Diagnosis of SARS-CoV-2 during the Pandemic by Multiplex RT-rPCR hCoV Test: Future Perspectives
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and RNA Isolation
2.2. Multiplex Reverse Transcriptase Real-Time PCR Assay
2.3. Confirmation of the Multiplex RT-rPCR in the Detection of SARS-CoV-2
2.4. Enzyme Stabilizer Validation
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rabaan, A.A.; Al-Ahmed, S.H.; Haque, S.; Sah, R.; Tiwari, R.; Malik, Y.S.; Dhama, K.; Yatoo, M.I.; Bonilla-Aldana, D.K.; Rodriguez-Morales, A.J. SARS-CoV-2, SARS-CoV, and MERS-COV: A Comparative Overview. Infez. Med. 2020, 28, 174–184. [Google Scholar] [PubMed]
- van der Hoek, L.; Pyrc, K.; Jebbink, M.F.; Vermeulen-Oost, W.; Berkhout, R.J.M.; Wolthers, K.C.; Wertheim-van Dillen, P.M.E.; Kaandorp, J.; Spaargaren, J.; Berkhout, B. Identification of a New Human Coronavirus. Nat. Med. 2004, 10, 368–373. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Peiris, J.S.M.; Zheng, B.; Poon, L.L.M.; Chan, K.H.; Zeng, F.Y.; Chan, C.W.M.; Chan, M.N.; Chen, J.D.; Chow, K.Y.C.; et al. Molecular Epidemiology of the Novel Coronavirus That Causes Severe Acute Respiratory Syndrome. Lancet. 2004, 363, 99–104. [Google Scholar] [CrossRef] [Green Version]
- Zaki, A.M.; van Boheemen, S.; Bestebroer, T.M.; Osterhaus, A.D.M.E.; Fouchier, R.A.M. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. N. Engl. J. Med. 2012, 367, 1814–1820. [Google Scholar] [CrossRef] [PubMed]
- Balzanelli, M.G.; Distratis, P.; Dipalma, G.; Vimercati, L.; Catucci, O.; Amatulli, F.; Cefalo, A.; Lazzaro, R.; Palazzo, D.; Aityan, S.K.; et al. Immunity Profiling of COVID-19 Infection, Dynamic Variations of Lymphocyte Subsets, a Comparative Analysis on Four Different Groups. Microorganisms 2021, 9, 2036. [Google Scholar] [CrossRef] [PubMed]
- Malcangi, G.; Inchingolo, A.D.; Inchingolo, A.M.; Santacroce, L.; Marinelli, G.; Mancini, A.; Vimercati, L.; Maggiore, M.E.; D’Oria, M.T.; Hazballa, D.; et al. COVID-19 Infection in Children, Infants and Pregnant Subjects: An Overview of Recent Insights and Therapies. Microorganisms 2021, 9, 1964. [Google Scholar] [CrossRef] [PubMed]
- Vimercati, L.; De Maria, L.; Quarato, M.; Caputi, A.; Gesualdo, L.; Migliore, G.; Cavone, D.; Sponselli, S.; Pipoli, A.; Inchingolo, F.; et al. Association between Long COVID and Overweight/Obesity. J. Clin. Med. 2021, 10, 4143. [Google Scholar] [CrossRef] [PubMed]
- Balzanelli, M.G.; Distratis, P.; Lazzaro, R.; Cefalo, A.; Catucci, O.; Aityan, S.K.; Dipalma, G.; Vimercati, L.; Inchingolo, A.D.; Maggiore, M.E.; et al. The Vitamin D, IL-6 and the EGFR Markers a Possible Way to Elucidate the Lung–Heart–Kidney Cross-Talk in COVID-19 Disease: A Foregone Conclusion. Microorganisms 2021, 9, 1903. [Google Scholar] [CrossRef] [PubMed]
- Scarano, A.; Inchingolo, F.; Lorusso, F. Environmental Disinfection of a Dental Clinic during the COVID-19 Pandemic: A Narrative Insight. BioMed Res. Int. 2020, 2020, 8896812. [Google Scholar] [CrossRef] [PubMed]
- Malcangi, G.; Inchingolo, A.D.; Inchingolo, A.M.; Piras, F.; Settanni, V.; Garofoli, G.; Palmieri, G.; Ceci, S.; Patano, A.; Mancini, A.; et al. COVID-19 Infection in Children and Infants: Current Status on Therapies and Vaccines. Children 2022, 9, 249. [Google Scholar] [CrossRef] [PubMed]
- Patano, A.; Cirulli, N.; Beretta, M.; Plantamura, P.; Inchingolo, A.D.; Inchingolo, A.M.; Bordea, I.R.; Malcangi, G.; Marinelli, G.; Scarano, A.; et al. Education Technology in Orthodontics and Paediatric Dentistry during the COVID-19 Pandemic: A Systematic Review. Int. J. Environ. Res. Public Health 2021, 18, 6056. [Google Scholar] [CrossRef] [PubMed]
- Balzanelli, M.G.; Distratis, P.; Dipalma, G.; Vimercati, L.; Inchingolo, A.D.; Lazzaro, R.; Aityan, S.K.; Maggiore, M.E.; Mancini, A.; Laforgia, R.; et al. SARS-CoV-2 Virus Infection May Interfere CD34+ Hematopoietic Stem Cells and Megakaryocyte–Erythroid Progenitors Differentiation Contributing to Platelet Defection towards Insurgence of Thrombocytopenia and Thrombophilia. Microorganisms 2021, 7, 1632. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Pei, S.; Chen, B.; Song, Y.; Zhang, T.; Yang, W.; Shaman, J. Substantial Undocumented Infection Facilitates the Rapid Dissemination of Novel Coronavirus (SARS-CoV-2). Science 2020, 368, 489–493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, Y.-H.; Cai, L.; Cheng, Z.-S.; Cheng, H.; Deng, T.; Fan, Y.-P.; Fang, C.; Huang, D.; Huang, L.-Q.; Huang, Q.; et al. A Rapid Advice Guideline for the Diagnosis and Treatment of 2019 Novel Coronavirus (2019-NCoV) Infected Pneumonia (Standard Version). Mil. Med. Res. 2020, 7, 4. [Google Scholar] [CrossRef] [Green Version]
- Charitos, I.A.; Del Prete, R.; Inchingolo, F.; Mosca, A.; Carretta, D.; Ballini, A.; Santacroce, L. What We Have Learned for the Future about COVID-19 and Healthcare Management of It? Acta BioMed. 2020, 91, e2020126. [Google Scholar] [CrossRef]
- Bordea, I.R.; Xhajanka, E.; Candrea, S.; Bran, S.; Onișor, F.; Inchingolo, A.D.; Malcangi, G.; Pham, V.H.; Inchingolo, A.M.; Scarano, A.; et al. Coronavirus (SARS-CoV-2) Pandemic: Future Challenges for Dental Practitioners. Microorganisms 2020, 8, 1704. [Google Scholar] [CrossRef]
- Rapone, B.; Ferrara, E.; Corsalini, M.; Converti, I.; Grassi, F.R.; Santacroce, L.; Topi, S.; Gnoni, A.; Scacco, S.; Scarano, A.; et al. The Effect of Gaseous Ozone Therapy in Conjunction with Periodontal Treatment on Glycated Hemoglobin Level in Subjects with Type 2 Diabetes Mellitus: An Unmasked Randomized Controlled Trial. Int. J. Environ. Res. Public Health 2020, 17, 5467. [Google Scholar] [CrossRef]
- Hamre, D.; Kindig, D.A.; Mann, J. Growth and Intracellular Development of a New Respiratory Virus. J. Virol. 1967, 1, 810–816. [Google Scholar] [CrossRef] [Green Version]
- Loeffelholz, M.J.; Tang, Y.-W. Laboratory Diagnosis of Emerging Human Coronavirus Infections—The State of the Art. Emerg. Microbes Infect. 2020, 9, 747–756. [Google Scholar] [CrossRef] [Green Version]
- Maggialetti, N.; Villanova, I.; Castrì, A.; Greco, C.N.; Inchingolo, F.; Virgilio, D.; Moschetta, M.; Sardaro, A.; Ianora, A.A.S.; Scardapane, A. COVID-19 in Italy: Comparison of CT Findings from Time Zero to the Delta Variant. Microorganisms 2022, 10, 796. [Google Scholar] [CrossRef]
- Gu, W.; Miller, S.; Chiu, C.Y. Clinical Metagenomic Next-Generation Sequencing for Pathogen Detection. Annu. Rev. Pathol. Mech. Dis. 2019, 14, 319–338. [Google Scholar] [CrossRef] [PubMed]
- LeBlanc, J.J.; Gubbay, J.B.; Li, Y.; Needle, R.; Arneson, S.R.; Marcino, D.; Charest, H.; Desnoyers, G.; Dust, K.; Fattouh, R.; et al. Real-time PCR-Based SARS-CoV-2 Detection in Canadian Laboratories. J. Clin. Virol. 2020, 128, 104433. [Google Scholar] [CrossRef] [PubMed]
- Cellini, F.; Kim, J.P.; Caravatta, L.; Bardoscia, L. The Role of Multiparametric Magnetic Resonance in Volumetric Modulated Arc Radiation Therapy Planning for Prostate Cancer Recurrence After Radical Prostatectomy: A Pilot Study. Front. Oncol. 2021, 10, 10. [Google Scholar]
- Inchingolo, A.D.; Inchingolo, A.M.; Bordea, I.R.; Malcangi, G.; Xhajanka, E.; Scarano, A.; Lorusso, F.; Farronato, M.; Tartaglia, G.M.; Isacco, C.G.; et al. SARS-CoV-2 Disease Adjuvant Therapies and Supplements Breakthrough for the Infection Prevention. Microorganisms 2021, 9, 525. [Google Scholar] [CrossRef] [PubMed]
- Santacroce, L.; Charitos, I.A.; Ballini, A.; Inchingolo, F.; Luperto, P.; De Nitto, E.; Topi, S. The Human Respiratory System and its Microbiome at a Glimpse. Biology 2020, 9, 318. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.; Wang, M.; Wei, Y.; Kim, T.; Wei, X. Coronavirus in Human Diseases: Mechanisms and Advances in Clinical Treatment. MedComm 2020, 1, 270–301. [Google Scholar] [CrossRef]
- Santacroce, L.; Inchingolo, F.; Topi, S.; Del Prete, R.; Di Cosola, M.; Charitos, I.A.; Montagnani, M. Potential Beneficial Role of Probiotics on the Outcome of COVID-19 Patients: An Evolving Perspective. Diabetes Metab. Syndr. 2021, 15, 295–301. [Google Scholar] [CrossRef]
- Pham, V.H.; Isacco, C.G.; Nguyen, K.C.D.; Le, S.H.; Tran, D.K.; Nguyen, Q.V.; Pham, H.T.; Aityan, S.; Pham, S.T.; Cantore, S.; et al. Rapid and Sensitive Diagnostic Procedure for Multiple Detection of Pandemic Coronaviridae Family Members SARS-CoV-2, SARS-CoV, MERS-CoV and HCoV: A Translational Research and Cooperation between the Phan Chau Trinh University in Vietnam and University of Bari “Aldo Moro” in Italy. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 7173–7191. [Google Scholar] [CrossRef]
- Santacroce, L.; Bottalico, L.; Charitos, I.A. The Impact of COVID-19 on Italy: A Lesson for the Future. Int. J. Occup. Environ. Med. 2020, 11, 151–152. [Google Scholar] [CrossRef]
- Balzanelli, M.G.; Ballini, A.; Gargiulo Isacco, C. Mesenchymal Stem Cells: The Secret Children’s Weapons against the SARS-CoV-2 Lethal Infection. Appl. Sci. 2021, 11, 1696. [Google Scholar] [CrossRef]
- Wang, Y.-X.; Ma, J.-R.; Wang, S.-Q.; Zeng, Y.-Q.; Zhou, C.-Y.; Ru, Y.-H.; Zhang, L.; Lu, Z.-G.; Wu, M.-H.; Li, H. Utilizing Integrating Network Pharmacological Approaches to Investigate the Potential Mechanism of Ma Xing Shi Gan Decoction in Treating COVID-19. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 3360–3384. [Google Scholar] [CrossRef] [PubMed]
- Dhamad, A.E.; Abdal Rhida, M.A. COVID-19: Molecular and Serological Detection Methods. PeerJ 2020, 8, e10180. [Google Scholar] [CrossRef] [PubMed]
- Lima Neto, J.X.; Vieira, D.S.; de Andrade, J.; Fulco, U.L. Exploring the Spike-HACE 2 Residue-Residue Interaction in Human Coronaviruses SARS-CoV-2, SARS-CoV, and HCoV-NL63. J. Chem. Inf. Model. 2022, 62, 2857–2868. [Google Scholar] [CrossRef] [PubMed]
- Petrosillo, N.; Viceconte, G.; Ergonul, O.; Ippolito, G.; Petersen, E. COVID-19, SARS and MERS: Are They Closely Related? Clin. Microbiol. Infect. 2020, 26, 729–734. [Google Scholar] [CrossRef] [PubMed]
- Attolico, I.; Tarantini, F.; Carluccio, P.; Schifone, C.P.; Delia, M.; Gagliardi, V.P.; Perrone, T.; Gaudio, F.; Longo, C.; Giordano, A.; et al. Serological Response Following BNT162b2 Anti-SARS-CoV-2 mRNA Vaccination in Haematopoietic Stem Cell Transplantation Patients. Br. J. Haematol. 2022, 196, 928–931. [Google Scholar] [CrossRef]
- Vimercati, L.; Stefanizzi, P.; De Maria, L.; Caputi, A.; Cavone, D.; Quarato, M.; Gesualdo, L.; Lopalco, P.L.; Migliore, G.; Sponselli, S.; et al. Large-Scale IgM and IgG SARS-CoV-2 Serological Screening among Healthcare Workers with a Low Infection Prevalence Based on Nasopharyngeal Swab Tests in an Italian University Hospital: Perspectives for Public Health. Environ. Res. 2021, 195, 110793. [Google Scholar] [CrossRef] [PubMed]
- Chernesky, M.A. Multiplex Polymerase Chain Reaction. 18; Academic Press, Inc.: New York, NY, USA, 1995. [Google Scholar]
- Bianchi, F.P.; Germinario, C.A.; Migliore, G.; Vimercati, L.; Martinelli, A.; Lobifaro, A.; Tafuri, S.; Stefanizzi, P.; Control Room Working Group; Amoruso, F.; et al. BNT162b2 mRNA COVID-19 Vaccine Effectiveness in the Prevention of SARS-CoV-2 Infection: A Preliminary Report. J. Infect. Dis. 2021, 224, 431–434. [Google Scholar] [CrossRef] [PubMed]
- Peeri, N.C.; Shrestha, N.; Rahman, M.S.; Zaki, R.; Tan, Z.; Bibi, S.; Baghbanzadeh, M.; Aghamohammadi, N.; Zhang, W.; Haque, U. The SARS, MERS and Novel Coronavirus (COVID-19) Epidemics, the Newest and Biggest Global Health Threats: What Lessons Have We Learned? Int. J. Epidemiol. 2020, 49, 717–726. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qian, X.; Ren, R.; Wang, Y.; Guo, Y.; Fang, J.; Wu, Z.-D.; Liu, P.-L.; Han, T.-R. Members of Steering Committee, Society of Global Health, Chinese Preventive Medicine Association Fighting against the Common Enemy of COVID-19: A Practice of Building A Community with a Shared Future for Mankind. Infect. Dis. Poverty 2020, 9, 34. [Google Scholar] [CrossRef] [Green Version]
- Wang, R.; Chen, J.; Gao, K.; Hozumi, Y.; Yin, C.; Wei, G.-W. Analysis of SARS-CoV-2 Mutations in the United States Suggests Presence of Four Substrains and Novel Variants. Commun. Biol. 2021, 4, 228. [Google Scholar] [CrossRef]
- Chen, B.; Tian, E.-K.; He, B.; Tian, L.; Han, R.; Wang, S.; Xiang, Q.; Zhang, S.; El Arnaout, T.; Cheng, W. Overview of Lethal Human Coronaviruses. Signal Transduct. Target. Ther. 2020, 5, 89. [Google Scholar] [CrossRef] [PubMed]
Oligo Name | Target | Mix | Sequence 5′–3′ |
---|---|---|---|
2019-nCoV_N1-F | N1 | MPL1 | GACCCCAAAATCAGCGAAT |
2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG | ||
2019-nCoV_N1-Probe | FAM-ACCCCGCATTCAGTTTGGTGGACC-BHQ1 | ||
2019-nCoV_N2-F | N2 | TTACAAACATTGGCCGCAAA | |
2019-nCoV_N2-R | GCGCGACATTCCGAAGAA | ||
2019-nCoV_N2-Probe | TexasRED-ACAATTTTGCCCCCAGCGCTTCAG-BHQ2 | ||
2019-nCoV_N3-F | N3 | GGGAGCCTTGAATACACCAAAA | |
2019-nCoV_N3-R | TGTAGCACGATTGCAGCATTG | ||
2019-nCoV_N3-Probe | HEX-AYCACATTGGCACCCGCAATCCTG-BHQ1 | ||
RP-F | RNAseP | AGATTTGGACCTGCGAGCG | |
RP-R | GAGCGGCTGTCTCCA | ||
RP-Probe | CY5-TTCTGACCTGAAGGCTCTGCGCG-BHQ3 | ||
E_Sarbeco_F1 | E | MPL2 | ACAGGTACGTTAATAGTTAATAGCGT |
E_Sarbeco_R2 | ATATTGCAGCAGTACGCACACA | ||
E_Sarbeco_Probe | FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 | ||
upE_TqF | UpE | GCAACGCGCGATTCAGTT | |
upE_tqR | GCCTCTACACGGGACCCATA | ||
upE_TqProbe | FAM-CTCTTCACATAATCGCCCCGACGTCG-BHQ2 | ||
PEDV-NF | N | GCGCAAAGACTGAACCCACTA | |
PEDV-NR | TTGCCTCTGTTGTTACTTGGAGAT | ||
PEDV-Probe | HEX-TGTTGCCATTGCCACGACTCCTGC-BHQ1 | ||
HCoV-HKU-1-F | RdRp | CCTTGCGAATGAATGTGCT | |
HCoV-HKU-1-R | TTGCATCACCACTGCTAGTACCAC | ||
HCoV-HKU-1-Probe | CY5-TGTGTGGCGGTTGCTATTATGTTAAGCCTG-BHQ3 |
Reagent | MPL1 | MPL2 |
---|---|---|
H2O (RNAse free) | 15 μL | 15 μL |
2× Buffer | 10 μL | 10 μL |
SuperScriptTM III RT/PlatinumTM Taq High Fidelity Enzyme mix | 0.4 μL | 0.4 μL |
Enzyme stabilizer | 1 μL | 1 μL |
2019-nCoV_N1-F | 10 pm | - |
2019-nCoV_N1-R | 10 pm | - |
2019-nCoV_N1-Probe | 5 pm | - |
2019-nCoV_N2-F | 10 pm | - |
2019-nCoV_N2-R | 10 pm | - |
2019-nCoV_N2-Probe | 5 pm | - |
2019-nCoV_N3-F | 10 pm | - |
2019-nCoV_N3-R | 10 pm | - |
2019-nCoV_N3-Probe | 5 pm | - |
RP-F | 10 pm | - |
RP-R | 10 pm | - |
RP-Probe | 5 pm | - |
E_Sarbeco_F1 | - | 10 pm |
E_Sarbeco_R2 | - | 10 pm |
E_Sarbeco_Probe | - | 5 pm |
upE_TqF | - | 10 pm |
upE_tqR | - | 10 pm |
upE_TqProbe | - | 5 pm |
PEDV-NF | - | 10 pm |
PEDV-NR | - | 10 pm |
PEDV-Probe | - | 5 pm |
HCoV-HKU-1-F | - | 2 pm |
HCoV-HKU-1-R | - | 2 pm |
HCoV-HKU-1-Probe | - | 5 pm |
MPL1 | MPL2 | Interpretation | ||||||
---|---|---|---|---|---|---|---|---|
FAM | HEX | Texas-RED | CY5 | FAM | HEX | Texas-RED | CY5 | |
+ | + | + | + 1 | + 2 | + | − | − | SARS-CoV-2 |
− | − | − | + | − | + | − | − | No coronaviral pathogens detected |
− | − | − | − | − | + | − | − | Sample contains no epithelial cells |
− | − | − | − | − | − | − | − | The RNA extraction step was failed |
− | − | − | + | + | + | − | SARS-CoV | |
− | − | − | + | − | + | + | − | MERS-COV |
− | − | − | + | − | + | − | + | hCOV |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Inchingolo, A.D.; Gargiulo, C.I.; Malcangi, G.; Ciocia, A.M.; Patano, A.; Azzollini, D.; Piras, F.; Barile, G.; Settanni, V.; Mancini, A.; et al. Diagnosis of SARS-CoV-2 during the Pandemic by Multiplex RT-rPCR hCoV Test: Future Perspectives. Pathogens 2022, 11, 1378. https://doi.org/10.3390/pathogens11111378
Inchingolo AD, Gargiulo CI, Malcangi G, Ciocia AM, Patano A, Azzollini D, Piras F, Barile G, Settanni V, Mancini A, et al. Diagnosis of SARS-CoV-2 during the Pandemic by Multiplex RT-rPCR hCoV Test: Future Perspectives. Pathogens. 2022; 11(11):1378. https://doi.org/10.3390/pathogens11111378
Chicago/Turabian StyleInchingolo, Alessio Danilo, Ciro Isacco Gargiulo, Giuseppina Malcangi, Anna Maria Ciocia, Assunta Patano, Daniela Azzollini, Fabio Piras, Giuseppe Barile, Vito Settanni, Antonio Mancini, and et al. 2022. "Diagnosis of SARS-CoV-2 during the Pandemic by Multiplex RT-rPCR hCoV Test: Future Perspectives" Pathogens 11, no. 11: 1378. https://doi.org/10.3390/pathogens11111378
APA StyleInchingolo, A. D., Gargiulo, C. I., Malcangi, G., Ciocia, A. M., Patano, A., Azzollini, D., Piras, F., Barile, G., Settanni, V., Mancini, A., Garofoli, G., Palmieri, G., Di Pede, C., Rapone, B., Inchingolo, A. M., Jones, M., Corriero, A., Brienza, N., Parisi, A., ... Inchingolo, F. (2022). Diagnosis of SARS-CoV-2 during the Pandemic by Multiplex RT-rPCR hCoV Test: Future Perspectives. Pathogens, 11(11), 1378. https://doi.org/10.3390/pathogens11111378