The Involvement of Thiamine Uptake in the Virulence of Edwardsiella piscicida
Abstract
1. Introduction
2. Results
2.1. E. piscicida Thiamine Transporter (TT) Operon Is Required for In Vivo Dissemination of E. piscicida
2.2. TT Knockout Reduces E. piscicida Motility and Flagellar Gene Expression
2.3. TT Knockout Impairs E. piscicida Ability to Attach Host Cells
2.4. C-di-GMP Is Involved in the Thiamine Uptake-Associated Virulence Regulation of E. piscicida
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Growth Conditions
4.2. Gene Deletion, Complementation, and Overexpression
4.3. Experimental Animals
4.4. In Vivo Infection
4.5. Soft Agar Swimming Assay
4.6. Cellular Adhesion Assay
4.7. qRT-PCR
4.8. Fluorescence Intensity Quantification
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Leung, K.Y.; Wang, Q.Y.; Zheng, X.C.; Zhuang, M.; Yang, Z.Y.; Shao, S.; Achmon, Y.; Siame, B.A. Versatile lifestyles of Edwardsiella: Free-living, pathogen, and core bacterium of the aquatic resistome. Virulence 2022, 13, 5–18. [Google Scholar] [CrossRef] [PubMed]
- Abayneh, T.; Colquhoun, D.J.; Sørum, H. Edwardsiella piscicida sp. nov. a novel species pathogenic to fish. J. Appl. Microbiol. 2013, 115, 634–635. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.T.; Zhang, X.-H. Edwardsiella tarda: An intriguing problem in aquaculture. Aquaculture 2014, 431, 129–135. [Google Scholar] [CrossRef]
- Leung, K.Y.; Wang, Q.Y.; Yang, Z.Y.; Siame, B.A. Edwardsiella piscicida: A versatile emerging pathogen of fish. Virulence 2019, 10, 555–567. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Xu, T.T.; Fossheim, L.E.; Zhang, X.-H. FliC, a Flagellin Protein, Is Essential for the Growth and Virulence of Fish Pathogen Edwardsiella tarda. PLoS ONE 2012, 7, e45070. [Google Scholar] [CrossRef]
- Sun, Y.; Zheng, W.-J.; Hu, Y.-H.; Sun, B.-G.; Sun, L. Edwardsiella tarda Eta1, an in vivo-Induced Antigen that is Involved in Host Infection. Infect. Immun. 2012, 80, 2948–2955. [Google Scholar] [CrossRef]
- Li, M.F.; Hu, Y.H.; Zheng, W.J.; Sun, B.G.; Wang, C.L.; Sun, L. Inv1: An Edwardsiella tarda invasin and a protective immunogen that is required for host infection. Fish Shellfish Immunol. 2012, 32, 586–592. [Google Scholar] [CrossRef]
- Zhou, Z.-J.; Sun, B.-G.; Sun, L. Edwardsiella tarda Sip1: A serum-induced zinc metalloprotease that is essential to serum resistance and host infection. Vet. Microbiol. 2015, 177, 332–340. [Google Scholar] [CrossRef]
- Wang, B.; Mo, Z.L.; Xiao, P.; Li, J.; Zou, Y.X.; Hao, B.; Li, G.Y. EseD, a Putative T3SS Translocon Component of Edwardsiella tarda, Contributes to Virulence in Fish and is a Candidate for Vaccine Development. Mar. Biotechnol. 2010, 12, 678–685. [Google Scholar] [CrossRef]
- Wang, B.; Mo, Z.L.; Mao, Y.X.; Zou, Y.X.; Xiao, P.; Li, J.; Yang, J.Y.; Ye, X.H.; Leung, K.Y.; Zhang, P.J. Investigation of EscA as a chaperone for the Edwardsiella tarda type III secretion system putative translocon component EseC. Microbiol. Read. 2009, 155 Pt 4, 1260–1271. [Google Scholar] [CrossRef]
- Chen, H.; Yang, D.; Han, F.; Tan, J.; Zhang, L.; Xiao, J.; Zhang, Y.; Liu, Q. The Bacterial T6SS Effector EvpP Prevents NLRP3 Inflammasome Activation by Inhibiting the Ca2+-Dependent MAPK-Jnk Pathway. Cell Host Microbe 2017, 21, 47–58. [Google Scholar] [CrossRef] [PubMed]
- Buján, N.; Toranzo, A.E.; Magariños, B. Edwardsiella piscicida: A significant bacterial pathogen of cultured fish. Dis. Aquat. Org. 2018, 131, 59–71. [Google Scholar] [CrossRef]
- Li, D.Y.; Liu, Y.L.; Liao, X.J.; He, T.T.; Sun, S.S.; Nie, P.; Xie, H.X. Identification and Characterization of EvpQ, a Novel T6SS Effector Encoded on a Mobile Genetic Element in Edwardsiella piscicida. Front. Microbiol. 2021, 12, 643498. [Google Scholar] [CrossRef]
- Leung, K.Y.; Siame, B.A.; Tenkink, B.J.; Noort, R.J.; Mok, Y.-K. Edwardsiella tarda—Virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect. 2012, 14, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Ling, S.H.M.; Wang, X.H.; Lim, T.M.; Leung, K.Y. Green fluorescent protein-tagged Edwardsiella tarda reveals portal of entry in fish. Fems. Microbiol. Lett. 2001, 194, 239–243. [Google Scholar] [CrossRef]
- Wei, L.; Qiao, H.; Sit, B.; Yin, K.; Yang, G.; Ma, R.; Ma, J.; Yang, C.; Yao, J.; Ma, Y.; et al. A Bacterial Pathogen Senses Host Mannose to Coordinate Virulence. Iscience 2019, 20, 310–323. [Google Scholar] [CrossRef]
- Yin, K.; Zhang, J.; Ma, J.; Jin, P.; Ma, Y.; Zhang, Y.; Liu, X.; Wang, Q. MviN mediates the regulation of environmental osmotic pressure on esrB to control the virulence in the marine fish pathogen Edwardsiella piscicida. Microbiol. Res. 2020, 239, 126528. [Google Scholar] [CrossRef] [PubMed]
- Jurgenson, C.T.; Begley, T.P.; Ealick, S.E. The Structural and Biochemical Foundations of Thiamin Biosynthesis. Annu. Rev. Biochem. 2009, 78, 569–603. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Bian, J.; Deng, Y.; Smith, A.; Nunez, R.E.; Li, M.B.; Pal, U.; Yu, A.-M.; Qiu, W.; Ealick, S.E.; et al. Lyme disease spirochaete Borrelia burgdorferi does not require thiamin. Nat. Microbiol. 2016, 2, 16213. [Google Scholar] [CrossRef]
- Aleshin, V.A.; Mkrtchyan, G.V.; Bunik, V.I. Mechanisms of Non-coenzyme Action of Thiamine: Protein Targets and Medical Significance. Biochemistry 2019, 84, 829–850. [Google Scholar] [CrossRef]
- Maupin-Furlow, J.A. Vitamin B1 (Thiamine) Metabolism and Regulation in Archaea. In B Group Vitamins—Current Uses and Perspectives; LeBlanc, J.G., Ed.; IntechOpen Limited: London, UK, 2018; Chapter 2; pp. 9–31. [Google Scholar]
- Begley, T.P.; Downs, D.M.; Ealick, S.E.; McLafferty, F.W.; Van Loon, A.P.G.M.; Taylor, S.; Campobasso, N.; Chiu, H.-J.; Kinsland, C.; Reddick, J.J.; et al. Thiamin biosynthesis in prokaryotes. Arch. Microbiol. 1999, 171, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Devedjiev, Y.; Surendranath, Y.; Derewenda, U.; Gabrys, A.; Cooper, D.R.; Zhang, R.-G.; Lezondra, L.; Joachimiak, A.; Derewenda, Z.S. The Structure and Ligand Binding Properties of the B.subtilis YkoF Gene Product, a Member of a Novel Family of Thiamin/HMP-binding Proteins. J. Mol. Biol. 2004, 343, 395–406. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Webb, E.; Claas, K.; Downs, D. thiBPQ encodes an ABC transporter required for transport of thiamine and thiamine pyrophosphate in Salmonella typhimurium. J. Biol. Chem. 1998, 273, 8946–8950. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.; Su, X.; Guo, H.; Qi, J.; Cheng, H. VdThit, a Thiamine Transport Protein, Is Required for Pathogenicity of the Vascular Pathogen Verticillium dahliae. Mol. Plant-Microbe Interact. 2016, 29, 545–559. [Google Scholar] [CrossRef] [PubMed]
- Schauer, K.; Stolz, J.; Scherer, S.; Fuchs, T.M. Both Thiamine Uptake and Biosynthesis of Thiamine Precursors are Required for Intracellular Replication of Listeria monocytogenes. J. Bacteriol. 2009, 191, 2218–2227. [Google Scholar] [CrossRef] [PubMed]
- Tylicki, A.; Łotowski, Z.; Siemieniuk, M.; Ratkiewicz, A. Thiamine and selected thiamine antivitamins—Biological activity and methods of synthesis. Biosci. Rep. 2018, 38, 38. [Google Scholar] [CrossRef]
- Hengge, R. Principles of c-di-GMP signalling in bacteria. Nat. Rev. Microbiol. 2009, 7, 263–273. [Google Scholar] [CrossRef]
- Jenal, U.; Reinders, A.; Lori, U.J.A.R.C. Cyclic di-GMP: Second messenger extraordinaire. Nat. Rev. Microbiol. 2017, 15, 271–284. [Google Scholar] [CrossRef]
- Li, Y.; Feng, T.; Wang, Y. The role of bacterial signaling networks in antibiotics response and resistance regulation. Mar. Life Sci. Technol. 2022, 4, 1–16. [Google Scholar] [CrossRef]
- Römling, U.; Galperin, M.Y.; Gomelsky, M. Cyclic di-GMP: The First 25 Years of a Universal Bacterial Second Messenger. Microbiol. Mol. Biol. Rev. 2013, 77, 1–52. [Google Scholar] [CrossRef]
- Srivastava, D.; Waters, C.M. A Tangled Web: Regulatory Connections between Quorum Sensing and Cyclic Di-GMP. J. Bacteriol. 2012, 194, 4485–4493. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Yang, M.; Xiao, J.; Wu, H.; Wang, X.; Lv, Y.; Xu, L.; Zheng, H.; Wang, S.; Zhao, G.; et al. Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS ONE. 2009, 4, e7646. [Google Scholar] [CrossRef] [PubMed]
- Righetti, F.; Materne, S.L.; Boss, J.; Eichner, H.; Charpentier, E.; Loh, E. Characterization of a transcriptional TPP riboswitch in the human pathogen Neisseria meningitidis. RNA Biol. 2020, 17, 718–730. [Google Scholar] [CrossRef]
- Zhou, H.; Zheng, C.; Su, J.; Chen, B.; Fu, Y.; Xie, Y.; Tang, Q.; Chou, S.-H.; He, J. Characterization of a natural triple-tandem c-di-GMP riboswitch and application of the riboswitch-based dual-fluorescence reporter. Sci. Rep. 2016, 6, 20871. [Google Scholar] [CrossRef]
- Antoniani, D.; Bocci, P.; Maciąg, A.; Raffaelli, N.; Landini, P. Monitoring of diguanylate cyclase activity and of cyclic-di-GMP biosynthesis by whole-cell assays suitable for high-throughput screening of biofilm inhibitors. Appl. Microbiol. Biotechnol. 2010, 85, 1095–1104. [Google Scholar] [CrossRef] [PubMed]
- Eisenreich, W.; Dandekar, T.; Heesemann, J.; Goebel, W. Carbon metabolism of intracellular bacterial pathogens and possible links to virulence. Nat. Rev. Microbiol. 2010, 8, 401–412. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Liang, X.; Liu, K.; Dong, W.; Wang, J.; Zhou, M.-G. The thiG Gene Is Required for Full Virulence of Xanthomonas oryzae pv. oryzae by Preventing Cell Aggregation. PLoS ONE 2015, 10, e0134237. [Google Scholar] [CrossRef]
- Kim, H.J.; Lee, H.; Lee, Y.; Choi, I.; Ko, Y.; Lee, S.; Jang, S. The ThiL enzyme is a valid antibacterial target essential for both thiamine biosynthesis and salvage pathways in Pseudomonas aeruginosa. J. Biol. Chem. 2020, 295, 10081–10091. [Google Scholar] [CrossRef]
- Morimoto, Y.V.; Ito, M.; Hiraoka, K.D.; Che, Y.S.; Bai, F.; Kami-Ike, N.; Namba, K.; Minamino, T. Assembly and stoichiometry of FliF and FlhA in Salmonella flagellar basal body. Mol. Microbiol. 2014, 91, 1214–1226. [Google Scholar] [CrossRef]
- Van Gerven, N.; Waksman, G.; Remaut, H. Pili and flagella biology, structure, and biotechnological applications. Prog. Mol. Biol. Transl. Sci. 2011, 103, 21–72. [Google Scholar]
- Muhlenkamp, M.; Oberhettinger, P.; Leo, J.C.; Linke, D.; Schutz, M.S. Yersinia adhesin A (YadA)—Beauty & beast. Int. J. Med. Microbiol. 2015, 305, 252–258. [Google Scholar] [PubMed]
- Valentini, M.; Filloux, A. Multiple Roles of c-di-GMP Signaling in Bacterial Pathogenesis. Annu. Rev. Microbiol. 2019, 73, 387–406. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.-H.; Köseoğlu, V.K.; Güvener, Z.T.; Myers-Morales, T.; Reed, J.M.; D’Orazio, S.E.F.; Miller, K.W.; Gomelsky, M. Cyclic di-GMP-dependent Signaling Pathways in the Pathogenic Firmicute Listeria monocytogenes. PLOS Pathog. 2014, 10, e1004301. [Google Scholar] [CrossRef] [PubMed]
- Lamprokostopoulou, A.; Monteiro, C.; Rhen, M.; Romling, U. Cyclic di-GMP signalling controls virulence properties of Salmonella enterica serovar Typhimurium at the mucosal lining. Environ. Microbiol. 2010, 12, 40–53. [Google Scholar] [CrossRef] [PubMed]
- McKee, R.W.; Mangalea, M.R.; Purcell, E.B.; Borchardt, E.K.; Tamayo, R. The Second Messenger Cyclic Di-GMP Regulates Clostridium difficile Toxin Production by Controlling Expression of sigD. J. Bacteriol. 2013, 195, 5174–5185. [Google Scholar] [CrossRef]
- Borlee, B.R.; Goldman, A.D.; Murakami, K.; Samudrala, R.; Wozniak, D.J.; Parsek, M.R. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol. Microbiol. 2010, 75, 827–842. [Google Scholar] [CrossRef]
- Pitzer, J.E.; Sultan, S.Z.; Hayakawa, Y.; Hobbs, G.; Miller, M.R.; Motaleb, M.A. Analysis of the Borrelia burgdorferi cyclic-di-GMP-binding protein PlzA reveals a role in motility and virulence. Infect. Immun. 2011, 79, 1815–1825. [Google Scholar] [CrossRef]
- Milton, D.L.; O’Toole, R.; Horstedt, P.; Wolf-Watz, H. Flagellin A is essential for the virulence of Vibrio anguillarum. J. Bacteriol. 1996, 178, 1310–1319. [Google Scholar] [CrossRef]
- Sun, Z.; Deng, J.; Wu, H.; Wang, Q.; Zhang, Y. Selection of Stable Reference Genes for Real-Time Quantitative PCR Analysis in Edwardsiella tarda. J. Microbiol. Biotechnol. 2017, 27, 112–121. [Google Scholar] [CrossRef]
- Zhou, Z.-X.; Zhang, B.-C.; Sun, L. Poly(I:C) Induces Antiviral Immune Responses in Japanese Flounder (Paralichthys olivaceus) that Require TLR3 and MDA5 and is Negatively Regulated by Myd88. PLoS ONE 2014, 9, e112918. [Google Scholar] [CrossRef]
- Hu, Y.-H.; Chen, L.; Sun, L. CXCL8 of Scophthalmus maximus: Expression, biological activity and immunoregulatory effect. Dev. Comp. Immunol. 2011, 35, 1032–1039. [Google Scholar] [CrossRef] [PubMed]







| Primer | Sequence (5′-3′) | Source |
|---|---|---|
| TTF1 | ATCTCTAGACCCTATTGAACAACGCCAGC (XbaI) | This study |
| TTR1 | ATATGGCCGGTCAGAACGGGCTTGTCG | This study |
| TTF2 | TTCTGACCGGCCATATCGCATACGACGG | This study |
| TTR2 | GCTGTCGACGTACTCCAGCGTGAAGTCCA (SalI) | This study |
| MCS linker-F | TTAAGTTAATTAACCTGCAGGGATATCAGATCTTCTAGACATATGGGATCCGAATTCCCATGGGTCGACAAGCTTGCGGCCGCC | This study |
| MCS linker-R | TCGAGGCGGCCGCAAGCTTGTCGACCCATGGGAATTCGGATCCCATATGTCTAGAAGATCTGATATCCCTGCAGGTTAATTAAC | This study |
| TTcF | TCCTCTAGACAAACGTCTTTCTAATCACGCACG (XbaI) | This study |
| TTcR | CCGAAGCTTCTATTCGGCCTGCTCTGGCA (HindIII) | This study |
| RT-topA-F | GCTATGAGGTAGAAGAGG | [50] |
| RT-topA-R | CCCATATACTTGCCAAAG | [50] |
| RT-1687-F | GCTATCACAGACGCTCTC | This study |
| RT-1687-R | GGCAATCATTCAGGATCAG | This study |
| RT-2842-F | AGATAGGACAATGGCTCAA | This study |
| RT-2842-R | CTGCGTAAATAGGGTCAAC | This study |
| RT-1902-F | TATAGCGTCGGTAAGTTCAA | This study |
| RT-1902-R | TGATGGGTAAAGCGGTAG | This study |
| RT-3032-F | GAGTCTGGCTATCACCTT | This study |
| RT-3032-R | TTATTGGCGGCATTATCG | This study |
| RT-2923-F | GATGACCGACCAGCATAA | This study |
| RT-2923-R | GTTGGCGTTCTGATAGTTG | This study |
| RT-0315-F | ATGTGGTTGATGGATGGA | This study |
| RT-0315-R | GTATTGGTGGCGGTAATG | This study |
| RT-0818-F | CAGGATGGTGTGATGATTG | This study |
| RT-0818-R | ACTTCCGTTGGCTATCTC | This study |
| RT-3034-F | ACCTGAGTGTCTGGAGTA | This study |
| RT-3034-R | CAGCGGCATCTTATTGAG | This study |
| RT-1987-F | TACGACTACGACGCCTAT | This study |
| RT-1987-R | AATATCCGCAGCTCATACTT | This study |
| RT-2107-F | GTCTTTGCCAACCTTTCC | This study |
| RT-2107-R | GCCATATCGTCATCTACTCT | This study |
| RT-flhB-F | TAAGCAGGAGATTAAGGATGAG | This study |
| RT-flhB-R | TAGTGGGTCGGGTTAGTC | This study |
| RT-flhA-F | ATCCTGATGAACGGCTATAC | This study |
| RT-flhA-R | GATACCGATGGCGAAGTT | This study |
| RT-flhE-F | GACTACTCTGTCTGGCTAT | This study |
| RT-flhE-R | GGGCTCAATAGGGTTATCT | This study |
| RT-flgA-F | CGATGGCTTCAATGTCAG | This study |
| RT-flgA-R | CTAGAGAACCAGCGTCAG | This study |
| RT-flgB-F | CGCTTTCACTCACCTCAT | This study |
| RT-flgB-R | ATAACGCAGGCTGTTGTC | This study |
| RT-flhD-F | TTGTTATTAGCACAGCGATT | This study |
| RT-flhD-R | CTGGCATACTAACTGATTGG | This study |
| RT-fliC1-F | TACTGGCGTTGATACTACC | This study |
| RT-fliC1-R | CTGAATAACATAGGCGGAAG | This study |
| RT-fliC2-F | CTTCACCGCCAATATCAAC | This study |
| RT-fliC2-R | GAGTTAGAGCCGTTCTGT | This study |
| RT-fliA-F | GAAGGCGTGATTGACAAA | This study |
| RT-fliA-R | TGAATGGCATAGGTGGTAA | This study |
| RT-fliZ-F | GAGTATGTGGTGCGTCTG | This study |
| RT-fliZ-R | CGAACTGAAGATACTGCTGATA | This study |
| RT-fliD-F | ACCACCAAGAGCATCAAT | This study |
| RT-fliD-R | CTTACTATTACTCATGGCGTTAA | This study |
| RT-fliF-F | CAGCCGCAATGAGAATATC | This study |
| RT-fliF-R | ACGCACCAGATTGTTGAT | This study |
| RT-fliG-F | CTGGAGGATATTCTGGAGTC | This study |
| RT-fliG-R | CAGGATAGTGGCGATGAT | This study |
| RT-fliH-F | GGGTTTTCAACAGGGACT | This study |
| RT-fliH-R | GGCAATGACGCTATCAAG | This study |
| RT-fliI-F | CATTAACGCTCTGCTGAC | This study |
| RT-fliI-R | CGCCGAGGATATTCTCAA | This study |
| RT-fliJ-F | AGATGCTACTCAACTATCAAGA | This study |
| RT-fliJ-R | CCAGCGTCAGGATAAACT | This study |
| RT-fliK-F | CCGTTTGCCGATATTCTG | This study |
| RT-fliK-R | CCGTGCTGATTCTCTAGG | This study |
| RT-fliL-F | AACGACTATCTGCCTGAG | This study |
| RT-fliL-R | TGAACGCTGTGAACATAAC | This study |
| RT-fliM-F | CAGCCGCAATGAGAATATC | This study |
| RT-fliM-R | ACGCACCAGATTGTTGAT | This study |
| RT-fliN-F | GTCAGAATAACGGCGATAT | This study |
| RT-fliN-R | GGATGTCCAGGATCAGAT | This study |
| RT-fliO-F | AGGTGGATAACCAATGTCT | This study |
| RT-fliO-R | CAGGAGTTCTCTTTACTTCG | This study |
| 1902-OE-F | AGAAAAGAATTCAAAAGATCTAAAGAGGAGAAAGGATCTATGAAAAACCGTCAATTCATTTTACT | This study |
| 1902-OE-R | GCCTGGAGATCCTTACTCGAGTCAGTTAAATTCGTAGTTGACGCC | This study |
| 2842-OE-F | AGAAAAGAATTCAAAAGATCTAAAGAGGAGAAAGGATCTATGGATTCGCTGTCCATTCG | This study |
| 2842-OE-R | GCCTGGAGATCCTTACTCGAGCTAAAGCGTTTTTACACAATTCGC | This study |
| adrA-OE-F | AGAAAAGAATTCAAAAGATCTAAAGAGGAGAAAATGTTCCCAAAA | This study |
| adrA-OE-R | GCCTGGAGATCCTTACTCGAGTCAGGCCGCCACTTCGGT | This study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Wang, X.; Sun, B.; Sun, L. The Involvement of Thiamine Uptake in the Virulence of Edwardsiella piscicida. Pathogens 2022, 11, 464. https://doi.org/10.3390/pathogens11040464
Liu X, Wang X, Sun B, Sun L. The Involvement of Thiamine Uptake in the Virulence of Edwardsiella piscicida. Pathogens. 2022; 11(4):464. https://doi.org/10.3390/pathogens11040464
Chicago/Turabian StyleLiu, Xin, Xinhui Wang, Boguang Sun, and Li Sun. 2022. "The Involvement of Thiamine Uptake in the Virulence of Edwardsiella piscicida" Pathogens 11, no. 4: 464. https://doi.org/10.3390/pathogens11040464
APA StyleLiu, X., Wang, X., Sun, B., & Sun, L. (2022). The Involvement of Thiamine Uptake in the Virulence of Edwardsiella piscicida. Pathogens, 11(4), 464. https://doi.org/10.3390/pathogens11040464

