Next Article in Journal
Targeting Host Tyrosine Kinase Receptor EPHA2 Signaling Affects Uropathogen Infection in Human Bladder Epithelial Cells
Next Article in Special Issue
The Troublesome Ticks Research Protocol: Developing a Comprehensive, Multidiscipline Research Plan for Investigating Human Tick-Associated Disease in Australia
Previous Article in Journal
Consumption of Galactose by Trypanosoma cruzi Epimastigotes Generates Resistance against Oxidative Stress
Previous Article in Special Issue
Investigation of Rickettsia conorii in Patients Suspected of Having Crimean-Congo Hemorrhagic Fever
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity of Coxiella burnetii in Iran by Multi-Spacer Sequence Typing

1
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran 1411713116, Iran
2
Department of Epidemiology and Biostatics, Research Centre for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Tehran 1316943551, Iran
3
National Reference Laboratory for Plague, Tularemia and Q Fever, Research Centre for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Akanlu, KabudarAhang, Hamadan 6556153145, Iran
4
Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman 7616913439, Iran
5
Australian Rickettsial Reference Laboratory, University Hospital Geelong, Geelong, VIC 3220, Australia
*
Author to whom correspondence should be addressed.
Pathogens 2022, 11(10), 1175; https://doi.org/10.3390/pathogens11101175
Submission received: 29 August 2022 / Revised: 2 October 2022 / Accepted: 8 October 2022 / Published: 11 October 2022
(This article belongs to the Collection Updates on Rickettsia and Coxiella)

Abstract

Coxiella burnetii, the zoonotic agent of Q fever, has a worldwide distribution including Iran. However, no information regarding the circulating genotype of this infection has been reported in Iran. This study aimed to evaluate the genetic diversity of C. burnetii in Iran using the multi-spacer sequence typing (MST) method. First, 14 positive C. burnetii samples (collected from four sheep, three goats, and seven cattle) were confirmed using quantitative polymerase chain reaction (qPCR) targeting the IS1111 gene. Then, ten spacers (Cox 2, 5, 18, 20, 22, 37, 51, 56, 57, and 61) were amplified using PCR for future MST analysis. The in-silico MST genotyping analysis of domestic ruminant samples revealed two new alleles (Cox5.11 and Cox56.15) in Cox5 and Cox56 loci that led to the emergence of four novel MST genotypes (MST62, 63, 64, and 65) and one MST genotype that has been previously described (MST61). This study showed the circulation of five MST C. burnetii genotypes among Iranian domestic ruminants. Understanding the C. burnetii genotypic profiles is critical in determining and preventing Q fever outbreaks.

1. Introduction

Q fever is a very important zoonotic disease worldwide. The infection is caused by an intracellular bacterium called Coxiella burnetii [1]. The global distribution, reservoirs, routes of transmission, and vectors of C. burnetii are very diverse. Therefore, the epidemiological features of Q fever are very complex [1,2]. Genotyping studies of C. burnetii isolates provide helpful information on types of circulating strains at the farm, regional, and country levels. In addition, molecular epidemiology can be used to identify the source of infection in humans and animals, the circulating and endemic genotypes, and virulent strains in acute and chronic Q fever. Finally, these findings help to establish preventive and control measures [3].
Since C. burnetii is highly infectious, its culture and purification are very dangerous for laboratory staff and require access to biosafety level 3 (BSL3) laboratory conditions. In addition, the culture of this agent requires enriched mediums and animal-derived cell culture systems [4]. Due to these factors, it is impossible to cultivate C. burnetii in the laboratories of some countries. Therefore, there are no comprehensive comparative studies on this bacterium in these countries [1,5]. On the other hand, differentiation between diverse C. burnetii strains has not been successful using serological methods [2].
Access to molecular methods and genome sequencing has led to great advances in bacterial typing. These techniques allow scientists to direct comparisons and evolutionary relationships between different strains using bioinformatics. Whole-genome sequencing is the ultimate method for direct comparison between strains. However, these methods are not accessible in many laboratories because there are limited financial resources in many countries. On the other hand, differentiation of C. burnetii strains based on sequencing of 16SrDNA, com1, mucZ, and isocitrate dehydrogenase genes does not provide enough information because of the similarity (more than 99% homologous) between different strains in the sequence analysis [2,6]. Therefore, these methods cannot be used to distinguish between different C. burnetii strains [2,7]. Since 2005, highly differentiated methods have been developed for C. burnetii genotyping, including multi-spacer sequence typing (MST), multiple-locus variable-number tandem repeat analysis (MLVA), and single nucleotide polymorphism (SNP) [2,7]. MST is based on intergenic region sequencing, and these regions are potentially variable since they are subject to lower selection pressure than the adjacent genes. For C. burnetii genotyping, Glazunova et al. selected ten spacers that had the most variations. This technique was able to classify 173 isolates of C. burnetii into 30 genotypes [8]. Due to its high-resolution power, this technique allows direct comparison of results between different laboratories. Another advantage of this technique is the ability to detect new alleles and changes within the studied spacers [1].
Since Q fever is an endemic zoonotic disease in Iran, there are many studies on the prevalence of C. burnetii [9,10,11,12]. However, there are no studies on the genotyping of this bacterium in livestock and humans. Various molecular studies in milk and animal abortion samples show the high prevalence of this bacterium in different parts of Iran. The C. burnetii genotyping data helps healthcare systems to explore Q fever epidemiology and putative outbreak control criteria. Therefore, this study aimed to genotype C. burnetii strains identified in Iran using the MST method.

2. Materials and Methods

2.1. Samples

In this study, we used various human and animal samples available in our biobank. These samples were collected during our previous studies [10,13,14,15] and were positive for C. burnetii. Seven animal abortion samples (two sheep, two goats, and three cattle) and seven milk samples (two sheep, one goat, and four cattle) were selected for MST genotyping (Table 1 and Figure 1). None of the human specimens had a sufficient level of C. burnetii DNA to be used in this study.

2.2. DNA Extraction and Quantitative Polymerase Chain Reaction (qPCR)

Using the Roche High Pure PCR Template Preparation Kit (Roche, Germany), DNA was extracted from 50 mg of aborted tissue and spleen samples or 200 μL of abortion fluids and milk samples, according to the manufacturer’s instructions.
For quantitative polymerase chain reaction (qPCR), we used DNA of C. burnetii Nine Mile, phase I strain (RSA 493), as a positive standard control, which was phenol-killed, purified, and lyophilized (Institute of Virology, Slovak Academy of Sciences, Bratislava, Slovak Republic). Based on the measured DNA concentration (50 ng/μl), the length of the published sequence of the C. burnetii Nine Mile (RSA 493) genome (1,995,275 bp), and also the mass of each C. burnetii genome (2.3 × 10-7 ng), the theoretical number of genome equivalents (GE) was calculated to be 2.24 × 108 GE per μl. Each C. burnetii Nine Mile strain (RSA 493) genome contains 20 copies of the IS 1111 gene. Therefore, the concentration of the IS1111 gene was 4.48 × 109 per μl in our standard control [16]. Ten consecutive dilutions (10-folds) were used for the standard control stock standard curve. Quantification of the approximate bacterial load and the quantification cycle (Cq) values were achieved using this standard. Finally, all samples were tested against the standard curve and Ct values for all samples were determined. Samples with Ct values of 31 or lower in qPCR were selected for MST genotyping. Furthermore, animal species, sample source, and origin were considered in the selection of the samples tested.

2.3. Multi-Spacer Sequence Typing (MST)

MST analyses of C. burnetii were performed on selected samples using ten spacers (Cox 2, 5, 18, 20, 22, 37, 51, 56, 57, and 61) (Table 2). PCR conditions and primer sequences have been previously described [8]. Briefly, each amplification reaction contained 12.5 μL of TEMPase Hot Start 2x Master Mix BLUE (Ampliqon, Odense, Denmark), 0.5 μM of each primer, 5 μL of DNA sample (in the final concentration of 5 ng), and 5.5 µL of double-distilled water in a final reaction volume of 25 µL. The PCR product for each gene was electrophoresed on 1% agarose gel to ensure the presence of the desired band and the absence of nonspecific bands. PCR products were sequenced by ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using forward and reverse primers. Sequencing results were initially reviewed using Chromas software (http://www.technelysium.com.au/chromas.html). In addition, sequencing data were edited using SeaView v.4 software (http://pbil.univ-lyon1.fr/software/seaview accessed on 5 January 2018). Allele numbers and MST genotype were determined by comparison with the MST database of C. burnetii (https://ifr48.timone.univ-mrs.fr/mst/coxiella_burnetii/ accessed on 20 February 2018).
Sequences that were not identical to the alleles in the database were considered novel alleles. These novel alleles were submitted to the MST database of C. burnetii. After examining the sequence of these alleles for each spacer against the database, these sequences were identified as new alleles. Also, profiles that did not resemble database data were considered a new MST genotype of C. burnetii and all identified MST genotypes in this study were recorded in the database.

2.4. Data Analysis

Data of all registered MST genotype profiles were extracted from the MST database and publications. All sequences of MST genotypes were aligned and used for phylogenetic analysis using the MEGA X version 10.2.2 software. The evolutionary distances were inferred using the neighbor-joining method (computing the maximum composite likelihood method) and expressed in the number of base substitutions per site by pair-wise comparison of 48 nucleotide sequences.
Also, the minimum-spanning tree was built using the goeBURST full algorithm (PHYLOViZ 2.1) for ten allelic profiles of all STs.

3. Results

In this study, a novel allele for Cox5 spacer was observed in two samples (AG1 and AS3). One mutation had occurred in nucleotides position 133 [Guanine (G) to Thymine (T) mutation] in the sequence of this novel allele compared with allele Cox5.4. This novel allele of Cox5 was recognized by the MST database as a new allele (Cox5.11). Moreover, a novel allele for the Cox56 spacer was observed in one sample (MB14), in which four mutations along with two deletions of nucleotides have occurred in the sequence of this novel allele relative to Cox56.10. This novel allele of Cox56 was recognized by the MST database as Cox56.15.
The discriminatory power of MST genotyping was calculated using Simpson’s diversity index (DI), which was 0.758. The Cox2, Cox22, and Cox57 spacers had only one allele in our samples. The Cox56 spacer had four different alleles with the highest discriminatory power (0.626) among all spacers.
Based on the comparison of our data with MST data bank, we found five MST genotypes (MST61-65) in our samples. Among these MST genotypes, four MST genotypes (MST62-65) were novel (Table 3). MST61, which was previously reported in Polish dairy cattle, was found in cattle milk from Tehran County (Capital of Iran). In this study, MST62 was the most prevalent (42.8%) MST genotype of C. burnetii. This genotype was found in six samples, including cattle milk (Tehran County), one cattle abortion (Tehran County), one goat milk (Qom County, central Iran), one goat abortion (Mahabad county, northwestern Iran), and two sheep milk (Qom County) samples. In addition, MST63 was found in two samples (one goat abortion and one sheep abortion originating from Tehran County). MST63 was closely related to MST62 (nine spacers), but this MST genotype was different from one spacer (Cox5) compared with MST62. MST64 was the second most prevalent (28.6%) MST genotype of C. burnetii among our samples, which was found in four samples, including in cattle milk (Qom County), one cattle abortion (Tehran County), and two abortion (Urmia County, northwest of Iran) samples. MST64 was different in only one spacer (Cox56) compared with MST62. Finally, MST65 was found in a cattle milk sample (Qom County), and this genotype was different in the Cox56 spacer compared with MST62 and MST63.
Analysis of our data with available data of MST genotyping of C. burnetii using the maximum composite likelihood method (Mega software) showed (Figure 2) that our novel genotypes (MST62-65) were very closely related to each other. Also, MST61 was closely related to MST20. Furthermore, the minimum spanning trees algorithm was performed on these data by extracting the data deposited in the MST database for C. burnetii and combining those data with the obtained data from the present study. MSTs analysis revealed that the new Iranian genotypes of C. burnetii (MST62-65) complement the phylogenetic tree of C. burnetii. The MST62 genotype was also identified as a node in the minimum spanning tree algorithm (Figure 3 and Figure 4). In clustering performed in this typing method based on the maximum difference in one allele, ten clonal (CC1-CC10) complexes and 15 singletons (MST38, MST53, MST30, MST37, MST9, MST10, MST54, MST13, MST60, MST44, MST46, MST49, MST16, MST17, and MST19) were created. Iranian samples were located in clonal complexes No. 4 (MST62-65) and No. 9 (MST61) (Figure 5). Moreover, in clustering performed based on the maximum difference between the two alleles, ten clonal complexes (CC1-CC10) and six singletons (MST16, MST17, MST21, MST60, MST38, and MST30) were created. Accordingly, Iranian samples were located in clonal complexes No. 6 (MST62-65) and No. 10 (MST61) (Figure 6).

4. Discussion

In the present study, the genetic diversity of C. burnetii strains in Iran was evaluated using the MST method and showed five MST genotypes in domestic animals including four novel MST genotypes. Domestic ruminants are the main source of Q fever infection in humans [17]. Therefore, it is important to understand C. burnetii prevalence and its genotypes among domestic ruminants to comprehend the epidemiological routes of infection. The MST method is a useful tool for investigating the genotypic variants of C. burnetii [8].
In the present study, 14 different samples of C. burnetii were selected (from domestic ruminants and their products in four cities) for genotyping by ten gene targets using the MST method. After analyzing the data, two new alleles were identified in Cox5 (Cox5.11 in two specimens) and Cox56 (Cox56.15 in one specimen) loci. In agreement with the present studies, Cox56 has been previously reported as highly polymorphic and variable loci that could represent new genotypes [18]. According to the new alleles in the present study, investigated samples were classified into five C. burnetii genotypes. Among identified genotypes in the present study, one genotype (MST61) has been previously described among C. burnetii strains originating from small ruminants in different parts of the world [18,19,20]. The MST61 genotype was reported for the first time in 2019 in dairy products (raw milk and cheese) obtained from cattle in Poland [20]. In the present study, MST61 was also identified in cattle milk in Tehran. In Belgium, MST61 was found in cattle abortion material, cattle stomach content, and goat milk [19]. In phylogenetic tree analysis based on C. burnetii MST typing, genotypes of Brazilian strains from goats (vaginal swab), cattle (fetus), and sheep (vaginal swab) appeared to have a close MST clone to MST61 and MST20 [18]. In MST analysis, high similarity and the common ancestor are observed between MST61 and MST20 [18,20]. Here, MST61 and MST20 are located in the same clonal complex (Figure 5 and Figure 6) in clustering analysis based on the difference between the alleles in MST genotyping. MST20 is a dominant genotype in many countries of Europe, Asia, Africa, and North America, especially in milk cattle [20,21]. However, in addition to livestock, MST20 has been identified in humans with Q fever and particularly in chronic Q fever cases from France [8]. These epidemiological studies displayed that the sequence type MST61 is predominately found in cattle but may also be transmitted to other domestic ruminants. Moreover, it should be considered a potential virulent genotype for human infections, possibly due to its strong correlation with MST20. More global studies are needed to improve these hypotheses.
Except for MST61, the other four identified genotypes (MST62-65) in the present study have not yet been reported elsewhere in the world. Therefore, there is no data about their virulence, and further research is suggested to investigate the possible pathogenesis of these genotypes in humans and livestock. MST62 was identified in milk and abortion samples of cattle and goats as well as sheep milk. The MST analysis showed a close relation between MST62 and MST12, MST18, and MST49. The MST12 has been identified in Europe and Africa from various specimens, including cattle milk (in Algeria) [22], cheese produced from the milk of sheep, goats, and cattle (in Italy) [23,24,25], and human clinical samples (in Switzerland, France, and Senegal) [22,24,25]. The MST18 was isolated from human, goat, sheep, cattle, and tick specimens in the Horn of Africa (Ethiopia) and Europe (France, Spain, Italy, Romania, Slovakia, Germany, and Poland) [24]. In agreement with other studies [26,27], MST49 is closely related to MST19 (CC9) and can be considered an ancestor of the MST20 genotype (Figure 5). However, it did not cluster with MST20.
Using the minimum spanning tree algorithm, ST62 was considered a putative ancestral genotype (Figure 3) for MST63, MST64, and MST65, which were classified in the same clonal complex (CC6; Figure 6).
In our study, MST63 had only been observed in abortion (goats and sheep) samples. In the cattle (milk and abortion) and sheep (abortion) samples, MST64 was also identified. The MST65 genotype was only detected in cattle milk. Although some samples (MB14 and MB47; AC3 and AC11; MB92 and MB98) belonged to the same host, source, and region, MST presented a distinct genotype for these specimens. For instance, samples of MB14 and MB47 were isolated from cattle milk in Qom County but classified into two different MST genotypes, including MST65 and MST64, respectively. This indicates the high genetic diversity of C. burnetii strains in Iran. In agreement with the present study, most studies worldwide have indicated various C. burnetii genotypes using MST. For instance, among 12 samples: (cattle: n = 6; sheep: n = 5; and human: n = 1) in Hungary, three MST genotypes of C. burnetii were identified [28]. Five MST patterns emerged from the analysis of C. burnetii among 20 biological samples collected from domestic ruminant farms in Italy [25]. In Asia, limited studies on the C. burnetii genotype have been performed. The MST51 genotype was reported in Saudi Arabia in an endocarditis patient [29]. In Asia, as elsewhere in the world, more genotypic studies are needed to determine the geographical distribution of C. burnetii genotypes among humans and livestock infections.

5. Conclusions

This study showed the variability of C. burnetii genotypes among domestic ruminants in Iran using MST. Comparisons of C. burnetii genotypes to the deposited data in the MST database showed that the circulating strains of C. burnetii in Iran were significantly different from those in other parts of the world. Two new alleles (Cox56.15 and Cox5.11) and novel MST genotypes (MST62-65) were reported during this study. In addition, previously described ST61 was reported in one sample. Understanding C. burnetii genotyping provides valuable information about the epidemiology of this bacterium in Iran and may help control outbreaks. Therefore, comprehensive studies on genotyping of this bacterium in Iran are recommended. In addition, further research is needed to determine the pathogenicity of novel MST genotypes in humans and livestock.

Author Contributions

Conceptualization, A.M.M., M.K. and S.E.; methodology, E.M. and S.E.; software, S.E.; validation, A.M.M., M.K. and S.E.; formal analysis, S.E. and E.M.; investigation, S.E.; resources, A.M.M. and S.E.; data curation, S.E.; writing—original draft preparation, S.E. and N.B.; writing—review and editing, S.E., J.S. and N.B.; visualization, S.E.; supervision, A.M.M. and M.K.; project administration, S.E.; funding acquisition, A.MM., E.M. and S.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Tarbiat Modarres University (Tehran, Iran), Ph.D thesis grant, Pasteur Institute of Iran, grant number 1050, and Iranian National Scientific Foundation, grant number 91004716.

Institutional Review Board Statement

The study was approved by the Ethics Committee for Biomedical Research of Tarbiat Modares University (Ethic Code: IR.TMU.REC.1395.510). The Ethics Committee for Biomedical Research of Tarbiat Modares University approved the consent procedure, the proposal, and the protocol of this study.

Informed Consent Statement

Waived: We did not directly use sampling from the patients. We used the samples available in our biobank. These samples were collected during our previous studies (10, 12-14).

Data Availability Statement

Data that support the findings of this study are available within the article and from the corresponding author upon request.

Acknowledgments

This work was supported financially by Tarbiat Modarres University (Tehran, Iran), Pasteur Institute of Iran, and Centre for Communicable Diseases Control in the Ministry of Health (grant 810) and, also, Iranian National Scientific Foundation (INSF; contract no. 91004716).

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Eldin, C.; Melenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.-L.; Maurin, M.; Raoult, D. From Q fever to Coxiella burnetii infection: A paradigm change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef]
  2. Massung, R.F.; Cutler, S.J.; Frangoulidis, D. Molecular typing of Coxiella burnetii (Q fever). In Coxiella burnetii: Recent Advances New Perspectives in Research of the Q Fever Bacterium; Toman, R., Heinzen, R., Samuel, J., Mege, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2012; Volume 984, pp. 381–396. [Google Scholar]
  3. Hemsley, C.M.; Essex-Lopresti, A.; Norville, I.H.; Titball, R.W. Correlating Genotyping Data of Coxiella burnetii with Genomic Groups. Pathogens 2021, 10, 604. [Google Scholar] [CrossRef]
  4. Larson, C.L.; Martinez, E.; Beare, P.A.; Jeffrey, B.; Heinzen, R.A.; Bonazzi, M. Right on Q: Genetics begin to unravel Coxiella burnetii host cell interactions. Future Microbiol. 2016, 11, 919–939. [Google Scholar] [CrossRef]
  5. Angelakis, E.; Raoult, D. Q fever. Vet. Microbiol. 2010, 140, 297–309. [Google Scholar] [CrossRef]
  6. D’Amato, F.; Eldin, C.; Raoult, D. The contribution of genomics to the study of Q fever. Future Microbiol. 2016, 11, 253–272. [Google Scholar] [CrossRef]
  7. Boldis, V.; Spitalska, E.; Toman, R. Molecular Typing of Coxiella burnetii: A Review of Available Methods with Major Focus on PCR-Based Techniques. In Molecular Typing in Bacterial Infections; de Filippis, I., McKee, M.L., Eds.; Humana Press: Totowa, NJ, USA, 2013; pp. 457–469. [Google Scholar]
  8. Glazunova, O.; Roux, V.; Freylikman, O.; Sekeyova, Z.; Fournous, G.; Tyczka, J.; Tokarevich, N.; Kovacova, E.; Marrie, T.J.; Raoult, D. Coxiella burnetii genotyping. Emerg. Infect. Dis. 2005, 11, 1211–1217. [Google Scholar] [PubMed]
  9. Mohabbati Mobarez, A.; Bagheri Amiri, F.; Esmaeili, S. Seroprevalence of Q fever among human and animal in Iran; A systematic review and meta-analysis. PLoS Negl. Trop. Dis. 2017, 11, e0005521. [Google Scholar] [CrossRef]
  10. Moradnejad, P.; Esmaeili, S.; Maleki, M.; Sadeghpour, A.; Kamali, M.; Rohani, M.; Ghasemi, A.; Bagheri Amiri, F.; Pasha, H.R.; Boudagh, S. Q fever endocarditis in iran. Sci. Rep. 2019, 9, 15276. [Google Scholar] [CrossRef] [PubMed]
  11. Esmaeili, S.; Mohabati Mobarez, A.; Khalili, M.; Mostafavi, E.; Moradnejad, P. Molecular prevalence of Coxiella burnetii in milk in Iran: A systematic review and meta-analysis. Trop. Anim. Health Prod. 2019, 51, 1345–1355. [Google Scholar] [CrossRef]
  12. Rahravani, M.; Moravedji, M.; Mostafavi, E.; Mohammadi, M.; Seyfi, H.; Baseri, N.; Mozoun, M.M.; Latifian, M.; Esmaeili, S.J.B.V.R. The epidemiological survey of Coxiella burnetii in small ruminants and their ticks in western Iran. BMC Vet. Res. 2022, 18, 292. [Google Scholar] [CrossRef]
  13. Mohabati Mobarez, A.; Khalili, M.; Mostafavi, E.; Esmaeili, S. Molecular detection of Coxiella burnetii infection in aborted samples of domestic ruminants in Iran. PLoS ONE 2021, 16, e0250116. [Google Scholar] [CrossRef]
  14. Esmaeili, S.; Mobarez, A.M.; Khalili, M.; Mostafavi, E. High prevalence and risk factors of Coxiella burnetii in milk of dairy animals with a history of abortion in Iran. Comp. Immunol. Microbiol. Infect. Dis. 2019, 63, 127–130. [Google Scholar] [CrossRef]
  15. Mobarez, A.M.; Mostafavi, E.; Khalili, M.; Esmaeili, S. Identification of Coxiella burnetii in raw milk of livestock animal in Iran. Int. J. Microbiol. 2021, 2021, 6632036. [Google Scholar] [CrossRef]
  16. Klee, S.R.; Tyczka, J.; Ellerbrok, H.; Franz, T.; Linke, S.; Baljer, G.; Appel, B. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 2006, 6, 2. [Google Scholar] [CrossRef]
  17. De Bruin, A.; Van der Plaats, R.; De Heer, L.; Paauwe, R.; Schimmer, B.; Vellema, P.; Van Rotterdam, B.; Van Duynhoven, Y.J.A. Detection of Coxiella burnetii DNA on small-ruminant farms during a Q fever outbreak in the Netherlands. Appl. Environ. Microbiol. 2012, 78, 1652–1657. [Google Scholar] [CrossRef]
  18. Mioni, M.d.S.R.; Sidi-Boumedine, K.; Morales Dalanezi, F.; Fernandes Joaquim, S.; Denadai, R.; Reis Teixeira, W.S.; Bahia Labruna, M.; Megid, J.J.P. New genotypes of Coxiella burnetii circulating in Brazil and Argentina. Pathogens 2019, 9, 30. [Google Scholar] [CrossRef]
  19. Tomaiuolo, S.; Boarbi, S.; Fancello, T.; Michel, P.; Desqueper, D.; Grégoire, F.; Callens, J.; Fretin, D.; Devriendt, B.; Cox, E.J.F.i.c.; et al. Phylogeography of human and animal Coxiella burnetii strains: Genetic fingerprinting of Q fever in Belgium. Front. Cell. Infect. Microbiol. 2021, 10, 625576. [Google Scholar] [CrossRef]
  20. Szymańska-Czerwińska, M.; Jodełko, A.; Zaręba-Marchewka, K.; Niemczuk, K.J.P.o. Shedding and genetic diversity of Coxiella burnetii in Polish dairy cattle. PLoS ONE 2019, 14, e0210244. [Google Scholar] [CrossRef]
  21. Olivas, S.; Hornstra, H.; Priestley, R.; Kaufman, E.; Hepp, C.; Sonderegger, D.; Handady, K.; Massung, R.; Keim, P.; Kersh, G. Massive dispersal of Coxiella burnetii among cattle across the United States. Microb. Genom. 2016, 2, e000068. [Google Scholar] [CrossRef]
  22. Menadi, S.E.; Chisu, V.; Santucciu, C.; Di Domenico, M.; Curini, V.; Masala, G.J.V.S. Serological, Molecular Prevalence and Genotyping of Coxiella burnetii in Dairy Cattle Herds in Northeastern Algeria. Vet. Sci. 2022, 9, 40. [Google Scholar] [CrossRef]
  23. Galiero, A.; Fratini, F.; Cammà, C.; Di Domenico, M.; Curini, V.; Baronti, I.; Turchi, B.; Cerri, D.J.I.j.o.f.m. Occurrence of Coxiella burnetii in goat and ewe unpasteurized cheeses: Screening and genotyping. Int. J. Food Microbiol. 2016, 237, 47–54. [Google Scholar] [CrossRef]
  24. Chochlakis, D.; Santos, A.S.; Giadinis, N.D.; Papadopoulos, D.; Boubaris, L.; Kalaitzakis, E.; Psaroulaki, A.; Kritas, S.K.; Petridou, E.I.J.B.m. Genotyping of Coxiella burnetii in sheep and goat abortion samples. BMC Microbiol. 2018, 18, 204. [Google Scholar] [CrossRef]
  25. Di Domenico, M.; Curini, V.; Di Lollo, V.; Massimini, M.; Di Gialleonardo, L.; Franco, A.; Caprioli, A.; Battisti, A.; Cammà, C.J.B.v.r. Genetic diversity of Coxiella burnetii in domestic ruminants in central Italy. BMC Vet. Res. 2018, 14, 171. [Google Scholar] [CrossRef]
  26. Hemsley, C.M.; O’Neill, P.A.; Essex-Lopresti, A.; Norville, I.H.; Atkins, T.P.; Titball, R.W.J.B.g. Extensive genome analysis of Coxiella burnetii reveals limited evolution within genomic groups. BMC Genom. 2019, 20, 441. [Google Scholar] [CrossRef]
  27. Hornstra, H.M.; Priestley, R.A.; Georgia, S.M.; Kachur, S.; Birdsell, D.N.; Hilsabeck, R.; Gates, L.T.; Samuel, J.E.; Heinzen, R.A.; Kersh, G.J.J.P.o. Rapid typing of Coxiella burnetii. PLoS ONE 2011, 6, e26201. [Google Scholar] [CrossRef]
  28. Sulyok, K.M.; Kreizinger, Z.; Hornstra, H.M.; Pearson, T.; Szigeti, A.; Dán, Á.; Balla, E.; Keim, P.S.; Gyuranecz, M.J.B.v.r. Genotyping of Coxiella burnetii from domestic ruminants and human in Hungary: Indication of various genotypes. BMC Vet. Res. 2014, 10, 107. [Google Scholar] [CrossRef]
  29. D’Amato, F.; Robert, C.; Azhar, E.; Fournier, P.-E.; Raoult, D.J.G.A. Draft genome sequence of Coxiella burnetii strain Cb196, an agent of endocarditis in Saudi Arabia. Genome Announc. 2014, 2, e01180-14. [Google Scholar] [CrossRef]
Figure 1. Geographic distribution of selected samples for Coxiella burnetii genotyping in Iran in the present study. Samples were obtained from 2 sheep in Urmia, 1 goat in Mahabad, 2 sheep, 1 goat, and 2 cattle in Qom, and 4 cattle, 1 goat, and 1 sheep in Tehran.
Figure 1. Geographic distribution of selected samples for Coxiella burnetii genotyping in Iran in the present study. Samples were obtained from 2 sheep in Urmia, 1 goat in Mahabad, 2 sheep, 1 goat, and 2 cattle in Qom, and 4 cattle, 1 goat, and 1 sheep in Tehran.
Pathogens 11 01175 g001
Figure 2. Neighbor-joining algorithm analysis of Coxiella burnetii multi-spacer sequence typing (MST) groups based on the connecting of 10 loci using computing the maximum composite likelihood method by Mega software. MSTs 61-65 are Iranian C. burnetii genotypes. MSTs 62-65 were our novel genotypes. MST61 was previously reported in Poland and Belgium. The symbol ▲ indicates novel detected genotypes in the present study (MST62-MST65), whereas the symbol ● indicates a previously reported genotype (MST61) that was also observed in the present study.
Figure 2. Neighbor-joining algorithm analysis of Coxiella burnetii multi-spacer sequence typing (MST) groups based on the connecting of 10 loci using computing the maximum composite likelihood method by Mega software. MSTs 61-65 are Iranian C. burnetii genotypes. MSTs 62-65 were our novel genotypes. MST61 was previously reported in Poland and Belgium. The symbol ▲ indicates novel detected genotypes in the present study (MST62-MST65), whereas the symbol ● indicates a previously reported genotype (MST61) that was also observed in the present study.
Pathogens 11 01175 g002
Figure 3. Multi-spacer sequence typing (MST) analysis using the minimum spanning tree algorithm for extracted data from the Coxiella burnetii database.
Figure 3. Multi-spacer sequence typing (MST) analysis using the minimum spanning tree algorithm for extracted data from the Coxiella burnetii database.
Pathogens 11 01175 g003
Figure 4. Analysis of multi-spacer sequence typing (MST) results using the minimum spanning tree algorithm for extracted data from Coxiella burnetii database based on the strain origin.
Figure 4. Analysis of multi-spacer sequence typing (MST) results using the minimum spanning tree algorithm for extracted data from Coxiella burnetii database based on the strain origin.
Pathogens 11 01175 g004
Figure 5. Clustering analysis of Coxiella burnetii in the minimum spanning tree algorithm based on the maximum difference in one allele using multi-spacer sequence typing (MST). It created ten clonal complexes (CC1-10) and fifteen singletons (MST38, MST53, MST30, MST37, MST9, MST10, MST54, MST13, MST60, MST44, MST46, MST49, MST16, MST17, and MST19).
Figure 5. Clustering analysis of Coxiella burnetii in the minimum spanning tree algorithm based on the maximum difference in one allele using multi-spacer sequence typing (MST). It created ten clonal complexes (CC1-10) and fifteen singletons (MST38, MST53, MST30, MST37, MST9, MST10, MST54, MST13, MST60, MST44, MST46, MST49, MST16, MST17, and MST19).
Pathogens 11 01175 g005
Figure 6. Clustering analysis of Coxiella burnetii in the minimum spanning tree algorithm based on the difference between the two alleles in multi-spacer sequence typing (MST). It emerged ten clonal complexes (CC1-10) and six singletons (MST16, MST17, MST21, MST60, MST38, and MST30).
Figure 6. Clustering analysis of Coxiella burnetii in the minimum spanning tree algorithm based on the difference between the two alleles in multi-spacer sequence typing (MST). It emerged ten clonal complexes (CC1-10) and six singletons (MST16, MST17, MST21, MST60, MST38, and MST30).
Pathogens 11 01175 g006
Table 1. Data of selected samples for Coxiella burnetii genotyping.
Table 1. Data of selected samples for Coxiella burnetii genotyping.
Sample IDHostSourceRegion (County)Cq *
MB14CattleMilkQom27.32
MB47CattleMilkQom25.24
MB92CattleMilkTehran29.61
MB98CattleMilkTehran27.25
AC3CattleAborted Fetus SpleenTehran29.02
AC11CattleAborted Fetus SpleenTehran27.82
MG101GoatMilkQom11.6
AG1GoatAborted Fetal FluidsTehran17.98
AG4GoatAborted Fetal FluidsMahabad31.07
MS45SheepMilkQom25.01
MS51SheepMilkQom25.46
AS3SheepAborted Fetal FluidsTehran25.5
AS25SheepAborted Fetus SpleenUrmia25.91
AS26SheepAborted Fetus SpleenUrmia26.13
* Quantification cycle.
Table 2. Oligonucleotide sequence of primers used for multi-spacer sequence typing (MST).
Table 2. Oligonucleotide sequence of primers used for multi-spacer sequence typing (MST).
SpacerForward Primer (5´–3´)Reverse Primer (5´–3´)
Cox2CAACCCTGAATACCCAAGGAGAAGCTTCTGATAGGCGGGA
Cox5CAGGAGCAAGCTTGAATGCGTGGTATGACAACCCGTCATG
Cox18CGCAGACGAATTAGCCAATCTTCGATGATCCGATGGCCTT
Cox20GATATTTATCAGCGTCAAAGCAATCTATTATTGCAATGCAAGTGG
Cox22GGGAATAAGAGAGTTAGCTCACGCAAATTTCGGCACAGACC
Cox37GGCTTGTCTGGTGTAACTGTATTCCGGGACCTTCGTTAAC
Cox51TAACGCCCGAGAGCTCAGAAGCGAGAACCGAATTGCTATC
Cox56CAAGCTCTCTGTGCCCAATATGCGCCAGAAACGCATAGG
Cox57TGGAAATGGAAGGCGGATTCGGTGGAAGGCGTAAGCCTTT
Cox61GAAGATAGAGCGGCAAGGATGGGATTTCAACTTCCGATAGA
Table 3. Results of Coxiella burnetii genotyping based on multi-spacer sequence typing (MST).
Table 3. Results of Coxiella burnetii genotyping based on multi-spacer sequence typing (MST).
Sample IDSample TypeCox 2Cox 5Cox 18Cox 20Cox 22Cox 37Cox 51Cox 56Cox 57Cox 61MST Genotype
MB92Cattle Milk32615104106561
MB98Cattle Milk3816545461162
AC3Cattle Abortion3816545461162
MG101Goat Milk3816545461162
AG4Goat Abortion3816545461162
MS45Sheep Milk3816545461162
MS51Sheep Milk3816545461162
AG1Goat Abortion311 *16545461163
AS3Sheep Abortion311 *16545461163
MB47Cattle Milk3816545961164
AC11Cattle Abortion3816545961164
AS25Sheep Abortion3816545961164
AS26Sheep Abortion3816545961164
MB14Cattle Milk381654515 ¥61165
* Novel allele for Cox 5; ¥ novel allele for Cox 56.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mohabati Mobarez, A.; Baseri, N.; Khalili, M.; Mostafavi, E.; Stenos, J.; Esmaeili, S. Genetic Diversity of Coxiella burnetii in Iran by Multi-Spacer Sequence Typing. Pathogens 2022, 11, 1175. https://doi.org/10.3390/pathogens11101175

AMA Style

Mohabati Mobarez A, Baseri N, Khalili M, Mostafavi E, Stenos J, Esmaeili S. Genetic Diversity of Coxiella burnetii in Iran by Multi-Spacer Sequence Typing. Pathogens. 2022; 11(10):1175. https://doi.org/10.3390/pathogens11101175

Chicago/Turabian Style

Mohabati Mobarez, Ashraf, Neda Baseri, Mohammad Khalili, Ehsan Mostafavi, John Stenos, and Saber Esmaeili. 2022. "Genetic Diversity of Coxiella burnetii in Iran by Multi-Spacer Sequence Typing" Pathogens 11, no. 10: 1175. https://doi.org/10.3390/pathogens11101175

APA Style

Mohabati Mobarez, A., Baseri, N., Khalili, M., Mostafavi, E., Stenos, J., & Esmaeili, S. (2022). Genetic Diversity of Coxiella burnetii in Iran by Multi-Spacer Sequence Typing. Pathogens, 11(10), 1175. https://doi.org/10.3390/pathogens11101175

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop