.0 | |
Cattle farm samples | Calves rectal swabs | 17 | 2 | 11.76 | 1 | 5.88 | 3 | 17.65 |
Cows rectal swabs | 17 | 2 | 11.76 | 2 | 11.76 | 4 | 23.53 | |
Milk | 14 | 2 | 14.28 | 1 | 7.14 | 3 | 21.43 | |
Milking machine swabs | 8 | 1 | 12.5 | 1 | 12.5 | 2 | 25.0 | |
Ration | 2 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | |
Water | 2 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | |
Total | 60 | 7 | 11.67 | 5 | 8.33 | 12 | 20.0 | |
Poultry farms samples | Cloacal swabs | 45 | 5 | 11.11 | 3 | 6.67 | 8 | 17.78 |
Ration | 5 | 1 | 20.0 | 2 | 40.0 | 3 | 60.0 | |
Water | 5 | 1 | 20.0 | 1 | 20.0 | 2 | 40.0 | |
Litter | 5 | 1 | 20.0 | 1 | 20.0 | 2 | 40.0 | |
Total | 60 | 8 | 13.33 | 7 | 11.67 | 15 | 25.0 |
Antibiotics | E. coli | Klebsiella | Total | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Type | Number | Resistant | % | Type | Number | Resistant | % | Type | Number | Resistant | % | |
Cefotaxime | Human | 4 | 3 | 75.0 | Human | 2 | 1 | 50.0 | Human | 6 | 4 | 66.67 |
Cattle | 7 | 5 | 71.43 | Cattle | 5 | 5 | 100.0 | Cattle | 12 | 10 | 83.33 | |
Poultry | 8 | 7 | 87.5 | Poultry | 7 | 7 | 100.0 | Poultry | 15 | 14 | 93.33 | |
Total | 28/33 | 84.85 | ||||||||||
Ceftazidime | Human | 4 | 2 | 50.0 | Human | 2 | 2 | 100.0 | Human | 6 | 4 | 66.67 |
Cattle | 7 | 7 | 100.0 | Cattle | 5 | 4 | 80.0 | Cattle | 12 | 11 | 91.67 | |
Poultry | 8 | 7 | 75.0 | Poultry | 7 | 6 | 85.71 | Poultry | 15 | 13 | 80.0 | |
Total | 28/33 | 84.85 | ||||||||||
Amoxyclavulanic | Human | 4 | 1 | 25.0 | Human | 2 | 0 | 0.00 | Human | 6 | 1 | 16.67 |
Cattle | 7 | 1 | 14.28 | Cattle | 5 | 1 | 20.00 | Cattle | 12 | 2 | 16.67 | |
Poultry | 8 | 2 | 25.0 | Poultry | 7 | 2 | 28.57 | Poultry | 15 | 4 | 26.67 | |
Total | 7/33 | 21.21 | ||||||||||
Levofloxacin | Human | 4 | 2 | 50.0 | Human | 2 | 2 | 100.0 | Human | 6 | 4 | 66.67 |
Cattle | 7 | 2 | 28.57 | Cattle | 5 | 2 | 40.0 | Cattle | 12 | 4 | 33.33 | |
Poultry | 8 | 6 | 75.0 | Poultry | 7 | 6 | 85.7 | Poultry | 15 | 12 | 80.0 | |
Total | 20/33 | 60.61 | ||||||||||
Imipenim | Human | 4 | 1 | 25.0 | Human | 2 | 0 | 0.00 | Human | 6 | 1 | 16.67 |
Cattle | 7 | 0 | 0.00 | Cattle | 5 | 1 | 20.0 | Cattle | 12 | 1 | 8.33 | |
Poultry | 8 | 1 | 12.5 | Poultry | 7 | 0 | 0.00 | Poultry | 15 | 1 | 6.67 | |
Total | 3/33 | 9.1 | ||||||||||
Cefepime | Human | 4 | 3 | 75.0 | Human | 2 | 2 | 100.0 | Human | 6 | 5 | 83.33 |
Cattle | 7 | 4 | 57.14 | Cattle | 5 | 3 | 60.0 | Cattle | 12 | 7 | 58.33 | |
Poultry | 8 | 6 | 75.0 | Poultry | 7 | 5 | 71.43 | Poultry | 15 | 11 | 73.33 | |
Total | 23/33 | 69.7 |
Isolates | Origin | Resistance Gene Pattern | Antimicrobial Resistance | |||
---|---|---|---|---|---|---|
blaCTX-M | blaSHV | blaTEM | AmpC | |||
Ec1 | Human | + | + | + | CTX, CAZ, AMC, LEVO, IPM | |
Ec2 | Human | + | + | CTX, CAZ, LEVO, FEP | ||
Ec3 | Human | + | + | + | CTX, FEP | |
Ec4 | Human | + | FEP | |||
Ec5 | Cattle | + | CTX, CAZ, LEVO, FEP | |||
Ec6 | Cattle | + | + | CTX, CAZ, LEVO, FEP | ||
Ec7 | Cattle | + | + | + | CTX, CAZ, FEP | |
Ec8 | Cattle | + | CTX, CAZ, FEP | |||
Ec9 | Cattle | + | + | CTX, CAZ, | ||
Ec10 | Cattle | + | + | + | + (blaFox & blaDHA) | CAZ, AMC |
Ec11 | Cattle | + | + | CAZ | ||
Ec12 | Poultry | + | + | CTX, LEVO, IPM, FEP | ||
Ec13 | Poultry | + | + | + | CTX, CAZ, AMC, LEVO, FEP | |
Ec14 | Poultry | + | + | + (blaFox & blaDHA) | CTX, CAZ, AMC, FEP | |
Ec15 | Poultry | + | + | + | CTX, CAZ, LEVO, FEP | |
Ec16 | Poultry | + | + | + | CTX, CAZ, LEVO, FEP | |
Ec17 | Poultry | + | + | + | CTX, CAZ, LEVO, FEP | |
Ec18 | Poultry | + | + | CTX, CAZ | ||
Ec19 | Poultry | + | + | CAZ, LEVO | ||
Kl1 | Human | + | + | + | CTX, CAZ, LEVO, FEP | |
Kl2 | Human | + | + | CAZ, LEVO, FEP | ||
Kl3 | Cattle | + | + | + | CTX, CAZ | |
Kl4 | Cattle | + | + | + | CTX, CAZ, LEVO, FEP | |
Kl5 | Cattle | + | + | CTX, CAZ, LEVO, FEP | ||
Kl6 | Cattle | + | + | + | + (blaFox & blaDHA) | CTX, CAZ, AMC |
Kl7 | Cattle | + | + | + | CTX, IPM, FEP | |
Kl8 | Poultry | + | + | + | + (blaACC) | CTX, CAZ, AMC, LEVO, FEP |
Kl9 | Poultry | + | + | + | + (blaACC) | CTX, CAZ, AMC, LEVO, FEP |
Kl10 | Poultry | + | + | + | CTX, CAZ | |
Kl11 | Poultry | + | + | + | CTX, CAZ, LEVO, FEP | |
Kl12 | Poultry | + | + | + | CTX, CAZ, LEVO, FEP | |
Kl13 | Poultry | + | + | + | CTX, CAZ, LEVO | |
Kl14 | Poultry | + | + | + | CTX, LEVO, FEP | |
Total | NO. | 23 | 31 | 29 | 5 | |
% | 69.70 | 93.94 | 87.88 | 15.15 |
Isolates | ID | Origin | GenBank Accession No. |
---|---|---|---|
Klebsiella | KHF | Human | MZ461491 |
Klebsiella | KCF | Cattle | MZ461492 |
Klebsiella | KPF | Poultry | MZ461493 |
E. coli | EHF | Human | MZ461494 |
E. coli | ECF | Cattle | MZ461495 |
E. coli | EPF | Poultry | MZ461496 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nossair, M.A.; Abd El Baqy, F.A.; Rizk, M.S.Y.; Elaadli, H.; Mansour, A.M.; Abd El-Aziz, A.H.; Alkhedaide, A.; Soliman, M.M.; Ramadan, H.; Shukry, M.; et al. Prevalence and Molecular Characterization of Extended-Spectrum β-Lactamases and AmpC β-lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry. Pathogens 2022, 11, 852. https://doi.org/10.3390/pathogens11080852
Nossair MA, Abd El Baqy FA, Rizk MSY, Elaadli H, Mansour AM, Abd El-Aziz AH, Alkhedaide A, Soliman MM, Ramadan H, Shukry M, et al. Prevalence and Molecular Characterization of Extended-Spectrum β-Lactamases and AmpC β-lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry. Pathogens. 2022; 11(8):852. https://doi.org/10.3390/pathogens11080852
Chicago/Turabian StyleNossair, Mohamed A., Fatma A. Abd El Baqy, Mohammad S. Y. Rizk, Haitham Elaadli, Alaa M. Mansour, Ayman H. Abd El-Aziz, Adil Alkhedaide, Mohamed Mohamed Soliman, Hazem Ramadan, Mustafa Shukry, and et al. 2022. "Prevalence and Molecular Characterization of Extended-Spectrum β-Lactamases and AmpC β-lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry" Pathogens 11, no. 8: 852. https://doi.org/10.3390/pathogens11080852
APA StyleNossair, M. A., Abd El Baqy, F. A., Rizk, M. S. Y., Elaadli, H., Mansour, A. M., Abd El-Aziz, A. H., Alkhedaide, A., Soliman, M. M., Ramadan, H., Shukry, M., & Shaaban, S. I. (2022). Prevalence and Molecular Characterization of Extended-Spectrum β-Lactamases and AmpC β-lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry. Pathogens, 11(8), 852. https://doi.org/10.3390/pathogens11080852