Next Article in Journal
Cefiderocol against Multi-Drug and Extensively Drug-Resistant Escherichia coli: An In Vitro Study in Poland
Previous Article in Journal
Acaricidal Activity of Tea Tree and Lemon Oil Nanoemulsions against Rhipicephalus annulatus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cross-Over Pathogenic Bacteria Detected in Infected Tomatoes (Solanum lycopersicum L.) and Peppers (Capsicum annuum L.) in Bulgaria

Department of General and Industrial Microbiology, Faculty of Biology, Sofia University, 1504 Sofia, Bulgaria
*
Author to whom correspondence should be addressed.
Pathogens 2022, 11(12), 1507; https://doi.org/10.3390/pathogens11121507
Submission received: 29 August 2022 / Revised: 2 December 2022 / Accepted: 7 December 2022 / Published: 9 December 2022
(This article belongs to the Section Bacterial Pathogens)

Abstract

The ability of certain human pathogens to adapt to plants without losing their virulence toward people is a major concern today. Thus, the aim of the present work was the investigation of the presence of cross-over pathogenic bacteria in infected tomato and pepper plants. The objects of the study were 21 samples from seven different parts of the plants and three from tomato rhizosphere. In total, 26 strains were isolated, identified by MALDI-TOF, and phenotypically characterized. The PCR amplification of the rpoB gene was applied as an approach for the rapid detection of cross-over pathogens in plant samples. A great bacterial diversity was revealed from tomato samples as nine species were identified (Leclercia adecarboxylata, Pseudesherichia vulneris, Enterobacter cancerogenus, Enterobacter cloacae, Enterobacter bugandensis, Acinetobacter calcoaceticus, Pantoea agglomerans, Pantoea ananatis, and Pectobacterium carotovorum). Polymicrobial contaminations were observed in samples T2 (tomato flower) and T10 (tomato fruit). Five species were identified from pepper samples (P. agglomerans, L. adecarboxylata, Pseudomonas sp., Pseudomonas putida, and Enterococcus sp.). Antibiotic resistance patterns were assigned in accordance with EFSA recommendations. All isolates showed varying resistance to the tested antibiotics. The genetic basis for the phenotypic antibiotic resistance was not revealed. No genes for the virulence factors were found among the population. To our knowledge, this is the first overall investigation of tomato and pepper cross-over pathogenic bacterial populations in Bulgaria.

1. Introduction

Microorganisms found on the surface and inside plant tissues form a complicated network known as the plant’s microbial community, which interacts with the host plant and the surrounding environment [1]. Many members of these communities are beneficial for plant physiology and development, while others are plant and human pathogens [2]. Human pathogens can actively interact with plants and potentially colonize them as alternate hosts rather than merely contaminating plant surfaces [3]. It has been reported that some human pathogenic bacteria can cause rot and blight diseases in plants [4]. Likewise, some phytopathogenic bacteria also have the potential to infect human beings [5]. The ability of some pathogenic bacteria (phyto- or human) to cause physiological and morphological changes in novel hosts (from different kingdom) has led to the emergence of cross-kingdom pathogenicity. This pathogenesis can occur either directly or indirectly. Human pathogens may be indirectly transmitted to plants through the environment or with the help of any carrier, according to some theories. Phytopathogens can be transmitted to humans directly or indirectly through the environment [2,4].
Members of the family Enterobacteriaceae can be isolated from a variety of host species, representatives of all biological kingdoms, and can adapt to a wide range of environmental conditions. Recently, fresh products have been considered as the most prominent carrier of foodborne pathogens as over 35 serious disease outbreaks, linked with that kind of food, have been reported [6]. Most outbreaks have been connected to leafy greens, sprouting seeds, herbs, fruits of tomatoes, cucumbers, and peppers [7]. A significant outbreak of Escherichia coli STEC (Shiga toxin—producing E. coli) linked to bagged baby spinach occurred in the USA and Canada in 2006, altering our understanding of bacteria associated with plant foods [8]. This outbreak, which resulted in 206 documented instances of illness with three fatalities, was caused by wildlife contaminating spinach fields [9] and the pathogen’s capacity to spread in watercourses [10]. In November 2006, the CDC (Centers for Disease Control and Prevention) reported that a Salmonella enterica serovar Typhimurium outbreak caused 183 cases in 21 states. Analyses of the data collected by the investigators indicated that the consumption of infected tomatoes was the cause of this infection [11]. Cucumbers have also been linked to a multistate Salmonella epidemic in 2015, which has led to an increase in outbreaks [12]. The CDC reported an epidemic of listeriosis in December 2021 after the consumption of mixed salad greens [13]. It can be summarized that among the most common causative agents of foodborne outbreaks in edible crops are pathogens with zoonotic origin such as Shigatoxigenic E. coli (STEC), S. enterica, and saprophytes such as Listeria monocytogenes, which represent >80% of reported cases [14].
The understanding that some human pathogens are well-adapted to inhabiting plant niches requires a fundamental change in our perception of their ecological range and should be taken into account when developing control measures [3]. In fact, this may not come as a surprise considering that many other bacteria, which operate as endophytes, epiphytes, and pathogens, can successfully inhabit plants. Thus, the study of the plant microbiome should be extensively conducted in order for more knowledge of microbial plant communities to be obtained and summarized. Such overall investigations have been reported for tomato (Solanum lycopersicum L.) and pepper (Capsicum annuum L.) plants. A metagenomic research, revealing the epiphytic microbial community of healthy tomato plants, grown in a field with a previous Salmonella outbreak, was conducted [15]. Similarly, the composition of the plant and human pathogenic bacterial population of green pepper has also been reported in Saudi Arabia. In that investigation, Proteus mirabilis and Klebsiella oxytoca were identified from the pepper samples [16]. Furthermore, a strikingly significant percentage of the genomes of the plant pathogenic Pectobacterium atrosepticum and the plant-associated enterobacteria Klebsiella pneumoniae are shared with the genomes of human pathogenic enterobacteria, according to many studies of these organisms [17,18,19].
Cross-kingdom jumps have been observed most frequently in numerous Enterobacteriaceae and Pseudomonadaceae members. Despite being largely known as plant disease agents, some species in the genera Pantoea, Burkholderia, Erwinia (Pectobacterium), Rhizobium, and Pseudomonas can cause animal diseases. For instance, K. pneumoniae (endophyte) and Pantoea agglomerans (plant pathogen) have both been linked to opportunistic infections in mammals including humans [3]. Dickeya dadantii and Pantoea ananatis are plant pathogens that cause diseases in pea aphids and humans, respectively [20]. Similarly, Salmonella, Enterobacter, and Shigella species, which are typically considered as animal pathogens, can also infect plant hosts [21,22,23].
However, the examples provided do not represent the entire species diversity of cross-over pathogens in plants. We suppose that a significantly greater number of microorganisms can jump between biological kingdoms. Thus, plants with symptoms of bacterial diseases are an ideal natural source for the study of cross-over pathogen bacteria. Thus, the aim of the present work was to investigate the existence of cross-over pathogens inhabiting infected tomato and pepper plants and to study their antibiotic resistance patterns. To our knowledge, this is the first overall investigation of a tomato and pepper cross-over pathogenic bacterial population in Bulgaria.

2. Materials and Methods

2.1. Sample Collection and Isolation of Bacterial Strains

The location of sampling was a private crop field in the village of Piperkov Chiflik, Kyustendil Municipality, Kyustendil Province (GPS coordinates according Google Earth 42°16′33″ N 22°44′18″ E), southwestern Bulgaria. In the field, various crops (tomatoes, peppers, fruit trees, potatoes, etc.) irrigated with purified and chlorinated water were grown. All tomato and pepper plants grown in the field showed symptoms of microbial diseases. All 24 samples were randomly collected (21 from the aboveground parts of different tomato and pepper plants and three from tomato rhizospheres). Among them, 12 samples were collected from tomatoes and nine samples from peppers (Figure 1). The probes were collected in sterile plastic bags and transferred to the laboratory where they were immediately subjected to analysis.
All samples with disease symptoms were washed with sterile dH2O and handled with an alcoholic solution of iodine (2%) to eliminate the epiphytic bacterial population. The areas containing disease symptoms were cut off with a sterile scalpel and homogenized. Each sample was then immersed in saline and left for 30 min at room temperature with strong vortex every 5 min. The rhizosphere samples were prepared by mixing 10 g soil with 90 mL sterile saline. Seed samples (T11, T12, and P9) were separated from the fruits (T10, T8, and P2, respectively), homogenized, and mixed with sterile dH2O to obtain the work solutions. To isolate the cross-over pathogens, decimal dilutions of each sample were prepared and 100 μL of each dilution was spread on the surface of three selective media: Endo agar (Oxoid™ Endo Agar, CM0479B, Thermo Fisher Scientific, Waltham, MA, USA), Slanetz and Bartley (SB) agar (HiMedia, M612), and Salmonella-Shigella (SS) agar (HiMedia, M108). Three replications of plating were carried out. The colonies were distinguished based on their morphology. Single colonies obtained from each morphological type were isolated on Nutrient agar plates and cultured for 24 h at 37 °C to obtain pure cultures. Pure cultures were subsequently stored on non-selective media (Nutrient Agar, Merck, Darmstadt, Germany) at 4 °C for further analysis.

2.2. Phenotypic Characterization of the Bacterial Isolates

Phenotypic characterization of the obtained pure cultures was carried out according to the procedures described by Traub et al. [24]. The isolates were studied for: Gram’s reaction, Ct (catalase), and Ox (oxidase) production, M (motility), I (indole) production, MR (methyl red test), VP (Voges–Proskauer reaction), H2S, ornithine decarboxylase, L-lysine decarboxylase, citrate, urease, and gelatinase production, and the fermentation of glucose, arabinose, inositol, and lactose.

2.3. Extraction of DNA from the Isolated Bacterial Strains

The bacterial strains, isolated from different parts of the tomato and pepper plants, were cultivated in nutrient broth overnight at 37 °C. The resulted liquid cultures were used for genomic DNA isolation using an E.Z.N.A. Bacterial DNA Kit according to the supplier’s protocol (Omega, Bio-Tek, Inc., Winooski, VT, USA). The isolated DNA was purified by the DNA purification Kit (PCR/DNA Clean-up, GeneMatrix, EURx Ltd., Gdansk, Poland). The quantity of purified DNA was measured by BioDrop µLITE+ (100 ng/µL ± 20 ng/µL).

2.4. Detection of Enterobacterial Strains by PCR

All isolates were examined using the PCR technique to determine what proportion of the isolated endophytic bacteria belonged to the Enterobacteriaceae family. Partial rpoB genes were amplified with primer pairs rpoB/F (5’CAGGTCGTCACGGTAACAAG3’) and rpoB/R (5’GTGGTTCAGTTTCAGCATGTAC3’). The PCR procedure was performed as described by Fazzeli et al. [25]. All PCR reactions were performed with a PCR thermal cycler (Techne® Prime, VWR International, Radnor, PE, USA) and the PCR products were visualized by 1.5% gel agarose electrophoresis. The following microorganisms were used as negative and positive controls to verify the discriminatory effect of the primers for Enterobacteriaceae: Xanthomonas vesicatoria NBIMCC 2427, Xanthomonas gardneri NBIMCC 8730, Xanthomonas euvesicatoria NBIMCC 8731, Clavibacter michiganensis subsp. michiganensis NBIMCC 2425, Pseudomonas syringae pv. syringae NBIMCC 2420, Sphingomonas paucimobilis NBIMCC 3733, Pseudomonas syringae pv. tomato NBIMCC 3374, Pseudomonas putida NBIMCC 1090, Pseudomonas fluorescens NBIMCC 8758, Pseudomonas syringae pv. tomato (isolate from infected tomato flower), Pantoea agglomerans (isolate from tomato rhizosphere soil), Curtobacterium flaccumfaciens (isolate from tomato stem), Curtobacterium flaccumfaciens (isolate from chili pepper leaf), Rhizobium larrymoorei (isolate from pepper fruit stem), Rhizobium larrymoorei (isolate from pepper leaf), Escherichia coli NBIMCC 8432, and Salmonella enterica NBIMCC 8691.

2.5. MALDI-TOF-MS

A matrix assisted laser desorption ionization-time of flight mass analysis (MALDI-TOF-MS) was performed for 26 pure cultures isolated from tomato and pepper plants. In brief, a single colony from an overnight culture was deposited on a polished steel MSP 96 target (Bruker Daltonics, Billerica, MA, USA) and overlaid with 1 μL of a saturated-cyano-4-hydroxycinnamic acid (HCCA) matrix solution (Bruker Daltonics). Unidentified strains were resubmitted using the extended protocol. Prior to the matrix, 1 μL of 70% formic acid was added to the bacterial spot and left dry out. Mass spectra were acquired using the microflex LT mass spectrometer (Bruker Daltonics) and analyzed with the research-use-only (RUO) software workflow and reference library MBT v. 4.1.100. All of the isolates were successfully identified with a score >1.7.

2.6. Search for Virulence Determinants

All isolates were screened for the presence of virulence determinants. The toxin gene (hlyA), secretion gene (invA), and invasion genes (eaeA, ipaH) were amplified using primer pairs and a protocol described by Chen et al. [26].

2.7. Screening for Antibiotic Resistant Phenotypes

Antibiotic resistance patterns of endophyte microbiota, isolated from diseased tomato and pepper plants, were assigned to EFSA-recommended antibiotics for foodborne enterobacterial pathogens [27]. Antibiotic susceptibility of the isolates to ten antibiotics: ampicillin/sulbactam (10 µg/10 µg/disc), neomycin (10 µg/disc), chloramphenicol (30 µg/disc), streptomycin (30 µg/disc), kanamycin (30 µg/disc), tetracycline (30 µg/disc), gentamicin (200 µg/disc), trimethoprim (5 µg/disc), sulfamethoxazole (23.75 µg/disc), and nalidixic acid (30 µg/disc) was investigated using the disc-diffusion method in accordance with the Clinical and Laboratory Standards Institute (CLSI) guidelines on Nutrient agar [28]. After a 24-h anaerobic incubation at 37 °C, inhibition-zone diameters were determined and used as an indication to distinguish between susceptible and resistant isolates.

2.8. Screening for Genes Encoding Antibiotic Resistance

Total DNAs were used as templates to detect the resistance genes. The genes encoding antibiotic resistance to gentamicin (aac6′-aph2″), chloramphenicol (cat), tetracycline (tetM), β-lactam ase (blaZ), streptomycin (aadA, aadE), and macrolide (mefA) were examined by PCR with specific primers. Primers used for the amplification of the indicated genes and PCR reactions were performed according to the protocol of Guo et al. [29] and Liu et al. [30]. The PCR products were separated in 1.5% agarose gel electrophoresis.

3. Results

3.1. Isolation of the Bacterial Strains

A total of 21 samples from different parts of infected tomato and pepper plants with symptoms of microbial diseases and three from the tomato rhizosphere were randomly collected. Twenty-six bacterial strains were obtained from 13 plant samples after cultivation on the selective media used (Table 1). However, no potential enterobacterial or enterococcal bacteria were isolated from the rest of the 11 samples: T1, T4, T7, P1, P4, P5, P6, P9, S1, S2, and S3.
The presumptive endophyte bacterial population, isolated on the selective media used, was found to be more numerous in the tomato samples than in the pepper ones. The average number of bacteria isolated from tomato samples on Endo agar was 2.2 × 103 CFU g−1 and 4.8 × 104 CFU g−1 on SS agar. No growth of the SB medium was observed from the tomato samples. The bacterial population was detected in the flower (T2), stems (T3, T5), leaf (T9), fruits (T6, T8, T10), and seeds (T11, T12), which represent 75% of all of the tested tomato samples. The average number of bacteria isolated from the pepper samples on Endo agar was 2.5 × 102 CFU g−1, 3.1 × 102 CFU g−1 on SS agar, and 1.3 × 102 CFU g−1 on the SB medium. Bacterial strains were isolated from the pepper fruit stems (P2, P8) and pepper leaves (P3, P7).
The colony morphology of the isolated bacterial strains (color, size, shape, and margins) was studied and 16 morphological types were differentiated. A single colony from each type was isolated to obtain pure cultures after three consecutive passages on the NB/NA medium. Some morphological variants were lost during purification, probably due to their inability to adapt to the laboratory environments or cultivation conditions. In the investigated bacterial population, colonies with homogeneous, granular, or mucoid structures were found. They had a convex, crater-shaped, or flat to teardrop-shaped profile, with a smooth or wavy (to rhizoid) margin, and a color varying in shades of cream, orange, and pink. Under the microscope, the majority (92.3%) of isolates were rod-shaped, and only 7.7% were spherical.
Cell sizes ranged from small to medium rods, with filaments observed in some cultures. According to the micro- and macromorphological characteristics, 18 strains were isolated from the tomato and eight strains from the pepper samples. The morphological diversity of strains from different plant parts varied significantly. The most morphological variants were obtained from the tomato flowers and fruits (five and four, respectively), whereas the tomato leaves had the least bacterial variability. In the pepper samples, five morphological variants were distinguished from the pepper fruit stem and two from the pepper leaves.

3.2. Phenotypic Characterization of Bacterial Isolates

A phenotypic characterization of 26 bacterial isolates was carried out. Approximately 92.3% (n  =  24) of the isolates were identified as Gram-negative and 7.7% (n  =  2) as Gram-positive. Next, 88.5% (n  =  23) were motility positive and 11.5% (n  =  3) were non-motile. In the studied population, 73.1% (n  = 19) did not have catalase activity, while 26.9% (n  = 7) were positive. Oxidase positive was 15.4% (n  = 4), while the remaining 84.6% (n  = 22) was negative. The ability to ferment glucose and arabinose was shown in 76.9% (n  = 20) and 69.2% (n  = 18) of the isolates, respectively. Nine isolates (34.6%) were variable in the inositol utilization. Only 11.5% (n  = 3) were fully fermented lactose, while the remaining 88.4% (n  = 23) were variable. Twenty isolates (76.9%) were urease-negative and 42.3% (n  = 11) were lysine-decarboxylase-positive. All strains (n  = 26) were capable of liquefying gelatin, and 73.1% (n  = 19) were citrate-positive (Table 2).
A crucial substrate for identifying Gram-negative bacteria is 2,6-butanediol, a substance that is produced during glucose fermentation from a precursor known as acetoin. The biochemical demonstration of acetoin is by the Voges–Proskauer (VP) reaction. A total of 53.8% (n  = 14) of isolates were VP-positive and 46% (n  = 12) were VP-negative. On the medium containing iron salts, none of the isolates produced H2S, indicating that they were unable to convert sulfate-containing substances to sulfides. This result indicates that there were no Salmonella strains among the endophytic isolates. Tryptophanase is an enzyme found in isolates that can convert tryptophan to indole. Indole was detected only in four bacteria, and methyl red was detected in six isolates. Ornithine decarboxylase was present in 23 isolates, which enables them to convert ornithine to putrescine.

3.3. Detection of Enterobacterial Strains by PCR

According to biochemical characterization, the majority of endophytic strains appear to be presumptive members of the Enterobacteriaceae family. The universal rpoB gene was amplified by PCR for family-level typing in order for rapid enterobacterial differentiation to be obtained. An amplification product with an expected length of 512 bp was generated by all Gram-negative isolates (n = 24) as opposed to the Gram-positive isolates (Figure 2). At this point of the study, all Gram-negative bacteria exhibited the Enterobacteriaceae PCR profile. However, the specificity of this primer set to identify members of the Enterobacteriaceae has not been widely validated in the plant microbial community [25]. Therefore, by using this combination of primers, we additionally amplified various phytopathogenic bacterial species (X. vesicatoria, X. gardneri, X. euvesicatoria, C. michiganensis subsp. michiganensis, C. flaccumfaciens, and S. paucimobilis) causing diseases on tomato and pepper plants. However, no specific amplification products were generated with the rpoB gene primers. Unexpectedly, species from different families including R. larrymoorei, P. putida, P. fluorescens, P. syringae pv. syringae, P. syringae pv. tomato produced an amplification product with an expected length of 512 bp.

3.4. Identification of Endophyte Isolates by MALDI-TOF-MS

The 26 endophytic bacterial strains were identified by the MALDI-TOF platform and the results are reported in Table 1. All of them belonged to 12 species from eight genera representing the following families: Enterobacteriaceae, Erwiniaceae, Pectobacteriaceae, Moraxellaceae, Pseudomonadaceae, and Enterococcaceae. The strains from Enterobacteriales order (73.1%) and Enterobacteriaceae family (42.3%) were prevalent. The species Leclercia adecarboxylata (23.1%, n = 6) and P. agglomerans (19.2%, n = 5) were dominant in the enterobacterial population. Strains of L. adecarboxylata were isolated from tomato flowers, tomato fruit, and pepper leaves. P. agglomerans representatives (n = 5) were discovered in the tomato plant fruit and seeds as well as pepper leaf. P. ananatis (n = 1) was isolated from tomato fruit. Five isolates of Enterobacter genus, belonging to the three species, Enterobacter cloacae (n = 2), Enterobacter cancerogenus (n = 2), and Enterobacter bugandensis (n = 1), were identified in the endophytic population. They were found in practically all tomato samples including flowers, fruits, leaves, and seeds, but not in pepper plants. The phytopathogenic bacterium Pectobacterium carotovorum was detected in sample T10.2 (tomato fruit). From the tomato stems, a strain belonging to the species Pseudesherichia vulneris was isolated. Pseudomonas putida and Pseudomonas sp., both members of the family Pseudomonadaceae, were found only in the pepper fruit stems. One strain belonging to the species Acinetobacter calcoaceticus (Moraxellaceae family) was isolated from the tomato flower (T 2.4.). The Gram-positive cocci (n = 2) were isolated from pepper fruit stems and identified as Enterococcus sp. Two isolates (T 2.5, and T 3.4) were not identified by the MALDI-TOF platform.

3.5. Searches for Virulence Determinants

We amplified certain genes involved in the virulence of some Enterobacteriaceae species such as E. coli, S. enterica, and Shigella flexneri, in order to establish their presence among our isolates. The toxin gene (hlyA), secretion gene (invA) and invasion genes (eaeA, ipaH) were amplified. None of the isolates generated a positive amplification product.

3.6. Screening for Antibiotic Resistant Phenotypes and Genotypes

Antibiotic resistance patterns of the isolated bacteria were studied according to the EFSA-recommended antibiotics for enterobacterial foodborne pathogens. Out of the 11 species cross-over pathogens isolated in this study, 81.8% isolates were found to be resistant or moderately susceptible (intermediate) to gentamycin, 72.7% to chloramphenicol, 63.6% to neomycin and kanamycin, 54.5% to streptomycin and trimethoprim, 45.5% to sulfamethoxazole, and 36.4% to ampicillin/sulbactam. The rate of tetracycline resistance was low, as 90% of the isolates were susceptible. The isolates were susceptible or intermediate to nalidixic acid. The strain E. bugandensis was resistant or intermediate to the action of eight out of the ten tested antibiotics, while strain A. calcoaceticus was the most sensitive to the antibiotics applied (Table 3).
Since the majority of the strains were resistant to some antimicrobial substances, primer pairs for genes aac (6′)-aph (2″), mefA, cat, aadA, aadE, blaZ, and tetM were used to amplify distinct resistant determinants. There were no positive amplifications for the genes evaluated in this investigation.

4. Discussion

The current investigation provides insight into the prevalence of the dominant members of endophytic bacterial communities in Solanum lycopersicum and Capsicum annuum capable of cross-jumping between hosts from different biological kingdoms. Cross-over pathogens have received a lot of attention recently as they have the potential to cause a significant number of foodborne illnesses, hospitalizations, and fatalities when contaminated fresh plant foods are consumed [31]. Vegetables have been considered as a major reservoir for opportunistic pathogens. In the case of endophytic existence in plant tissues, these bacteria cannot be removed by washing practices and thus they can pose a threat to human health. Moreover, evidence proving that cross-over pathogens have evolved to persist in plants as a normal part of their life cycle can be found in the literature [31].
In the present work, the identification of an endophytic population in diseased tomato and pepper plants revealed that 96% (n = 25) of isolated species were opportunistic pathogens (isolate T 10.2. is a typical phytopathogenic bacterium). The applied PCR approach for distinguishing the cross-over pathogens from phytopathogenic bacteria can be considered fairly reliable among the tested phytopathogenic species, causing diseases on tomatoes and peppers; only the representatives of the Pseudomonadaceae family generated the expected amplicon.
Shiga toxigenic E. coli, the different S. enterica serovars, and L. monocytogenes have been the most commonly described cross-pathogenic bacteria [5]. None of these microorganisms were found during our testing. In this study, two enterobacterial species, L. adecarboxylata and P. vulneris, which have not been previously described as cross-pathogens, were isolated from new hosts (infected tomato and pepper plants). Both species are opportunistic human pathogens phenotypically closely related to E. coli. Originally classified as Escherichia adecarboxylata and Escherichia vulneris within genus Escherichia, they were later divided into different genera of the Enterobacteriaceae family due to their genetic variability [32,33].
L. adecarboxylata is a widespread microbe found in aquatic habitats, soil, environmental sources, and animal specimens. It has been reported that some strains of the species, isolated from tomato rhizosphere, can have plant growth promoting activity [34]. To our knowledge, there are no data on the behavior of the bacterium in plant tissues during endophytic propagation. L. adecarboxylata can also be isolated from clinical specimens such as blood, urine, sputum, stool, and wound pus, and has been identified as an emerging opportunistic pathogen [35]. Endocarditis, urinary tract infections, pneumonia, catheter-related bacteremia, cellulitis, and bacterial peritonitis are examples where L. adecarboxylata is involved [36]. The bacterium was discovered in both healthy and immunocompromised individuals as part of polymicrobial infection, and less frequently of monomicrobial infection. The most frequent co-infecting organisms in polymicrobial infections with L. adecarboxylata clinical strains are Enterococcus species, Cutibacterium acnes, Fusarium species, Staphylococcus epidermidis, K. oxytoca, and Pseudomonas aeruginosa [36]. We found this dominant motile bacterium in the endophytic population in the flowers and fruits of tomatoes as well as in the leaves and stems of pepper. We also detected polymicrobial contamination in the studied plant samples. L. adecarboxylata coexisted with both Enterococcus and Pseudomonas in the pepper samples, successfully colonized tomato flowers along with several species of Enterobacter, and tomato fruits with the phytopathogens P. agglomerans, P. ananatis, and P. carotovorum. To our knowledge, this is the first report of L. adecarboxylata persisting in the aboveground parts of plants such as S. lycopersicum and C. annuum.
Most clinical isolates of L. adecarboxylata have been reported as susceptible to the most commonly applied antibiotics [37,38]. Beta-lactamase producing isolates and cephalosporin-resistant strains of L. adecarboxylata have been reported in only a few cases in human pathology [39]. In these rare cases, genetic determinants of resistance-encoding SHV-type beta-lactamases, bla, and intl1 genes were identified [40,41]. The unintentional consumption of infected food has recently been linked to an outbreak of carbapenem-resistant L. adecarboxylata [42].
These findings highlight the risk posed by foodborne cross-over pathogens. The first multidrug-resistant Leclercia species was isolated from an animal clinical case in India [43]. In our study, all L. adecarboxylata isolates showed resistance to streptomycin and gentamicin, moderate susceptibility to neomycin and kanamycin, and good susceptibility to ampicillin, tetracycline, chloramphenicol, sulfamethoxazole, and trimethoprim. The PCR did not identify resistance genes and virulence factors in wild strains of L. adecarboxylata. These results suggest a lower virulence of the wild-type L. adecarboxylata isolates compared to the clinical ones.
There have been few clinical reports of human infections with the opportunistic human pathogen P. vulneris [44,45,46]. The bacterium was first identified in humans in association with other bacteria including Staphylococcus epidermidis, Staphylococcus aureus, Enterobacter spp., Acinetobacter lwoffii, and Cedecea neteri [47]. It was later isolated from various clinical specimens such as feces, urine, sputum, vaginal swabs, and throat swabs, and was regarded as a colonizer [44]. In other research, P. vulneris was detected as a single pathogen in cases of osteomyelitis, urosepsis, intravenous catheter-mediated bacteremia, dialysis-related peritonitis, meningitis, and bacteremia in a patient with chronic lymphocytic leukemia [48,49,50]. In several of the clinical isolates, genes for LT enterotoxin and hemolysin (hlyA) were found, showing the diarrheal potential of P. vulneris [51]. Microbial contamination of food and water are the main causes of diarrhea and invasive sepsis-inducing infection [51]. Our tomato stem isolate of P. vulneris T 5.4 did not contain hemolysin genes, indicating that it is incapable of causing diarrhea.
It has been reported that the clinical isolates of P. vulneris are susceptible to all classes of antibiotics [44,49,50]. There has only been one clinical report of P. vulneris developing an extended spectrum of β-lactamase, but resistance to chloramphenicol, ampicillin, tetracycline, and/or first- and second-generation cephalosporins has occasionally been described [52,53]. Compared to clinical isolates, our tomato isolate P. vulneris had a different antibiotic resistance profile. It was resistant to gentamicin and neomycin, intermediate to streptomycin, kanamycin, chloramphenicol, sulfamethoxazole, and nalidixic acid, and susceptible to ampicillin/sulbactam, trimethoprim, and tetracycline.
Representatives of three genera of phytopathogenic bacteria were also found in our samples: Pectobacterium, Pantoea, and Enterobacter. These phytopathogens cause diseases on trees, flowers, fruits, and vegetables that lead to quantitative and qualitative losses of crop production. For example, P. carotovorum is known as a common causative agent of soft rot and stem rot in tomatoes [54,55]. However, various members of the two genera, Pantoea and Enterobacter, are known opportunistic pathogens in humans, but infections usually require an immunocompromised host. The cross-over representatives of P. agglomerans, P. ananatis, E. cancerogenus, E. cloacae, and E. bugandensis species were found in the endophytic population of diseased tomato and pepper plants.
P. ananatis has rarely been identified as a human pathogen, but it has been reported to cause bacteremia [56]. The pathogenic P. agglomerans was isolated from cases of endophthalmitis, choledocholithiasis, bacteremia, pneumonia, osteomyelitis, urinary tract infection, and septicemia [57,58,59,60,61,62,63]. Additionally, connections between P. agglomerans and contaminated intravenous fluids, blood products, propofol, total parenteral nutrition, and powdered infant formula have been documented in other reports [58,64]. Pneumonia caused by P. agglomerans might be a life-threatening illness in young patients with underlying comorbidities. Clinical isolates of P. agglomerans have been reported to be resistant to carbapenems, ciprofloxacin, and piperacillin [65]. Our isolates of P. agglomerans were resistant to gentamicin and neomycin, intermediate to streptomycin, ampicillin/sulbactam, and kanamycin, and susceptible to the rest of the tested antibiotics. No genes determining antimicrobial resistance were found in their genomes.
E. cancerogenus has rarely been associated with human infections, and only a few cases of acute or chronic illnesses have been reported: osteomyelitis [66,67], urinary tract infection, infection of a traumatic cranial wound [68], bacteremia and pneumonia [69], open wound infection [70], hand traumatic cut infection, and infected hematoma after surgical treatment [71]. Our isolates showed a pattern of antibiotic susceptibility that was similar to patterns previously reported [67]. The T2.1 and T2.6 isolates of E. cancerogenus were resistant to neomycin and gentamicin, intermediate to streptomycin, kanamycin, sulfamethoxazole, trimethoprim, and chloramphenicol, and susceptible to ampicillin/sulbactam, tetracycline, and nalidixic acid. Some authors have reported that their clinical isolates were resistant or moderately susceptible to penicillin antibiotics due to the presence of β-lactamase genes [69]. Since the utilization of ampicillin/sulbactam inhibits the production of beta-lactamase, we were unable to confirm whether or not our isolates produced it.
E. cloacae is a naturally occurring component of the human intestinal flora that can be found in human and animal feces, water, plants, insects, and food. It is considered that this bacterium causes infection in immunocompromised patients. However, E. cloacae is a member of the Enterobacter cloacae complex (ECC), which also comprises other common nosocomial pathogens that can cause a wide range of diseases [72]. For example, E. cloacae has been reported as the main causative agent of various outbreaks in hospitals and it is known to cause respiratory and urinary tract infections. The bacterium is responsible for up to 5% of all hospital-acquired sepsis and nosocomial pneumonia cases, 4% of nosocomial urinary tract infections, and 10% of postoperative peritonitis cases [73]. Due to its opportunistic nature and capacity for antibiotic resistance, it has emerged as a significant pathogen and a global hazard [74]. The pathogenesis of E. cloacae is multifactorial and complex, since it involves a few virulence factors whose function is still unknown [75]. E. cloacae’s pathogenicity is attributed to the production of various virulence factors such as enterotoxins (cytotoxin similar to Shiga-like toxin II after the attachment to the epithelial cells), effector proteins secreted through the type III secretion system (T3SS), and the ability to destroy phagocytes [76,77,78]. Clinical isolates of E. cloacae have been reported to be resistant to ampicillin, cephalosporins, amoxicillin, and cefoxitin [79]. Surprisingly, the natural isolates of E. cloacae reported in this paper were susceptible to all tested antibiotics and only displayed resistance to chloramphenicol. We did not detect specific genes, coding the virulence determinants studied in our analyses, which may be due to their species specificity.
Recently, E. bugandensis has been identified as an enterobacterial species associated with severe clinical infection. The strain, obtained from a blood sample of an infected neonate, was resistant to amoxicillin/clavulanic acid, ampicillin, piperacillin/sulbactam, piperacillin-tazobactam, cefuroxime, cefalotin, cefoxitin, cefuroxime-axetil, cefpodoxime, cefotaxime, gentamicin, ceftazidime, ciprofloxacin, norfloxacin, tobramycin, tetracycline and trimethoprim/sulfamethoxazol [80]. In some studies, E. bugandensis has been classified among the most harmful Enterobacter species currently known [81]. The discovery that all antibiotic resistance genes are encoded on a common transmissible plasmid serves as a reminder of how easily pathogenic bacteria can develop a MDR (multidrug resistance) phenotype, which can have disastrous effects during outbreaks [81]. Unfortunately, our isolate of E. bugandensis can also be categorized as a MDR strain due to its resistance or intermediate sensitivity to eight out of 10 of the tested antibiotics. The strain showed susceptibility only to streptomycin and nalidixic acid. However, this resistance is intrinsic as no genes responsible for it have been discovered.
Acinetobacter species are typically found in humid places including moist soil, lakes, water treatment facilities, fish farms, sewage, and even seawater [82]. Acinetobacter is represented by more than 50 species, but most of them are nonpathogenic, environmental organisms. Acinetobacter baumannii is the most frequent infection agent, followed by A. calcoaceticus and Acinetobacter lwoffii [83]. Some clinically relevant species such as A. calcoaceticus are a widespread component of the typical human microflora and have been found on vegetables, meat, and dairy products [84,85]. A. calcoaceticus has been considered as a common pathogen associated with a wide range of diseases including pneumonia, bacteremia, urinary tract infections, and burn wound infections [86]. Numerous clinical settings have documented A. calcoaceticus nosocomial infection outbreaks [87]. However, antimicrobial resistance is the main factor affecting clinical outcomes. Antibiotic resistance genes such as carbapenemases and extended-spectrum β-lactamases (ESBLs) are frequently reported among the environmental isolates of the species [82]. Thus, they may serve as crucial environmental reservoirs for the emergence of clinically relevant strains. The strain of A. calcoaceticus, characterized in our investigation, was isolated from tomato flower, which could be a prerequisite for its persistence in the mature fruit. The isolate was susceptible to most antibiotics tested, but resistant to trimethoprim and chloramphenicol. No genes responsible for this resistance were found in the genome of A. calcoaceticus. There are a few different reasons for the established phenotypic resistance. The few and relatively small porins in Acinetobacter’s outer membrane contribute to its broad resistance to antibiotics. Acinetobacter has a lower permeability to antibiotics compared to other Gram-negative bacteria due to the reduced outer membrane porin concentration [88]. Additionally, Acinetobacter has one or more active efflux systems (such as AdeABC and AdeIJK) expressed constitutively at low levels [89]. There are few therapeutic alternatives as a result of the interaction between constitutive efflux and low permeability to antimicrobials, which leads to intrinsic resistance to a wide range of antibiotics [90].
P. putida is a member of the Pseudomonas species fluorescent group, widely discovered in the environment and previously regarded to possess weak virulence [91]. P. putida can colonize humid, inanimate hospital surfaces, leading to nosocomial infections, particularly in patients with impaired immune systems and those who use catheters or other medical devices [92]. There are also reports of bloodstream infection outbreaks linked to contaminated fluids [93,94,95]. The P. putida strain isolated in this study from pepper fruit stem showed resistance to different classes of antibiotics (five out of 10 tested) and ranked second in antibiotic resistance after E. bugandensis.

5. Conclusions

Most strains isolated in the present study had the profile of opportunistic pathogens for humans. Some of them can participate in polymicrobial infections and show diverse phenotypic antibiotic resistance to major classes of antibiotics. Our results showed that some species were found in tomato seeds, flowers, and fruits (E. cloacae, P. agglomerans, and L. adecarboxylata), which could indicate their distribution pathway in plants. Thus, we can speculate that seeds can be considered as one possible source of this contamination.
In conclusion, the ability of certain cross-over pathogens to adapt to plants without losing their virulence toward people is a major concern today. Detailed reports on the endophytic bacterial community of vegetables and fruit, survival rate of pathogens in non-host environments, etc., must be determined to adequately implement actions for control of these outbreaks.

Author Contributions

Conceptualization, P.H. and Y.K.; Methodology, P.H., Y.K., G.G., D.D., M.D. and M.P.; Software, D.D.; Validation, P.H., Y.K. and D.D.; Formal analysis, G.G. and Y.K; Investigation, G.G., D.D., M.D. and M.P.; Resources, I.R.; Data curation, D.D.; Writing—original draft preparation, P.H.; Writing—review and editing, Y.K and D.D.; Visualization, Y.K., M.D., P.H. and G.G.; Supervision, P.H.; Project administration, P.H.; Funding acquisition, P.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Bulgarian Ministry of Education, Program “Healthy Foods for a Strong Bio-Economy and Quality of Life” approved by grant number DCM# 577/17.08.2018.

Institutional Review Board Statement

Not applicable for studies not involving humans or animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors wish to thank Julia Nikolaeva Dobreva for performing the language editing and the Faculty of Biology for the administrative and technical support. MALDI-TOF strain identification was performed at the National Reference Laboratory for Control and Monitoring of Antimicrobial Resistance, NCIPD (26 Yanko Sakazov blvd., 1504 Sofia), purchased with support from the European Regional Development Fund through the Operational Program Science and Education for Smart Growth 2014–2020; Grant BG05M2OP001-1.002-0001-C04 “Fundamental Translational and Clinical Research in Infection and Immunity”.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Brennan, F.P.; Alsanius, B.W.; Allende, A.; Burgess, C.M.; Moreira, H.; Johannessen, G.S.; Castro, P.M.L.; Uyttendaele, M.; Truchado, P.; Holden, N.J. Harnessing agricultural microbiomes for human pathogen control. ISME Commun. 2022, 2, 44. [Google Scholar] [CrossRef] [Scilit]
  2. Mendes, R.; Garbeva, P.; Raaijmakers, J.M. The rhizosphere microbiome: Significance of plant beneficial, plant pathogenic, and human pathogenic microorganisms. FEMS Microbiol. Rev. 2013, 37, 634–663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Holden, N.; Pritchard, L.; Toth, I. Colonization out with the colon: Plants as an alternative environmental reservoir for human pathogenic enterobacteria. FEMS Microbiol. Rev. 2009, 33, 689–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Mahmud, S.; Rehman, Y.; Hasnain, S. Cross-kingdom pathogenicity across plants and human beings. J. Bacteriol. Parasitol. 2015, 6, e124. [Google Scholar]
  5. Kirzinger, M.W.; Nadarasah, G.; Stavrinides, J. Insights into cross-kingdom plant pathogenic bacteria. Genes 2011, 2, 980–997. [Google Scholar] [CrossRef] [Scilit]
  6. Brandl, M.T. Plant lesions promote the rapid multiplication of Escherichia coli O157:H7 on postharvest lettuce. Appl. Environ. Microbiol. 2008, 74, 5285–5289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Schulz, B.; Boyle, C. The endophytic continuum. Mycol. Res. 2005, 109, 661–686. [Google Scholar] [CrossRef] [Scilit]
  8. CDC. Ongoing Multistate Outbreak of Escherichia coli serotype O157:H7 Infections associated with consumption of fresh spinach—United States. JAMA Intern. Med. 2006, 296, 2195–2196. [Google Scholar]
  9. Jay, M.T.; Cooley, M.; Carychao, D.; Wiscomb, G.W.; Sweitzer, R.A.; Crawford-Miksza, L.; Farrar, J.A.; Lau, D.K.; O’Connell, J.; Millington, A.; et al. Escherichia coli O157: H7 in feral swine near spinach fields and cattle, central California coast. Emerg. Infect. Dis. 2007, 13, 1908–1911. [Google Scholar] [CrossRef] [Scilit]
  10. Cooley, M.; Carychao, D.; Crawford-Miksza, L.; Jay, M.T.; Myers, C.; Rose, C.; Keys, C.; Farrar, J.; Mandrell, R.E. Incidence and tracking of Escherichia coli O157: H7 in a major produce production region in California. PLoS ONE 2007, 2, e1159. [Google Scholar] [CrossRef] [Scilit]
  11. CDC. Multistate Outbreak of Salmonella Typhimurium Infections Linked to Tomatoes 2006. Available online: https://www.cdc.gov/salmonella/2006/tomatoes-11-2006.html (accessed on 3 November 2006).
  12. CDC. Multistate Outbreak of Salmonella Poona Infections Linked to Imported Cucumbers 2015. Available online: https://www.cdc.gov/salmonella/poona-09-15/index.html (accessed on 9 November 2015).
  13. CDC. Listeria Outbreak Linked to Packaged Salads Produced by Fresh Express 2022. Available online: https://www.fda.gov/food/outbreaks-foodborne-illness/outbreak-investigation-listeria-monocytogenes-fresh-express-packaged-salad-december-2021 (accessed on 8 March 2022).
  14. Dewey-Mattia, D.; Manikonda, K.; Hall, A.J.; Wise, M.E.; Crowe, S.J. Surveillance for foodborne disease outbreaks -United States, 2009–2015. MMWR Surveill. Summ. 2018, 67, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Ottesen, A.R.; Peña, A.G.; White, J.R.; Pettengill, J.B.; Li, C.; Allard, S.; Rideout, S.; Allard, M.; Hill, T.; Evans, P.; et al. Baseline survey of the anatomical microbial ecology of an important food plant: Solanum lycopersicum (tomato). BMC Microbiol. 2013, 13, 114. [Google Scholar] [CrossRef] [Scilit]
  16. Al-Mijalli, S.H.S. Isolation and characterization of plant and human pathogenic bacteria from green pepper (Capsicum annum L.) in Riyadh, Saudi Arabia. 3 Biotech 2014, 4, 337–344. [Google Scholar] [CrossRef] [Scilit]
  17. Bell, K.S.; Sebaihia, M.; Pritchard, L.; Holden, M.T.; Hyman, L.J.; Holeva, M.C.; Thomson, N.R.; Bentley, S.D.; Churcher, L.J.; Mungall, K.; et al. Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc. Natl. Acad. Sci. USA 2004, 101, 11105–11110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Toth, I.K.; Pritchard, L.; Birch, P.R. Comparative genomics reveals what makes an enterobacterial plant pathogen. Annu. Rev. Phytopathol. 2006, 44, 305–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Fouts, D.E.; Tyler, H.L.; DeBoy, R.T.; Daugherty, S.; Ren, Q.; Badger, J.H.; Durkin, A.S.; Huot, H.; Shrivastava, S.; Kothari, S.; et al. Complete genome sequence of the N2-fixing broad host range endophyte Klebsiella pneumoniae 342 and virulence predictions verified in mice. PLoS Genet. 2008, 4, e1000141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Grenier, A.M.; Duport, G.; Pages, S.; Condemine, G.; Rahbe, Y. The phytopathogen Dickeya dadantii (Erwinia chrysanthemi 3937) is a pathogen of the pea aphid. Appl. Environ. Microbiol. 2006, 72, 1956–1965. [Google Scholar] [CrossRef] [Scilit]
  21. Schikora, A.; Carreri, A.; Charpentier, E.; Hirt, H. The dark side of the salad: Salmonella typhimurium the innate immune response of Arabidopsis thaliana and shows an endopathogenic lifestyle. PLoS ONE 2008, 3, e2279. [Google Scholar] [CrossRef] [Scilit]
  22. Barak, J.D.; Kramer, L.C.; Hao, L.Y. Colonization of tomato plants by Salmonella enterica is cultivar dependent, and type 1 trichomes are preferred colonization sites. Appl. Environ. Microbiol. 2011, 77, 498–504. [Google Scholar] [CrossRef] [Scilit]
  23. Jo, S.H.; Lee, J.; Park, E.; Kim, D.W.; Lee, D.H.; Ryu, C.M.; Choi, D.; Park, J.M. A human pathogenic bacterium Shigella proliferates in plants through adoption of type III effectors for shigellosis. Plant Cell Environ. 2019, 42, 2962–2978. [Google Scholar] [CrossRef] [Scilit]
  24. Traub, W.H.; Raymond, E.A.; Linehan, J. Identification of Enterobacteriaceae in the clinical microbiology laboratory. Appl. Microbiol. 1970, 20, 303–308. [Google Scholar] [CrossRef] [PubMed]
  25. Fazzeli, H.; Arabestani, M.R.; Esfahani, B.N.; Khorvash, F.; Pourshafie, M.R.; Moghim, S.; Safaei, H.G.; Faghri, J.; Narimani, T. Development of PCR-based method for detection of Enterobacteriaceae in septicemia. J. Res. Med. Sci. 2012, 17, 671–675. [Google Scholar] [PubMed]
  26. Chen, J.; Tang, J.N.; Liu, J.; Cai, Z.; Bai, X. Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J. Appl. Microbiol. 2012, 112, 823–830. [Google Scholar] [CrossRef] [Scilit]
  27. EFSA. Panel on Additives and Products or Substances used in Animal Feed (FEEDAP); Scientific Opinion on Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J. 2012, 10, 2740. [Google Scholar] [CrossRef] [Scilit]
  28. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th ed.; CLSI Standard MO2; Clinical and Laboratory Standarts Institute: Wayne, PA, USA, 2018. [Google Scholar]
  29. Guo, H.; Pan, L.; Li, L.; Lu, J.; Kwok, L.; Menghe, B.; Zhang, H.; Zhang, W. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products. J. Food Sci. 2017, 82, 724–730. [Google Scholar] [CrossRef] [Scilit]
  30. Liu, C.; Zhang, Z.; Dong, K.; Yuan, J.; Guo, X. Antibiotic resistance of probiotic strains of lactic acid bacteria isolated from marketed foods and drugs. BES Biomed. Environ. Sci. 2009, 22, 401–412. [Google Scholar] [CrossRef] [Scilit]
  31. Teplitski, M.; Barak, J.D.; Schneider, K.P. Human enteric pathogens in produce: Un-answered ecological questions with direct implications for food safety. Curr. Opin. Biotechnol. 2009, 20, 166–171. [Google Scholar] [CrossRef] [Scilit]
  32. Izard, D.; Mergaert, J.; Gavini, F.; Beji, A.; Kersters, K.; De Ley, J.; Leclerc, H. Separation of Escherichia adecarboxylata from the Erwinia herbicolaEnterobacter agglomerans complex and from the other Enterobacteriaceae by nucleic acid and protein electrophoretic techniques. Ann. Inst. Pasteur Microbiol. 1985, 136, 151–168. [Google Scholar] [CrossRef] [Scilit]
  33. Alnajar, S.; Gupta, R.S. Phylogenomics and comparative genomic studies delineate six main clades within the family Enterobacteriaceae and support the reclassification of several polyphyletic members of the family. Infect. Genet. Evol. 2017, 54, 108–127. [Google Scholar] [CrossRef] [Scilit]
  34. Kang, S.-M.; Shahzad, R.; Khan, M.A.; Hasnain, Z.; Lee, K.-E.; Park, H.-S.; Kim, L.-R.; Lee, I.-J. Ameliorative effect of indole-3-acetic acid and siderophore producing Leclercia adecarboxylata MO1 on cucumber plants under zinc stress. J. Plant. Interact. 2021, 16, 30–41. [Google Scholar] [CrossRef] [Scilit]
  35. Broderick, A.; Lowe, E.; Xiao, A.; Ross, R.; Miller, R. Leclercia adecarboxylata folliculitis in a healthy swimmer—An emerging aquatic pathogen? JAAD Case Rep. 2019, 5, 706–708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Zayet, S.; Lang, S.; Garnier, P.; Pierron, A.; Plantin, J.; Toko, L.; Royer, P.-Y.; Villemain, M.; Klopfenstein, T.; Gendrin, V. Leclercia adecarboxylata as emerging pathogen in human infections: Clinical features and antimicrobial susceptibility testing. Pathogens 2021, 10, 1399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Spiegelhauer, M.R.; Andersen, P.F.; Frandsen, T.H.; Nordestgaard, R.L.M.; Andersen, L.P. Leclercia adecarboxylata: A case report and literature review of 74 cases demonstrating its pathogenicity in immunocompromised patients. Infect. Dis. 2018, 51, 179–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Gajdács, M.; Ábrók, M.; Lázár, A.; Terhes, G.; Burián, K. Leclercia adecarboxylata as an emerging pathogen in human infections: A 13-year retrospective analysis in Southern Hungary. J. Infect. Dev. Ctries. 2020, 14, 1004–1010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Sng, E.C.Y.; Goh, K.C.M.; Tan, S.H.; Tan, A.L.; Oh, H.M.L. Leclercia adecarboxylata bacteraemia: Clinical features and antibiotic susceptibilities in 2 hospitals in Singapore. Ann. Acad. Med. Singap. 2021, 50, 643–645. [Google Scholar] [CrossRef] [Scilit]
  40. Mazzariol, A.; Zuliani, J.; Fontana, R.; Cornaglia, G. Isolation from Blood Culture of a Leclercia adecarboxylata strain producing an SHV-12 extended-spectrum beta-lactamase. J. Clin. Microbiol. 2003, 41, 1738–1739. [Google Scholar] [CrossRef] [Scilit]
  41. Shin, G.-W.; You, M.-J.; Lee, H.-S.; Lee, C.-S. Catheter-related bacteremia caused by multidrug-resistant Leclercia adecarboxylata in a patient with breast cancer. J. Clin. Microbiol. 2012, 50, 3129–3132. [Google Scholar] [CrossRef] [Scilit]
  42. Garza-González, E.; Bocanegra-Ibarias, P.; Rodríguez-Noriega, E.; González-Díaz, E.; Silva-Sanchez, J.; Garza-Ramos, U.; Contreras-Coronado-Tovar, I.F.; Santos-Hernández, J.E.; Gutiérrez-Bañuelos, D.; Mena-Ramirez, J.P.; et al. Molecular investigation of an outbreak associated with total parenteral nutrition contaminated with NDM-producing Leclercia adecarboxylata. BMC Infect. Dis. 2021, 21, 235. [Google Scholar] [CrossRef] [Scilit]
  43. Choudhary, M.; Choudhary, B.K.; Bhoyar, S.; Kale, S.B.; Chaudhari, S.P.; Bera, B.C.; Jain, A.; Barbuddhe, S.B. Isolation and characterization of multidrug-resistant Leclercia species from animal clinical case. Lett. Appl. Microbiol. 2018, 66, 44–48. [Google Scholar] [CrossRef] [Scilit]
  44. Brenner, D.J.; McWhorter, A.C.; Knutson, J.K.; Steigerwalt, A.G. Escherichia vulneris: A new species of Enterobacteriaceae associated with human wounds. J. Clin. Microbiol. 1982, 15, 1133–1140. [Google Scholar] [CrossRef] [Scilit]
  45. Pien, F.D.; Shrum, S.; Swenson, J.M.; Hill, B.C.; Thornsberry, C.; Farmer, J.J., III. Colonization of human wounds by Escherichia vulneris and Escherichia hermannii. J. Clin. Microbiol. 1985, 22, 283–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Horii, T.; Suzuki, Y.; Kimura, T.; Kanno, T.; Maekawa, M. Intravenous catheter-related septic shock caused by Staphylococcus sciuri and Escherichia vulneris. Scand. J. Infect. Dis. 2001, 33, 930–932. [Google Scholar] [PubMed]
  47. Anon, M.T.; Ruiz-Velasco, L.M.; Borrajo, E.; Giner, C.; Sendino, M.; Canton, R. Escherichia vulneris infection. Report of 2 cases. Enferm. Infecc. Microbiol. Clin. 1993, 11, 559–561. [Google Scholar] [PubMed]
  48. Arslan, U.; Cosar, M.; Tuncer, I.; Findik, D. Escherichia vulneris peritonitis in a patient on CAPD. Perit. Dial. Int. 2008, 28, 681–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Awsare, S.V.; Lillo, M. A case report of Escherichia vulneris urosepsis. Rev. Infect. Dis. 1991, 13, 1247–1248. [Google Scholar] [CrossRef] [Scilit]
  50. Senanayake, S.N.; Jadeer, A.; Talaulikar, G.S.; Roy, J. First reported case of dialysis-related peritonitis due to Escherichia vulneris. J. Clin. Microbiol. 2006, 44, 4283–4284. [Google Scholar] [CrossRef] [Scilit]
  51. Jain, S.; Nagarjuna, D.; Gaind, R.; Chopra, S.; Debata, P.K.; Dawar, R.; Sardana, R.; Yadav, M. Escherichia vulneris: An unusual cause of complicated diarrhoea and sepsis in an infant. A case report and review of literature. New Microbes New Infect. 2016, 13, 83–86. [Google Scholar] [CrossRef] [Scilit]
  52. Mohanty, S.; Chandra, S.P.; Dhawan, B.; Kapil, A.; Das, B.K. Meningitis due to Escherichia vulneris. Neurol. India 2005, 53, 122–123. [Google Scholar] [CrossRef] [Scilit]
  53. Chaudhury, A.; Nath, G.; Tikoo, A.; Sanyal, S.C. Enteropathogenicity and antimicrobial susceptibility of new Escherichia spp. J. Diarrhoeal Dis. Res. 1999, 17, 85–87. [Google Scholar]
  54. Lim, J.A.; Jee, S.; Lee, D.H.; Roh, E.; Jung, K.; Oh, C.; Heu, S. Biocontrol of Pectobacterium carotovorum subsp. carotovorum using bacteriophage PP1. J. Microbiol. Biotechnol. 2013, 23, 1147–1153. [Google Scholar] [CrossRef] [Scilit]
  55. Caruso, A.; Licciardello, G.; La Rosa, R.; Catara, V.; Bella, P. Mixed infection of Pectobacterium carotovorum subsp. carotovorum and P. carotovorum subsp. brasiliensis in tomato stem rot in Italy. J. Plant Pathol. 2016, 98, 661–665. [Google Scholar]
  56. De Baere, T.; Verhelst, R.; Labit, C.; Verschraegen, G.; Wauters, G.; Claeys, G.; Vaneechoutte, M. Bacteremic infection with Pantoea ananatis. J. Clin. Microbiol. 2004, 42, 4393–4395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Cheng, A.; Liu, C.; Tsai, H.Y.; Hsu, M.; Yang, I.; Huang, Y.; Liao, C.; Hsueh, P. Bacteremia caused by Pantoea agglomerans at a medical center in Taiwan, 2000–2010. J. Microbiol. Immunol. Infect. 2013, 46, 187–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Cruz, A.T.; Cazacu, A.C.; Allen, C.H. Pantoea agglomerans, as a plant pathogen causing human disease. J. Clin. Microbiol. 2007, 45, 1989–1992. [Google Scholar] [CrossRef] [Scilit]
  59. Rave, O.; Assous, M.V.; Hashkes, P.J.; Lebel, E.; Hadas-Halpern, I.; Megged, O. Pantoea agglomerans foreign body-induced septic arthritis. Pediatr. Infect. Dis. J. 2012, 31, 1311–1312. [Google Scholar] [CrossRef] [Scilit]
  60. Sastre, A.; González-Arregoces, J.E.; Romainoik, I.; Mariño, S.; Lucas, C.; Monfá, E.; Stefan, G.; León, B.; Prieto, M. Peritonitis caused by Pantoea agglomerans in peritoneal dialysis. Nefrologia 2016, 37, 108–109. [Google Scholar] [CrossRef] [Scilit]
  61. Shubov, A.; Jagannathan, P.; Chin-Hong, P.V. Pantoea agglomerans pneumonia in a heart-lung transplant recipient: Case report and a review of an emerging pathogen in immunocompromised host. Transpl. Infect. Dis. 2011, 13, 536–539. [Google Scholar] [CrossRef] [Scilit]
  62. Kazancioglu, R.; Buyukaydin, B.; Iraz, M.; Alay, M.; Erkos, R. An unusual cause of peritonitis in peritoneal dialysis patients: Pantoea agglomerans. J. Infect. Dev. Ctries. 2014, 8, 919–922. [Google Scholar] [CrossRef] [Scilit]
  63. Labianca, L.; Montanaro, A.; Turturro, F.; Calderaro, C.; Ferretti, A. Osteomyelitis caused by Pantoea agglomerans in a closed fracture in a child. Orthopedics 2013, 36, e252–e256. [Google Scholar] [CrossRef] [Scilit]
  64. Mardaneh, J.; Dallal, M.M. Isolation, identification and antimicrobial susceptibility of Pantoea (Enterobacter) agglomerans isolated from consumed powdered infant formula milk (PIF) in NICU ward: First report from Iran. Iran. J. Microbiol. 2013, 5, 263–267. [Google Scholar]
  65. Büyükcam, A.; Tuncer, Ö.; Gür, D.; Sancak, B.; Ceyhan, M.; Cengiz, A.B.; Kara, A. Clinical and microbiological characteristics of Pantoea agglomerans infection in children. J. Infect. 2018, 11, 304–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Westblom, T.U.; Coggins, M.E. Osteomyelitis caused by Enterobacter taylorae, formerly enteric group 19. J. Clin. Microbiol. 1987, 25, 2432–2433. [Google Scholar] [CrossRef] [Scilit]
  67. Garazzino, S.; Aprato, A.; Maiello, A.; Massé, A.; Biasibetti, A.; De Rosa, F.G.; Di Perri, G. Osteomyelitis caused by Enterobacter cancerogenus infection following a traumatic injury: Case report and review of the literature. J. Clin. Microbiol. 2005, 43, 1459–1461. [Google Scholar] [CrossRef] [Scilit]
  68. Reina, J.; Salva, F.; Gil, J.; Alomar, P. Urinary tract infection caused by Enterobacter taylorae. J. Clin. Microbiol. 1989, 27, 2877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Rubinstien, E.M.; Klevjer-Anderson, P.; Smith, C.A.; Drouin, M.T.; Patterson, J.E. Enterobacter taylorae, a new opportunistic pathogen: Report of four cases. J. Clin. Microbiol. 1993, 31, 249–254. [Google Scholar] [CrossRef] [Scilit]
  70. Martinez, J.; Toval, M.; Colomo, L.F. 3 new cases of Enterobacter taylorae infection. Enferm. Infecc. Microbiol. Clin. 1994, 12, 289–292. [Google Scholar] [PubMed]
  71. Abbott, S.L.; Janda, J.M. Enterobacter cancerogenus (“Enterobacter taylorae”) infections associated with severe trauma or crush injuries. Am. J. Clin. Pathol. 1997, 107, 359–361. [Google Scholar] [CrossRef] [Scilit]
  72. Annavajhala, M.K.; Gomez-Simmonds, A.; Uhlemann, A.C. Multidrug-Resistant Enterobacter cloacae Complex Emerging as a Global, Diversifying Threat. Front. Microbiol. 2019, 10, 44. [Google Scholar] [CrossRef] [Scilit]
  73. Hoffmann, H.; Roggenkamp, A. Population genetics of the nomenspecies Enterobacter cloacae. Appl. Environ. Microbiol. 2003, 69, 5306–5318. [Google Scholar] [CrossRef] [Scilit]
  74. Dey, S.; Shahrear, S.; Afroj Zinnia, M.; Tajwar, A.; Islam, A.B.M.M.K. Functional annotation of hypothetical proteins from the Enterobacter cloacae B13 Strain and Its association with pathogenicity. Bioinform. Biol. Insights 2022, 16, 11779322221115535. [Google Scholar] [CrossRef] [Scilit]
  75. Mezzatesta, M.L.; Gona, F.; Stefani, S. Enterobacter cloacae complex: Clinical impact and emerging antibiotic resistance. Future Microbiol. 2012, 7, 887–902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Barnes, A.I.; Ortiz, C.; Paraje, M.G.; Balanzino, L.E.; Albesa, I. Purification and characterization of a cytotoxin from Enterobacter cloacae. Can. J. Microbiol. 1997, 43, 729–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Krzymińska, S.; Mokracka, J.; Koczura, R.; Kaznowski, A. Cytotoxic activity of Enterobacter cloacae human isolates. FEMS Immunol. Med. Microbiol. 2009, 56, 248–252. [Google Scholar] [CrossRef] [Scilit]
  78. Stuber, K.; Frey, J.; Burnens, A.P.; Kuhnert, P. Detection of type III secretion genes as a general indicator of bacterial virulence. Mol. Cell. Probes 2003, 17, 25–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Tang, H.J.; Hsieh, C.F.; Chang, P.C.; Chen, J.J.; Lin, Y.H.; Lai, C.C.; Chao, C.M.; Chuang, Y.C. Clinical significance of community- and healthcare-acquired carbapenem-resistant Enterobacteriaceae isolates. PLoS ONE 2016, 11, e0151897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Mshana, S.E.; Gerwing, L.; Minde, M.; Hain, T.; Domann, E.; Lyamuya, E.; Chakraborty, T.; Imirzalioglu, C. Outbreak of a novel Enterobacter sp. carrying blaCTX-M-15 in a neonatal unit of a tertiary care hospital in Tanzania. Int. J. Antimicrob. Agents 2011, 38, 265–269. [Google Scholar] [CrossRef] [Scilit]
  81. Pati, N.B.; Doijad, S.P.; Schultze, T.; Mannala, G.K.; Yao, Y.; Jaiswal, S.; Ryan, D.; Suar, M.; Gwozdzinski, K.; Bunk, B.; et al. Enterobacter bugandensis: A novel enterobacterial species associated with severe clinical infection. Sci. Rep. 2018, 8, 5392. [Google Scholar] [CrossRef] [Scilit]
  82. Al Atrouni, A.; Joly-Guillou, M.L.; Hamze, M.; Kempf, M. Reservoirs of non-baumannii Acinetobacter species. Front. Microbiol. 2016, 7, 49. [Google Scholar] [CrossRef] [Scilit]
  83. Dijkshoorn, L.; van der Toorn, J. Acinetobacter species: Which do we mean? Clin. Infect. Dis. 1992, 15, 748–749. [Google Scholar] [CrossRef] [Scilit]
  84. Rosenthal, S.; Tager, l.B. Prevalence of gram-negative rods in the normal pharyngeal flora. Ann. Intern. Med. 1975, 83, 355–357. [Google Scholar] [CrossRef] [Scilit]
  85. Rafei, R.; Hamze, M.; Pailhories, H.; Eveillard, M.; Marsollier, L.; Joly-Guillou, M.L.; Dabboussi, F.; Kempf, M. Extra human epidemiology of Acinetobacter baumannii in Lebanon. Appl. Environ. Microbiol. 2015, 81, 2359–2367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  86. Glew, R.H.; Moellering, R.C., Jr.; Kunz, L.J. Infections with Acinetobacter calcoaceticus (Herellea vaginicola): Clinical and laboratory studies. Medicine 1977, 56, 79–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  87. Buxton, A.E.; Anderson, R.L.; Werdegar, D.; Atlas, E. Nosocomial respiratory tract infection and colonization with Acinetobacter calcoaceticus. Am. J. Med. 1978, 65, 507–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. Sato, K.; Nakae, T. Outer membrane permeability of Acinetobacter calcoaceticus and its implication in antibiotic resistance. J. Antimicrob. Chemother. 1991, 28, 35–45. [Google Scholar] [CrossRef] [Scilit]
  89. Vila, J.; Marti, S.; Sanchez-Cespedes, J. Porins, efflux pumps and multidrug resistance in Acinetobacter baumannii. J. Antimicrob. Chemother. 2007, 59, 1210–1215. [Google Scholar] [CrossRef] [Scilit]
  90. Wong, D.; Nielsen, T.B.; Bonomo, R.A.; Pantapalangkoor, P.; Luna, B.; Spellberg, B. Clinical and pathophysiological overview of Acinetobacter Infections: A Century of Challenges. Clin. Microbiol. Rev. 2017, 30, 409–447. [Google Scholar] [CrossRef] [Scilit]
  91. Von Graevenitz, A.; Weinstein, J. Pathogenic significance of Pseudomonas fluorescens and Pseudomonas putida. Yale J. Biol. Med. 1971, 44, 265–273. [Google Scholar]
  92. Yoshino, Y.; Kitazawa, T.; Kamimura, M.; Tatsuno, K.; Ota, Y.; Yotsuyanagi, H. Pseudomonas putida bacteremia in adult patients: Five case reports and a review of the literature. J. Infect. Chemother. 2011, 17, 278–282. [Google Scholar] [CrossRef] [Scilit]
  93. Perz, J.F.; Craig, A.S.; Stratton, C.W.; Bodner, S.J.; Phillips, W.E., Jr.; Schaffner, W. Pseudomonas putida septicemia in a special care nursery due to contaminated flush solutions prepared in a hospital pharmacy. J. Clin. Microbiol. 2005, 43, 5316–5318. [Google Scholar] [CrossRef] [Scilit]
  94. Torii, K.; Noda, Y.; Miyazaki, Y.; Ohta, M. An unusual outbreak of infusion-related bacteremia in a gastrointestinal disease ward. Jpn. J. Infect. Dis. 2003, 56, 177–178. [Google Scholar]
  95. Kumita, W.; Saito, R.; Sato, K.; Ode, T.; Moriya, K.; Koike, K. Molecular characterizations of carbapenem and ciprofloxacin resistance in clinical isolates of Pseudomonas putida. J. Infect. Chemother. 2009, 15, 6–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Plant samples. (A) Tomatoes samples: stems—T3, T5; leaves—T4, T9; flower—T2; fruits—T6, T7, T8, T10; and seeds—T11, T12; (B) Pepper samples: leaves—P1, P3, P4, P5, P6, P7; fruit stem–P2, P8; and seeds—P9. Samples T1, S1, S2, and S3 are not shown.
Figure 1. Plant samples. (A) Tomatoes samples: stems—T3, T5; leaves—T4, T9; flower—T2; fruits—T6, T7, T8, T10; and seeds—T11, T12; (B) Pepper samples: leaves—P1, P3, P4, P5, P6, P7; fruit stem–P2, P8; and seeds—P9. Samples T1, S1, S2, and S3 are not shown.
Pathogens 11 01507 g001
Figure 2. PCR amplification of the rpoB gene for rapid enterobacterial differentiation. Lanes—T 2.1; 2—T 2.2; 3—T 2.3; 4—T 2.4; 5—T 2.6; 6—T 6.1; 7—T 3.4; 8b—T 5.4; 9—T 9.2; 10—T 8.4; 11—T 10.1; 12—T 10.2; 13—T 10.3; 14—T 11.2; 15—T 12.3; 16— P 3.5; 17—P 2.4; 18—P 8.5; 19—P 8.6.; 20E. coli (tc*); 21X. vesicatoria (tc); 22X. euvesicatoria (tc); 23X. gardneri (tc); 24C. michiganensis subsp. michiganensis (tc); 25P. syringae pv. syringae (tc); 26S. paucimobilis (tc); 27P. syringae pv. tomato (tc); 28P. putida (tc); 29P. fluorescens (tc); 30P. syringae pv. tomato (isolate); 31—P. agglomerans (isolate); 32, 33C. flaccumfaciens (isolates); 34, 35R. larrymoorei (isolates); 36S. enterica (tc); 37E. coli (tc); 38Enterococcus sp. *tc—type culture.
Figure 2. PCR amplification of the rpoB gene for rapid enterobacterial differentiation. Lanes—T 2.1; 2—T 2.2; 3—T 2.3; 4—T 2.4; 5—T 2.6; 6—T 6.1; 7—T 3.4; 8b—T 5.4; 9—T 9.2; 10—T 8.4; 11—T 10.1; 12—T 10.2; 13—T 10.3; 14—T 11.2; 15—T 12.3; 16— P 3.5; 17—P 2.4; 18—P 8.5; 19—P 8.6.; 20E. coli (tc*); 21X. vesicatoria (tc); 22X. euvesicatoria (tc); 23X. gardneri (tc); 24C. michiganensis subsp. michiganensis (tc); 25P. syringae pv. syringae (tc); 26S. paucimobilis (tc); 27P. syringae pv. tomato (tc); 28P. putida (tc); 29P. fluorescens (tc); 30P. syringae pv. tomato (isolate); 31—P. agglomerans (isolate); 32, 33C. flaccumfaciens (isolates); 34, 35R. larrymoorei (isolates); 36S. enterica (tc); 37E. coli (tc); 38Enterococcus sp. *tc—type culture.
Pathogens 11 01507 g002
Table 1. Diversity of the endophytic bacterial isolates from Solanum lycopersicum and Capsicum annuum.
Table 1. Diversity of the endophytic bacterial isolates from Solanum lycopersicum and Capsicum annuum.
Bacterial IsolatesSource
Plant Parts
Isolation MediaCell ShapeGram StainTaxonomic Identification of Bacterial Isolates by MALDI-TOFID Score Value
T 2.1.Tomato flowerEndo agarShort rodsnegativeEnterobacter cancerogenus1.97.
T 2.2.Tomato flowerEndo agarShort rodsnegativeEnterobacter cloacae1.92
T 2.3.Tomato flowerEndo agarShort rodsnegativeLeclercia adecarboxylata2.29
T 2.4.Tomato flowerEndo agarShort rodsnegativeAcinetobacter calcoaceticus1.81
T 2.5.Tomato flowerEndo agarShort rodsnegativeunidentified isolate1.23
T 2.6.Tomato flowerSS agarShort rodsnegativeEnterobacter cancerogenus1.95
T 6.1.Tomato flowerEndo agarShort rodsnegativeLeclercia adecarboxylata1.93
T 3.4.Tomato stemEndo agarShort rodsnegativeunidentified isolate1.34
T 5.4.Tomato stemEndo agarShort rodsnegativePseudesherichia vulneris1.92
T 9.2.Tomato leafEndo agarShort rodsnegativeEnterobacter bugandensis1.84
T 8.4.Tomato fruitEndo agarShort rodsnegativePantoea agglomerans2.05
T 10.1.Tomato fruitEndo agarShort rodsnegativePantoea ananatis1.97
T 10.2.Tomato fruitEndo agarShort rodsnegativePectobacterium carotovorum2.06
T 10.3.Tomato fruitEndo agarShort rodsnegativePantoea agglomerans2.02
T 10.4.Tomato fruitEndo agarShort rodsnegativeLeclercia adecarboxylata2.43
T 11.2.Tomato seedEndo agarShort rodsnegativePantoea agglomerans1.99
T 12.3.Tomato seedEndo agarShort rodsnegativePantoea agglomerans1.89
T 12.4.Tomato seedEndo agarShort rodsnegativeEnterobacter cloacae2.18
P 3.5.Pepper leafEndo agarShort rodsnegativePantoea agglomerans2.11
P 7.3.Pepper leafEndo agarShort rodsnegativeLeclercia adecarboxylata2.39
P 7.4.Pepper leafEndo agarShort rodsnegativeLeclercia adecarboxylata1.91
P 2.4.Pepper fruit stemSS agarShort rodsnegativePseudomonas sp. 2.19
P 8.5.Pepper fruit stemSS agarShort rodsnegativePseudomonas putida1.89
P 8.6.Pepper fruit stemEndo agarShort rodsnegativeLeclercia adecarboxylata2.08
P 8.7.Pepper fruit stemSB agarcoccipositiveEnterococcus sp. 1.98
P 8.8.Pepper fruit stemSB agarcoccipositiveEnterococcus sp. 2.01
Table 2. Biochemical characterization of the endophytic bacterial isolates.
Table 2. Biochemical characterization of the endophytic bacterial isolates.
Bacterial IsolatesGlucoseArabinoseInositolLactoseL-lysine
Decarboxylase
UreaseGelatinCitrateVPH2SMethyl-RedOrnithine Indole
T 2.1.++V+V++++
T 2.2++V+++++
T 2.3++V++++
T 2.4+VVV++++
T 2.5.++VV+++
T 2.6++VV++++
T 6.1V++++
T 3.4.++V+++++
T 5.4+++++++
T 9.2++V++++
T 8.4.++VV++++
T 10.1++V+V+++++
T 10.2+V++++
T 10.3++V+V++
T 10.4V++++
T 11.2++VV++++
T 12.3++VV+V+++
T 12.4++V++++++
P 3.5+VV+++
P 7.3.++VV+V+++++
P 7.4V++++
P 2.4.V++++
P 8.5.V++++
P 8.6++VV++++
P 8.7.++V++
P 8.8+VV+++
Table 3. Antibiotic resistance patterns of cross-over pathogens isolated from infected tomato and pepper plants.
Table 3. Antibiotic resistance patterns of cross-over pathogens isolated from infected tomato and pepper plants.
Bacterial
Strains
StreptomycinTetracyclineAmpicillin/SulbactamNeomycinKanamycinSulfamethoxazoleChloramphenicolTrimethoprimNalidixic AcidGentamycin
Leclercia
adecarboxylata
RSSIISSSSR
Enterobacter
cancerogenus
ISSRIIIISR
Enterobacter
cloacae
SSSSISRSSS
Enterobacter
bugandensis
SRRIIRIRSR
Pantoea
agglomerans
ISIRISSSSR
Pantoea
ananatis
ISSRSSSSSR
Pseudoesherichia vulnerisISSRIIISIR
Pectobacterium carotovorumRSSRISIRIR
Pseudomonas putidaSSRSSRRRIR
Pseudomonas spp. SSRSSRRRIR
Acinetobacter
calcoaceticus
SSSSSSRRSS
R—resistant; S—susceptible; I—intermediate.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kizheva, Y.; Georgiev, G.; Donchev, D.; Dimitrova, M.; Pandova, M.; Rasheva, I.; Hristova, P. Cross-Over Pathogenic Bacteria Detected in Infected Tomatoes (Solanum lycopersicum L.) and Peppers (Capsicum annuum L.) in Bulgaria. Pathogens 2022, 11, 1507. https://doi.org/10.3390/pathogens11121507

AMA Style

Kizheva Y, Georgiev G, Donchev D, Dimitrova M, Pandova M, Rasheva I, Hristova P. Cross-Over Pathogenic Bacteria Detected in Infected Tomatoes (Solanum lycopersicum L.) and Peppers (Capsicum annuum L.) in Bulgaria. Pathogens. 2022; 11(12):1507. https://doi.org/10.3390/pathogens11121507

Chicago/Turabian Style

Kizheva, Yoana, Georgi Georgiev, Deyan Donchev, Melani Dimitrova, Maria Pandova, Iliyana Rasheva, and Petya Hristova. 2022. "Cross-Over Pathogenic Bacteria Detected in Infected Tomatoes (Solanum lycopersicum L.) and Peppers (Capsicum annuum L.) in Bulgaria" Pathogens 11, no. 12: 1507. https://doi.org/10.3390/pathogens11121507

APA Style

Kizheva, Y., Georgiev, G., Donchev, D., Dimitrova, M., Pandova, M., Rasheva, I., & Hristova, P. (2022). Cross-Over Pathogenic Bacteria Detected in Infected Tomatoes (Solanum lycopersicum L.) and Peppers (Capsicum annuum L.) in Bulgaria. Pathogens, 11(12), 1507. https://doi.org/10.3390/pathogens11121507

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop