SARS-CoV-2 Infects Primary Neurons from Human ACE2 Expressing Mice and Upregulates Genes Involved in the Inflammatory and Necroptotic Pathways
Abstract
:1. Introduction
2. Results
2.1. SARS-CoV-2 Infection of Primary Mouse Cortical Neurons
2.2. Host Immune Responses in SARS-CoV-2-Infected Neurons and Mouse Brains
2.3. SARS-CoV-2 Infection Activates the ZBP1/MLKL Pathway in Neurons and Mouse Brains
3. Discussion
4. Materials and Methods
4.1. Neuronal Cultures and SARS-CoV-2 Infection
4.2. Animal Infection Experiments
4.3. Quantification of the Viral Titers
4.4. Immunostaining
4.5. Western Blot Analysis
4.6. ELISA
4.7. qRT-PCR
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rothan, H.A.; Byrareddy, S.N. The epidemiology and pathogenesis of coronavirus disease (COVID-19) outbreak. J. Autoimmun. 2020, 109, 102433. [Google Scholar] [CrossRef] [PubMed]
- Rothan, H.A.; Acharya, A.; Reid, S.P.; Kumar, M.; Byrareddy, S.N. Molecular Aspects of COVID-19 Differential Pathogenesis. Pathogens 2020, 9, 538. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Iyer, S.S. ASSURED-SQVM diagnostics for COVID-19: Addressing the why, when, where, who, what and how of testing. Expert Rev. Mol. Diagn. 2021, 21, 349–362. [Google Scholar] [CrossRef] [PubMed]
- Puelles, V.G.; Lutgehetmann, M.; Lindenmeyer, M.T.; Sperhake, J.P.; Wong, M.N.; Allweiss, L.; Chilla, S.; Heinemann, A.; Wanner, N.; Liu, S.; et al. Multiorgan and Renal Tropism of SARS-CoV-2. N. Engl. J. Med. 2020, 383, 590–592. [Google Scholar] [CrossRef]
- Baig, A.M.; Sanders, E.C. Potential neuroinvasive pathways of SARS-CoV-2: Deciphering the spectrum of neurological deficit seen in coronavirus disease-2019 (COVID-19). J. Med. Virol. 2020, 92, 1845–1857. [Google Scholar] [CrossRef]
- Cheng, Q.; Yang, Y.; Gao, J. Infectivity of human coronavirus in the brain. EBioMedicine 2020, 56, 102799. [Google Scholar] [CrossRef]
- Verstrepen, K.; Baisier, L.; De Cauwer, H. Neurological manifestations of COVID-19, SARS and MERS. Acta Neurol. Belg. 2020, 120, 1051–1060. [Google Scholar] [CrossRef]
- Parry, A.H.; Wani, A.H.; Yaseen, M. Neurological Dysfunction in Coronavirus Disease-19 (COVID-19). Acad. Radiol. 2020, 27, 1329–1330. [Google Scholar] [CrossRef]
- Nuzzo, D.; Picone, P. Potential neurological effects of severe COVID-19 infection. Neurosci. Res. 2020, 158, 1–5. [Google Scholar] [CrossRef]
- von Weyhern, C.H.; Kaufmann, I.; Neff, F.; Kremer, M. Early evidence of pronounced brain involvement in fatal COVID-19 outcomes. Lancet 2020, 395, e109. [Google Scholar] [CrossRef]
- Solomon, I.H.; Normandin, E.; Bhattacharyya, S.; Mukerji, S.S.; Keller, K.; Ali, A.S.; Adams, G.; Hornick, J.L.; Padera, R.F., Jr.; Sabeti, P. Neuropathological Features of COVID-19. N. Engl. J. Med. 2020, 383, 989–992. [Google Scholar] [CrossRef] [PubMed]
- Meinhardt, J.; Radke, J.; Dittmayer, C.; Franz, J.; Thomas, C.; Mothes, R.; Laue, M.; Schneider, J.; Brunink, S.; Greuel, S.; et al. Olfactory transmucosal SARS-CoV-2 invasion as a port of central nervous system entry in individuals with COVID-19. Nat. Neurosci. 2020, 24, 168–175. [Google Scholar] [CrossRef] [PubMed]
- Thepmankorn, P.; Bach, J.; Lasfar, A.; Zhao, X.; Souayah, S.; Chong, Z.Z.; Souayah, N. Cytokine storm induced by SARS-CoV-2 infection: The spectrum of its neurological manifestations. Cytokine 2021, 138, 155404. [Google Scholar] [CrossRef] [PubMed]
- Lavoie, J.L.; Cassell, M.D.; Gross, K.W.; Sigmund, C.D. Adjacent expression of renin and angiotensinogen in the rostral ventrolateral medulla using a dual-reporter transgenic model. Hypertension 2004, 43, 1116–1119. [Google Scholar] [CrossRef] [PubMed]
- Gowrisankar, Y.V.; Clark, M.A. Angiotensin II regulation of angiotensin-converting enzymes in spontaneously hypertensive rat primary astrocyte cultures. J. Neurochem. 2016, 138, 74–85. [Google Scholar] [CrossRef] [Green Version]
- Lukiw, W.J.; Pogue, A.; Hill, J.M. SARS-CoV-2 Infectivity and Neurological Targets in the Brain. Cell. Mol. Neurobiol. 2020, 42, 217–224. [Google Scholar] [CrossRef]
- Chen, R.; Wang, K.; Yu, J.; Howard, D.; French, L.; Chen, Z.; Wen, C.; Xu, Z. The Spatial and Cell-Type Distribution of SARS-CoV-2 Receptor ACE2 in the Human and Mouse Brains. Front. Neurol. 2020, 11, 573095. [Google Scholar] [CrossRef]
- Xu, J.; Lazartigues, E. Expression of ACE2 in Human Neurons Supports the Neuro-Invasive Potential of COVID-19 Virus. Cell. Mol. Neurobiol. 2020, 42, 305–309. [Google Scholar] [CrossRef]
- Song, E.; Zhang, C.; Israelow, B.; Lu-Culligan, A.; Prado, A.V.; Skriabine, S.; Lu, P.; Weizman, O.E.; Liu, F.; Dai, Y.; et al. Neuroinvasion of SARS-CoV-2 in human and mouse brain. J. Exp. Med. 2021, 218, e20202135. [Google Scholar] [CrossRef]
- Jacob, F.; Pather, S.R.; Huang, W.K.; Zhang, F.; Wong, S.Z.H.; Zhou, H.; Cubitt, B.; Fan, W.; Chen, C.Z.; Xu, M.; et al. Human Pluripotent Stem Cell-Derived Neural Cells and Brain Organoids Reveal SARS-CoV-2 Neurotropism Predominates in Choroid Plexus Epithelium. Cell Stem Cell 2020, 27, 937–950.e9. [Google Scholar] [CrossRef]
- Zhang, B.Z.; Chu, H.; Han, S.; Shuai, H.; Deng, J.; Hu, Y.F.; Gong, H.R.; Lee, A.C.; Zou, Z.; Yau, T.; et al. SARS-CoV-2 infects human neural progenitor cells and brain organoids. Cell Res. 2020, 30, 928–931. [Google Scholar] [CrossRef] [PubMed]
- Ramani, A.; Muller, L.; Ostermann, P.N.; Gabriel, E.; Abida-Islam, P.; Muller-Schiffmann, A.; Mariappan, A.; Goureau, O.; Gruell, H.; Walker, A.; et al. SARS-CoV-2 targets neurons of 3D human brain organoids. EMBO J. 2020, 39, e106230. [Google Scholar] [CrossRef] [PubMed]
- Ramani, A.; Pranty, A.I.; Gopalakrishnan, J. Neurotropic Effects of SARS-CoV-2 Modeled by the Human Brain Organoids. Stem Cell Rep. 2021, 16, 373–384. [Google Scholar] [CrossRef] [PubMed]
- Winkler, E.S.; Bailey, A.L.; Kafai, N.M.; Nair, S.; McCune, B.T.; Yu, J.; Fox, J.M.; Chen, R.E.; Earnest, J.T.; Keeler, S.P.; et al. SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function. Nat. Immunol. 2020, 21, 1327–1335. [Google Scholar] [CrossRef]
- Zheng, J.; Wong, L.R.; Li, K.; Verma, A.K.; Ortiz, M.; Wohlford-Lenane, C.; Leidinger, M.R.; Knudson, C.M.; Meyerholz, D.K.; McCray, P.B., Jr.; et al. COVID-19 treatments and pathogenesis including anosmia in K18-hACE2 mice. Nature 2020, 589, 603–607. [Google Scholar] [CrossRef]
- Moreau, G.B.; Burgess, S.L.; Sturek, J.M.; Donlan, A.N.; Petri, W.A.; Mann, B.J. Evaluation of K18-hACE2 Mice as a Model of SARS-CoV-2 Infection. Am. J. Trop. Med. Hyg. 2020, 103, 1215–1219. [Google Scholar] [CrossRef]
- Golden, J.W.; Cline, C.R.; Zeng, X.; Garrison, A.R.; Carey, B.D.; Mucker, E.M.; White, L.E.; Shamblin, J.D.; Brocato, R.L.; Liu, J.; et al. Human angiotensin-converting enzyme 2 transgenic mice infected with SARS-CoV-2 develop severe and fatal respiratory disease. JCI Insight 2020, 5, e142032. [Google Scholar] [CrossRef]
- Kumari, P.; Rothan, H.A.; Natekar, J.P.; Stone, S.; Pathak, H.; Strate, P.G.; Arora, K.; Brinton, M.A.; Kumar, M. Neuroinvasion and Encephalitis Following Intranasal Inoculation of SARS-CoV-2 in K18-hACE2 Mice. Viruses 2021, 13, 132. [Google Scholar] [CrossRef]
- Meessen-Pinard, M.; Le Coupanec, A.; Desforges, M.; Talbot, P.J. Pivotal Role of Receptor-Interacting Protein Kinase 1 and Mixed Lineage Kinase Domain-Like in Neuronal Cell Death Induced by the Human Neuroinvasive Coronavirus OC43. J. Virol. 2017, 91, e01513-16. [Google Scholar] [CrossRef] [Green Version]
- Mangalmurti, N.; Hunter, C.A. Cytokine Storms: Understanding COVID-19. Immunity 2020, 53, 19–25. [Google Scholar] [CrossRef]
- Blanco-Melo, D.; Nilsson-Payant, B.E.; Liu, W.C.; Uhl, S.; Hoagland, D.; Moller, R.; Jordan, T.X.; Oishi, K.; Panis, M.; Sachs, D.; et al. Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. Cell 2020, 181, 1036–1045.e9. [Google Scholar] [CrossRef] [PubMed]
- Mehta, P.; McAuley, D.F.; Brown, M.; Sanchez, E.; Tattersall, R.S.; Manson, J.J.; HLH Across Speciality Collaboration. COVID-19: Consider cytokine storm syndromes and immunosuppression. Lancet 2020, 395, 1033–1034. [Google Scholar] [CrossRef]
- Karki, R.; Sharma, B.R.; Tuladhar, S.; Williams, E.P.; Zalduondo, L.; Samir, P.; Zheng, M.; Sundaram, B.; Banoth, B.; Malireddi, R.K.S.; et al. Synergism of TNF-alpha and IFN-gamma Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-CoV-2 Infection and Cytokine Shock Syndromes. Cell 2021, 184, 149–168.e17. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Verma, S.; Nerurkar, V.R. Pro-inflammatory cytokines derived from West Nile virus (WNV)-infected SK-N-SH cells mediate neuroinflammatory markers and neuronal death. J. Neuroinflamm. 2010, 7, 73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, M.; Belcaid, M.; Nerurkar, V.R. Identification of host genes leading to West Nile virus encephalitis in mice brain using RNA-seq analysis. Sci. Rep. 2016, 6, 26350. [Google Scholar] [CrossRef] [PubMed]
- Brabers, N.A.; Nottet, H.S. Role of the pro-inflammatory cytokines TNF-alpha and IL-1beta in HIV-associated dementia. Eur. J. Clin. Investig. 2006, 36, 447–458. [Google Scholar] [CrossRef]
- Rothan, H.A.; Arora, K.; Natekar, J.P.; Strate, P.G.; Brinton, M.A.; Kumar, M. Z-DNA-Binding Protein 1 Is Critical for Controlling Virus Replication and Survival in West Nile Virus Encephalitis. Front. Microbiol. 2019, 10, 2089. [Google Scholar] [CrossRef]
- Balachandran, S.; Rall, G.F. Benefits and Perils of Necroptosis in Influenza Virus Infection. J. Virol. 2020, 94, e01101-19. [Google Scholar] [CrossRef] [Green Version]
- Shubina, M.; Tummers, B.; Boyd, D.F.; Zhang, T.; Yin, C.; Gautam, A.; Guo, X.J.; Rodriguez, D.A.; Kaiser, W.J.; Vogel, P.; et al. Necroptosis restricts influenza A virus as a stand-alone cell death mechanism. J. Exp. Med. 2020, 217, e20191259. [Google Scholar] [CrossRef]
- Tweedie, D.; Sambamurti, K.; Greig, N.H. TNF-alpha inhibition as a treatment strategy for neurodegenerative disorders: New drug candidates and targets. Curr. Alzheimer Res. 2007, 4, 378–385. [Google Scholar] [CrossRef]
- Nailwal, H.; Chan, F.K. Necroptosis in anti-viral inflammation. Cell Death Differ. 2019, 26, 4–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, J.; Amin, P.; Ofengeim, D. Necroptosis and RIPK1-mediated neuroinflammation in CNS diseases. Nat. Rev. Neurosci. 2019, 20, 19–33. [Google Scholar] [CrossRef]
- Pasparakis, M.; Vandenabeele, P. Necroptosis and its role in inflammation. Nature 2015, 517, 311–320. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.; Williams, E.P.; Malireddi, R.K.S.; Karki, R.; Banoth, B.; Burton, A.; Webby, R.; Channappanavar, R.; Jonsson, C.B.; Kanneganti, T.D. Impaired NLRP3 inflammasome activation/pyroptosis leads to robust inflammatory cell death via caspase-8/RIPK3 during coronavirus infection. J. Biol. Chem. 2020, 295, 14040–14052. [Google Scholar] [CrossRef] [PubMed]
- Azouz, F.; Arora, K.; Krause, K.; Nerurkar, V.R.; Kumar, M. Integrated MicroRNA and mRNA Profiling in Zika Virus-Infected Neurons. Viruses 2019, 11, 162. [Google Scholar] [CrossRef] [Green Version]
- Forest, K.H.; Alfulaij, N.; Arora, K.; Taketa, R.; Sherrin, T.; Todorovic, C.; Lawrence, J.L.M.; Yoshikawa, G.T.; Ng, H.L.; Hruby, V.J.; et al. Protection against beta-amyloid neurotoxicity by a non-toxic endogenous N-terminal beta-amyloid fragment and its active hexapeptide core sequence. J. Neurochem. 2018, 144, 201–217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rothan, H.A.; Stone, S.; Natekar, J.; Kumari, P.; Arora, K.; Kumar, M. The FDA-approved gold drug auranofin inhibits novel coronavirus (SARS-COV-2) replication and attenuates inflammation in human cells. Virology 2020, 547, 7–11. [Google Scholar] [CrossRef]
- Natekar, J.P.; Rothan, H.A.; Arora, K.; Strate, P.G.; Kumar, M. Cellular microRNA-155 Regulates Virus-Induced Inflammatory Response and Protects against Lethal West Nile Virus Infection. Viruses 2019, 12, 9. [Google Scholar] [CrossRef] [Green Version]
- Kumar, M.; Roe, K.; Orillo, B.; Muruve, D.A.; Nerurkar, V.R.; Gale, M., Jr.; Verma, S. Inflammasome adaptor protein Apoptosis-associated speck-like protein containing CARD (ASC) is critical for the immune response and survival in west Nile virus encephalitis. J. Virol. 2013, 87, 3655–3667. [Google Scholar] [CrossRef] [Green Version]
- Kumar, M.; Roe, K.; Nerurkar, P.V.; Orillo, B.; Thompson, K.S.; Verma, S.; Nerurkar, V.R. Reduced immune cell infiltration and increased pro-inflammatory mediators in the brain of Type 2 diabetic mouse model infected with West Nile virus. J. Neuroinflamm. 2014, 11, 80. [Google Scholar] [CrossRef] [Green Version]
- Stone, S.; Rothan, H.A.; Natekar, J.P.; Kumari, P.; Sharma, S.; Pathak, H.; Arora, K.; Auroni, T.T.; Kumar, M. SARS-CoV-2 variants of concern infect the respiratory tract and induce inflammatory response in wild-type laboratory mouse. Viruses 2022, 14, 27. [Google Scholar] [CrossRef]
Gene (Accession No.) | Primer Sequence (5′–3′) |
---|---|
IL-1β (NM_000576) | |
Forward | AGCACCTTCTTTCCCTTCATC |
Reverse | GGACCAGACATCACCAAGC |
IL-6 (NM_000600) | |
Forward | CCAGGAGCCCAGCTATGAAC |
Reverse | CCCAGGGAGAAGGCAACTG |
CCL3 (NM_011337) | |
Forward | ATTCCACGCCAATTCATC |
Reverse | ATTCAGTTCCAGGTCAGT |
IFN-α (NM_010502) | |
Forward | CTCTGTGCTTTCCTGATG |
Reverse | CTGAGGTTATGAGTCTGAG |
TNF-α (NM_013693) | |
Forward | CCAGTCTGTATCCTTCTAA |
Reverse | TCTTGTGTTTCTGAGTAGT |
CCL2 (NM_011333) | |
Forward | TCACCTGCTGCTACTCATTCACCA |
Reverse | TACAGCTTCTTTGGGACACCTGCT |
ISG-15 (NM_015783) | |
Forward | AGAGCCACTGTTGGTTAT |
Reverse | TTTCCTCGTTTACATTTCCA |
Caspase 1 (NM_009807) | |
Forward | GGAAGCAATTTATCAACTCAGTG |
Reverse | GCCTTGTCCATAGCAGTAATG |
Caspase 3 (NM_009810) | |
Forward | ATCCTGAAATGGGCATAT |
Reverse | CTTCCTTAGAAACACTATCC |
Caspase 7 (NM_007611) | |
Forward | GTGACACCCATAAAGGAT |
Reverse | ATGCCTGAATGAAGAAGA |
Caspase 8 (NM_009812) | |
Forward | CTAGTTCTCTCAGTTGTCTTT |
Reverse | GAGGTTTGCTACCGATTC |
ZBP1 (NM_021394) | |
Forward | GAAATAAGCACCTTCTGAG |
Reverse | GAATTGGCAATGGAGATC |
MLKL (NM_029005) | |
Forward | GGAACTTAGGCTATGGATA |
Reverse | CGGCAGTATTTCATCTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rothan, H.A.; Kumari, P.; Stone, S.; Natekar, J.P.; Arora, K.; Auroni, T.T.; Kumar, M. SARS-CoV-2 Infects Primary Neurons from Human ACE2 Expressing Mice and Upregulates Genes Involved in the Inflammatory and Necroptotic Pathways. Pathogens 2022, 11, 257. https://doi.org/10.3390/pathogens11020257
Rothan HA, Kumari P, Stone S, Natekar JP, Arora K, Auroni TT, Kumar M. SARS-CoV-2 Infects Primary Neurons from Human ACE2 Expressing Mice and Upregulates Genes Involved in the Inflammatory and Necroptotic Pathways. Pathogens. 2022; 11(2):257. https://doi.org/10.3390/pathogens11020257
Chicago/Turabian StyleRothan, Hussin A., Pratima Kumari, Shannon Stone, Janhavi P. Natekar, Komal Arora, Tabassum T. Auroni, and Mukesh Kumar. 2022. "SARS-CoV-2 Infects Primary Neurons from Human ACE2 Expressing Mice and Upregulates Genes Involved in the Inflammatory and Necroptotic Pathways" Pathogens 11, no. 2: 257. https://doi.org/10.3390/pathogens11020257