Atelerix algirus, the North African Hedgehog: Suitable Wild Host for Infected Ticks and Fleas and Reservoir of Vector-Borne Pathogens in Tunisia
Abstract
1. Introduction
2. Results
2.1. Investigated Hedgehogs and Infesting Arthropods
2.2. Vector-Borne Pathogen Detection in Hedgehog Biopsies and Infesting Arthropods
2.2.1. Vector-Borne Pathogen Detection in Atelerix Algirus Hedgehogs
2.2.2. Vector-Borne Pathogen Detection in Ticks
2.2.3. Vector-Borne Pathogen Detection in Fleas
2.2.4. Co-Infection in Hedgehogs, Ticks and Fleas
3. Discussion
3.1. Coxiella burnetii in Hedgehogs, Ticks and Fleas
3.2. Rickettsia spp. in Hedgehogs and Haemaphysalis erinacei Ticks
3.3. Rickettsia massiliae in Rhipicephalus sanguineus Ticks
3.4. Rickettsia massiliae in Fleas and Rickettsia lusitaniae in Rhipicephalus sanguineus
3.5. Rickettsia asembonensis in Fleas
3.6. Ehrlichia ewingii and Candidatus Ehrlichia shimanensis in Hedgehogs and Haemaphysalis erinacei Ticks
3.7. Theileria youngi and Hepatozoon sp. in Hedgehogs
3.8. Anaplasma sp. and Borrelia sp.
3.9. Bartonella spp. in Ticks and Fleas
3.10. Co-Infections in Hedgehogs, Ticks, and Fleas
4. Materials and Methods
4.1. Experimental Design
4.2. Study Location and Sample Collection
4.3. Sample Processing and DNA Extraction
4.4. DNA Pre-Amplification
4.5. High-Throughput Real-Time PCR Screening
4.6. Validation of Results by Conventional PCR, Nested PCR, and Sequencing
4.7. Phylogenetic Tree Construction
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global Trends in emerging infectious diseases. Nature 2008, 451, 990–993. [Google Scholar] [CrossRef] [Scilit]
- Dantas-Torres, F. Climate change, biodiversity, ticks and tick-borne diseases: The butterfly effect. Int. J. Parasitol. Parasites Wildl. 2015, 4, 452–461. [Google Scholar] [CrossRef] [Scilit]
- Keesing, F.; Ostfeld, R.S. Is biodiversity good for your health? Science 2015, 349, 235–236. [Google Scholar] [CrossRef] [Scilit]
- Levi, T.; Massey, A.L.; Holt, R.D.; Keesing, F.; Ostfeld, R.S.; Peres, C.A. Does biodiversity protect humans against infectious disease? Ecology 2016, 97, 536–542. [Google Scholar] [CrossRef] [Scilit]
- Hollingsworth, T.D.; Pulliam, J.R.C.; Funk, S.; Truscott, J.E.; Isham, V.; Lloyd, A.L. Seven challenges for modelling indirect transmission: Vector-borne diseases, macroparasites and neglected tropical diseases. Epidemics 2015, 10, 16–20. [Google Scholar] [CrossRef] [Scilit]
- Tomassone, L.; Berriatua, E.; De Sousa, R.; Duscher, G.G.; Mihalca, A.D.; Silaghi, C.; Sprong, H.; Zintl, A. Neglected vector-borne zoonoses in Europe: Into the wild. Vet. Parasitol. 2018, 251, 17–26. [Google Scholar] [CrossRef] [Scilit]
- Evensen, D.T. Wildlife disease can put conservation at risk. Nature 2008, 452, 282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braks, M.; Medlock, J.M.; Hubalek, Z.; Hjertqvist, M.; Perrin, Y.; Lancelot, R.; Duchyene, E.; Hendrickx, G.; Stroo, A.; Heyman, P.; et al. Vector-borne disease intelligence: Strategies to deal with disease burden and threats. Front. Public Health 2014, 2, 280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rizzoli, A.; Tagliapietra, V.; Cagnacci, F.; Marini, G.; Arnoldi, D.; Rosso, F.; Rosà, R. Parasites and wildlife in a changing world: The vector-host-pathogen interaction as a learning case. Int. J. Parasitol. Parasites Wildl. 2019, 9, 394–401. [Google Scholar] [CrossRef] [Scilit]
- Corbet, G.B. The family erinaceidae: A synthesis of its taxonomy, phylogeny, ecology and zoogeography. Mamm. Rev. 1988, 18, 117–172. [Google Scholar] [CrossRef] [Scilit]
- He, K.; Chen, J.-H.; Gould, G.C.; Yamaguchi, N.; Ai, H.-S.; Wang, Y.-X.; Zhang, Y.-P.; Jiang, X.-L. An estimation of erinaceidae phylogeny: A combined analysis approach. PloS ONE 2012, 7, e39304. [Google Scholar] [CrossRef] [Scilit]
- Reeve, N. Hedgehogs; T. & AD Poyser: London, UK, 1994; ISBN 978-0-85661-081-3. [Google Scholar]
- El-Farhati, H.; Jaziri, B.; Hizem, M.W.; Nouira, S. Distribution, bioclimatic niche and sympatry of two erinaceidae in Tunisia. Afr. J. Ecol. 2020, 58, 193–210. [Google Scholar] [CrossRef] [Scilit]
- Egli, R. Comparison of Physical Condition and Parasite Burdens in Rural, Suburban and Urban Hedgehogs Erinaceus europaeus: Implications for Conservation. Ph.D. Thesis, Universität Bern, Bern, Germany, 2004. [Google Scholar]
- Dziemian, S.; Sikora, B.; Piłacińska, B.; Michalik, J.; Zwolak, R. Ectoparasite loads in sympatric urban populations of the northern white-breasted and the European hedgehog. Parasitol. Res. 2015, 114, 2317–2323. [Google Scholar] [CrossRef] [Scilit]
- Földvári, G.; Rigó, K.; Jablonszky, M.; Biró, N.; Majoros, G.; Molnár, V.; Tóth, M. Ticks and the City: Ectoparasites of the northern white-breasted hedgehog (Erinaceus roumanicus) in an urban park. Ticks Tick Borne Dis. 2011, 2, 231–234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorgani-Firouzjaee, T.; Pour-Reza, B.; Naem, S.; Tavassoli, M. Ectoparasitic infestations of the European hedgehog (Erinaceus europaeus) in Urmia City, Iran: First report. Vet. Res. Forum 2013, 4, 191–194. [Google Scholar] [PubMed]
- Sakraoui, F.; Boukheroufa, M.; Sakraoui, W.; Madoui, M.B.E. Ectoparasitic ecology of Algerian hedgehog Ateleris algirus (Lereboullet, 1842) (Erinaceidae, Mammalia) in some localities of Edough Montain (W. Annaba, Northest Algeria). Adv. Environ. Biol. 2014, 217–222. Available online: https://link.gale.com/apps/doc/A417895203/AONE?u=anon~947afc63&sid=googleScholar&xid=e66711f2 (accessed on 12 January 2021).
- Khaldi, M.; Socolovschi, C.; Benyettou, M.; Barech, G.; Biche, M.; Kernif, T.; Raoult, D.; Parola, P. Rickettsiae in arthropods collected from the North African hedgehog (Atelerix algirus) and the desert hedgehog (Paraechinus aethiopicus) in Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 117–122. [Google Scholar] [CrossRef] [Scilit]
- Pfäffle, M.; Petney, T.; Elgas, M.; Skuballa, J.; Taraschewski, H. Tick-Induced blood loss leads to regenerative anaemia in the European hedgehog (Erinaceus europaeus). Parasitology 2009, 136, 443–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uspensky, I. Tick pests and vectors (Acari: Ixodoidea) in European towns: Introduction, persistence and management. Ticks Tick Borne Dis. 2014, 5, 41–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krawczyk, A.I.; van Leeuwen, A.D.; Jacobs-Reitsma, W.; Wijnands, L.M.; Bouw, E.; Jahfari, S.; van Hoek, A.H.A.M.; van der Giessen, J.W.B.; Roelfsema, J.H.; Kroes, M.; et al. Presence of zoonotic agents in engorged ticks and hedgehog faeces from Erinaceus europaeus in (Sub) urban areas. Parasit. Vectors 2015, 8, 210. [Google Scholar] [CrossRef] [Scilit]
- Gern, L.; Rouvinez, E.; Toutoungi, L.N.; Godfroid, E. Transmission cycles of Borrelia Burgdorferi Sensu Lato involving Ixodes ricinus and/or I. hexagonus ticks and the European hedgehog, Erinaceus europaeus, in suburban and urban areas in Switzerland. Folia Parasitol. 1997, 44, 309–314. [Google Scholar]
- Skuballa, J.; Oehme, R.; Hartelt, K.; Petney, T.; Bücher, T.; Kimmig, P.; Taraschewski, H. European hedgehogs as hosts for Borrelia Spp., Germany. Emerg. Infect. Dis. 2007, 13, 952–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skuballa, J.; Petney, T.; Pfäffle, M.; Taraschewski, H. Molecular detection of Anaplasma phagocytophilum in the European hedgehog (Erinaceus europaeus) and its ticks. Vector Borne Zoonotic Dis. 2010, 10, 1055–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silaghi, C.; Skuballa, J.; Thiel, C.; Pfister, K.; Petney, T.; Pfäffle, M.; Taraschewski, H.; Passos, L.M.F. The European hedgehog (Erinaceus europaeus)—A suitable reservoir for variants of Anaplasma phagocytophilum? Ticks Tick Borne Dis. 2012, 3, 49–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szekeres, S.; Docters van Leeuwen, A.; Tóth, E.; Majoros, G.; Sprong, H.; Földvári, G. Road-killed mammals provide insight into tick-borne bacterial pathogen communities within urban habitats. Transbound Emerg. Dis. 2019, 66, 277–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schönbächler, K.; Hatt, J.; Silaghi, C.; Merz, N.; Fraefel, C.; Bachofen, C. Confirmation of tick-borne encephalitis virus in an European hedgehog (Erinaceus europaeus). Schweiz Arch. Tierheilkd 2019, 161, 23–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Földvári, G.; Jahfari, S.; Rigó, K.; Jablonszky, M.; Szekeres, S.; Majoros, G.; Tóth, M.; Molnár, V.; Coipan, E.C.; Sprong, H. Candidatus neoehrlichia mikurensis and Anaplasma Phagocytophilum in urban hedgehogs. Emerg. Infect. Dis. 2014, 20, 496–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, X.Q.; Xiao, X.; Liu, J.W.; Han, H.J.; Qin, X.R.; Lei, S.C.; Yu, X.J. Occurrence and genotyping of Coxiella burnetii in hedgehogs in China. Vector Borne Zoonotic Dis. 2020, 20, 580–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bitam, I.; Rolain, J.-M.; Kernif, T.; Baziz, B.; Parola, P.; Raoult, D. Bartonella species detected in rodents and hedgehogs from Algeria. Clin. Microbiol. Infect. 2009, 15, 102–103. [Google Scholar] [CrossRef] [Scilit]
- Leulmi, H.; Aouadi, A.; Bitam, I.; Bessas, A.; Benakhla, A.; Raoult, D.; Parola, P. Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria. Parasit. Vectors 2016, 9, 27. [Google Scholar] [CrossRef] [Scilit]
- Tomás-Pérez, M.; Khaldi, M.; Riera, C.; Mozo-León, D.; Ribas, A.; Hide, M.; Barech, G.; Benyettou, M.; Seghiri, K.; Doudou, S.; et al. First report of natural infection in hedgehogs with Leishmania major, a possible reservoir of zoonotic cutaneous leishmaniasis in Algeria. Acta Trop. 2014, 135, 44–49. [Google Scholar] [CrossRef] [Scilit]
- Chemkhi, J.; Souguir, H.; Ali, I.B.H.; Driss, M.; Guizani, I.; Guerbouj, S. Natural infection of Algerian hedgehog, Atelerix algirus (Lereboullet 1842) with Leishmania parasites in Tunisia. Acta Trop. 2015, 150, 42–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souguir-Omrani, H.; Chemkhi, J.; Fathallah-Mili, A.; Saadi-BenAoun, Y.; BelHadjAli, I.; Guizani, I.; Guerbouj, S. Paraechinus aethiopicus (Ehrenberg 1832) and Atelerix algirus (Lereboullet 1842) hedgehogs: Possible reservoirs of endemic leishmaniases in Tunisia. Infect. Genet. Evol. 2018, 63, 219–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Estrada-Peña, A.; Gray, J.S.; Kahl, O.; Lane, R.S.; Nijhof, A.M. Research on the ecology of ticks and tick-borne pathogens—Methodological principles and caveats. Front. Cell. Infect. Microbiol. 2013, 3, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riley, P.Y.; Chomel, B.B. Hedgehog zoonoses. Emerg. Infect. Dis. 2005, 11, 1–5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sixl, W.; Köck, M.; Withalm, H.; Stünzner, D. Serological investigations of the hedgehog (Erinaceus europaeus) in Styria. Geogr. Med. Suppl. 1989, 2, 105–108. [Google Scholar]
- Medkour, H.; Laidoudi, Y.; Marié, J.-L.; Fenollar, F.; Davoust, B.; Mediannikov, O. Molecular investigation of vector-borne pathogens in red foxes (Vulpes vulpes) from southern france. J. Wildl. Dis. 2020, 56, 837–850. [Google Scholar] [CrossRef] [Scilit]
- Bártová, E.; Kučerová, H.L.; Žákovská, A.; Budíková, M.; Nejezchlebová, H. Coxiella burnetii and Francisella tularensis in wild small mammals from the Czech Republic. Ticks Tick Borne Dis. 2020, 11, 101350. [Google Scholar] [CrossRef] [Scilit]
- Tokarevich, N.K.; Panferova, Y.A.; Freylikhman, O.A.; Blinova, O.V.; Medvedev, S.G.; Mironov, S.V.; Grigoryeva, L.A.; Tretyakov, K.A.; Dimova, T.; Zaharieva, M.M.; et al. Coxiella burnetii in ticks and wild birds. Ticks Tick Borne Dis. 2019, 10, 377–385. [Google Scholar] [CrossRef] [Scilit]
- Angelakis, E.; Raoult, D. Q Fever. Vet. Microbiol. 2010, 140, 297–309. [Google Scholar] [CrossRef] [Scilit]
- Loftis, A.D.; Reeves, W.K.; Szumlas, D.E.; Abbassy, M.M.; Helmy, I.M.; Moriarity, J.R.; Dasch, G.A. Surveillance of Egyptian fleas for agents of public health significance: Anaplasma, Bartonella, Coxiella, Ehrlichia, Rickettsia, and Yersinia pestis. Am. J. Trop. Med. Hyg. 2006, 75, 41–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Psaroulaki, A.; Chochlakis, D.; Ioannou, I.; Angelakis, E.; Tselentis, Y. Presence of Coxiella burnetii in fleas in Cyprus. Vector Borne Zoonotic Dis. 2014, 14, 685–687. [Google Scholar] [CrossRef] [Scilit]
- Watanabe, M.; Nakao, R.; Amin-Babjee, S.M.; Maizatul, A.M.; Youn, J.H.; Qiu, Y.; Sugimoto, C.; Watanabe, M. Molecular screening for Rickettsia, anaplasmataceae and Coxiella burnetii in Rhipicephalus sanguineus ticks from Malaysia. Trop. Biomed. 2015, 32, 390–398. [Google Scholar] [PubMed]
- Mtshali, K.; Nakao, R.; Sugimoto, C.; Thekisoe, O. Occurrence of Coxiella burnetii, Ehrlichia canis, Rickettsia species and Anaplasma phagocytophilum-like bacterium in ticks collected from dogs and cats in South Africa. J. South Afr. Vet. Assoc. 2017, 88, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Mantovani, A.; Benazzi, P. The isolation of Coxiella burnetii from Rhipicephalus sanguineus on naturally infected dogs. J. Am. Vet. Med. Assoc. 1953, 122, 117–118. [Google Scholar] [PubMed]
- Dantas-Torres, F. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): From taxonomy to control. Vet. Parasitol. 2008, 152, 173–185. [Google Scholar] [CrossRef] [Scilit]
- Selmi, R.; Mamlouk, A.; Ben Yahia, H.; Abdelaali, H.; Ben Said, M.; Sellami, K.; Daaloul-Jedidi, M.; Jemli, M.H.; Messadi, L. Coxiella burnetii in Tunisian dromedary camels (Camelus dromedarius): Seroprevalence, associated risk factors and seasonal dynamics. Acta Trop. 2018, 188, 234–239. [Google Scholar] [CrossRef] [Scilit]
- Selmi, R.; Ben Said, M.; Mamlouk, A.; Ben Yahia, H.; Messadi, L. Molecular detection and genetic characterization of the potentially pathogenic Coxiella burnetii and the endosymbiotic Candidatus midichloria mitochondrii in ticks infesting camels (Camelus dromedarius) from Tunisia. Microb. Pathog. 2019, 136, 103655. [Google Scholar] [CrossRef] [Scilit]
- Delaloye, J.; Pillonel, T.; Smaoui, M.; Znazen, A.; Abid, L.; Greub, G. Culture-independent genome sequencing of Coxiella burnetii from a native heart valve of a Tunisian patient with severe infective endocarditis. New Microbes New Infect. 2018, 21, 31–35. [Google Scholar] [CrossRef] [Scilit]
- Duron, O.; Jourdain, E.; McCoy, K.D. Diversity and global distribution of the Coxiella intracellular bacterium in seabird ticks. Ticks Tick Borne Dis. 2014, 5, 557–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buysse, M.; Plantard, O.; McCoy, K.D.; Duron, O.; Menard, C. Tissue localization of Coxiella-like endosymbionts in three European tick species through fluorescence in situ hybridization. Ticks Tick Borne Dis. 2019, 10, 798–804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duron, O.; Sidi-Boumedine, K.; Rousset, E.; Moutailler, S.; Jourdain, E. The importance of ticks in Q fever transmission: What has (and has not) been demonstrated? Trends Parasitol. 2015, 31, 536–552. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Fan, M.Y.; Bi, D.Z. A molecular epidemiologic investigation of north Asia fever in scenic spots of Beijing suburb. Zhonghua Liu Xing Bing Xue Za Zhi 1997, 18, 197–200. [Google Scholar]
- Orkun, Ö.; Çakmak, A.; Nalbantoğlu, S.; Karaer, Z. Molecular detection of a novel Babesia Sp. and pathogenic spotted fever group rickettsiae in ticks collected from hedgehogs in Turkey: Haemaphysalis erinacei, a novel candidate vector for the genus Babesia. Infect. Genet. Evol. 2019, 69, 190–198. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.P.; Mu, L.M.; Xu, J.; Jiang, S.H.; Wang, A.D.; Chen, C.F.; Guo, G.; Zhang, W.J.; Wang, Y.Z. Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border. Parasit. Vectors 2015, 8, 461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoogstraal, H. Notes on African Haemaphysalis ticks. I. The Mediterraneanlittoral hedgegog parasite H. erinacei Pavesi, 1884 (Ixodoidea, Ixodidae). J. Parasitol. 1955, 41, 221–233. [Google Scholar] [CrossRef] [Scilit]
- Bursali, A.; Keskin, A.; Tekin, S. A review of the ticks (Acari: Ixodida) of Turkey: Species diversity, hosts and geographical distribution. Exp. Appl. Acarol. 2012, 57, 91–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Znazen, A.; Khrouf, F.; Elleuch, N.; Lahiani, D.; Marrekchi, C.; M’Ghirbi, Y.; Ben Jemaa, M.; Bouattour, A.; Hammami, A. Multispacer typing of Rickettsia isolates from humans and ticks in Tunisia revealing new genotypes. Parasit. Vectors 2013, 6, 367. [Google Scholar] [CrossRef] [Scilit]
- Khrouf, F.; M’Ghirbi, Y.; Znazen, A.; Ben Jemaa, M.; Hammami, A.; Bouattour, A. Detection of Rickettsia in Rhipicephalus sanguineus ticks and Ctenocephalides felis fleas from southeastern Tunisia by reverse line blot assay. J. Clin. Microbiol. 2014, 52, 268–274. [Google Scholar] [CrossRef] [Scilit]
- Marié, J.L.; Davoust, B.; Socolovschi, C.; Raoult, D.; Parola, P. Molecular detection of rickettsial agents in ticks and fleas collected from a European hedgehog (Erinaceus europaeus) in Marseilles, France. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 77–79. [Google Scholar] [CrossRef] [Scilit]
- Marié, J.L.; Davoust, B.; Socolovschi, C.; Mediannikov, O.; Roqueplo, C.; Beaucournu, J.C.; Raoult, D.; Parola, P. Rickettsiae in arthropods collected from red foxes (Vulpes Vulpes) in France. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 59–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernández de Mera, I.G.; Zivkovic, Z.; Bolaños, M.; Carranza, C.; Pérez-Arellano, J.L.; Gutiérrez, C.; de la Fuente, J. Rickettsia massiliae in the Canary Islands. Emerg. Infect. Dis. 2009, 15, 1869–1870. [Google Scholar] [CrossRef] [Scilit]
- Toledo, Á.; Olmeda, A.S.; Escudero, R.; Jado, I.; Valcárcel, F.; Casado-Nistal, M.A.; Rodríguez-Vargas, M.; Gil, H.; Anda, P. Tick-borne zoonotic bacteria in ticks collected from Central Spain. Am. J. Trop. Med. Hyg. 2009, 81, 67–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Socolovschi, C.; Reynaud, P.; Kernif, T.; Raoult, D.; Parola, P. Rickettsiae of spotted fever group, Borrelia valaisiana, and Coxiella burnetii in ticks on passerine birds and mammals from the Camargue in the South of France. Ticks Tick Borne Dis. 2012, 3, 355–360. [Google Scholar] [CrossRef] [Scilit]
- García-García, J.C.; Portillo, A.; Núñez, M.J.; Santibáñez, S.; Castro, B.; Oteo, J.A. A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med. Hyg. 2010, 82, 691–692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cascio, A.; Torina, A.; Valenzise, M.; Blanda, V.; Camarda, N.; Bombaci, S.; Iaria, C.; De Luca, F.; Wasniewska, M. Scalp eschar and neck lymphadenopathy caused by Rickettsia massiliae. Emerg. Infect. Dis. 2013, 19, 836–837. [Google Scholar] [CrossRef] [Scilit]
- Zaharia, M.; Popescu, C.P.; Florescu, S.A.; Ceausu, E.; Raoult, D.; Parola, P.; Socolovschi, C. Rickettsia massiliae infection and SENLAT syndrome in Romania. Ticks Tick Borne Dis. 2016, 7, 759–762. [Google Scholar] [CrossRef] [Scilit]
- Vitale, G.; Mansueto, S.; Rolain, J.-M.; Raoult, D. Rickettsia massiliae human isolation. Emerg. Infect. Dis. 2006, 12, 174–175. [Google Scholar] [CrossRef] [Scilit]
- Fedele, K.; Poh, K.C.; Brown, J.E.; Jones, A.; Durden, L.A.; Tiffin, H.S.; Pagac, A.; Li, A.Y.; Machtinger, E.T. Host distribution and pathogen infection of fleas (Siphonaptera) recovered from small mammals in Pennsylvania. J. Vector Ecol. 2020, 45, 32–44. [Google Scholar] [CrossRef] [Scilit]
- Torina, A.; Blanda, V.; Antoci, F.; Scimeca, S.; D’Agostino, R.; Scariano, E.; Piazza, A.; Galluzzo, P.; Giudice, E.; Caracappa, S. A Molecular survey of Anaplasma Spp., Rickettsia Spp., Ehrlichia canis and Babesia microti in foxes and fleas from Sicily. Transbound Emerg Dis. 2013, 60, 125–130. [Google Scholar] [CrossRef] [Scilit]
- Lindsay, L.R.; Barker, I.K.; Surgeoner, G.A.; McEwen, S.A.; Elliott, L.A.; Kolar, J. Apparent incompetence of Dermacentor variabilis (Acari: Ixodidae) and fleas (Insecta: Siphonaptera) as vectors of Borrelia burgdorferi in an Ixodes dammini endemic area of Ontario, Canada. J. Med. Entomol. 1991, 28, 750–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Netušil, J.; Žákovská, A.; Vostal, K.; Norek, A.; Stanko, M. The occurrence of Borrelia burgdorferi Sensu Lato in certain ectoparasites (Mesostigmata, Siphonaptera) of Apodemus flavicollis and Myodes glareolus in chosen localities in the Czech Republic. Acta Parasit. 2013, 58, 337–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gern, L.; Rais, O. Efficient transmission of Borrelia burgdorferi between cofeeding Ixodes ricinus ticks (Acari: Ixodidae). J. Med. Entomol. 1996, 33, 189–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patrican, L.A. Acquisition of Lyme disease spirochetes by cofeeding Ixodes scapularis ticks. Am. J. Trop. Med. Hyg. 1997, 57, 589–593. [Google Scholar] [CrossRef] [Scilit]
- Belli, A.; Sarr, A.; Rais, O.; Rego, R.O.M.; Voordouw, M.J. Ticks infected via co-feeding transmission can transmit Lyme borreliosis to vertebrate hosts. Sci. Rep. 2017, 7, 5006. [Google Scholar] [CrossRef] [Scilit]
- Brown, L.D.; Christofferson, R.C.; Banajee, K.H.; Del Piero, F.; Foil, L.D.; Macaluso, K.R. Cofeeding intra- and interspecific transmission of an Eemerging Insect-Borne Rickettsial Pathogen. Mol. Ecol. 2015, 24, 5475–5489. [Google Scholar] [CrossRef] [Scilit]
- Milhano, N.; Palma, M.; Marcili, A.; Núncio, M.S.; de Carvalho, I.L.; de Sousa, R. Rickettsia lusitaniae sp. Nov. Isolated from the soft tick Ornithodoros erraticus (Acarina: Argasidae). Comp. Immunol. Microbiol. Infect. Dis. 2014, 37, 189–193. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Montes, S.; Guzmán-Cornejo, C.; Martínez-Nájera, Y.; Becker, I.; Venzal, J.M.; Labruna, M.B. Rickettsia lusitaniae associated with Ornithodoros yumatensis (Acari: Argasidae) from two caves in Yucatan, Mexico. Ticks Tick Borne Dis. 2016, 7, 1097–1101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, S.; Yang, M.; Liu, G.; Hornok, S.; Zhao, S.; Sang, C.; Tan, W.; Wang, Y. Rickettsiae in the common pipistrelle Pipistrellus Pipistrellus (Chiroptera: Vespertilionidae) and the bat soft tick Argas vespertilionis (Ixodida: Argasidae). Parasit. Vectors 2020, 13, 10. [Google Scholar] [CrossRef] [Scilit]
- Hornok, S.; Szőke, K.; Meli, M.L.; Sándor, A.D.; Görföl, T.; Estók, P.; Wang, Y.; Tu, V.T.; Kováts, D.; Boldogh, S.A.; et al. Molecular detection of vector-borne bacteria in bat ticks (Acari: Ixodidae, Argasidae) from eight countries of the old and new worlds. Parasit. Vectors 2019, 12. [Google Scholar] [CrossRef] [Scilit]
- Bouattour, A.; Garnier, M.; M’Ghirbi, Y.; Sarih, M.; Gern, L.; Ferquel, E.; Postic, D.; Cornet, M. Borrelia crocidurae infection of Ornithodoros erraticus (Lucas, 1849) ticks in Tunisia. Vector Borne Zoonotic Dis. 2010, 10, 825–830. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilles, J.; Silaghi, C.; Just, F.T.; Pradel, I.; Pfister, K. Polymerase chain reaction detection of Rickettsia felis-like organism in Archaeopsylla erinacei (Siphonaptera: Pulicidae) from Bavaria, Germany. J. Med. Entomol. 2009, 46, 703–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barradas, P.F.; Mesquita, J.R.; Mateus, T.L.; Ferreira, P.; Amorim, I.; Gärtner, F.; de Sousa, R. Molecular detection of Rickettsia Spp. in ticks and fleas collected from rescued hedgehogs (Erinaceus europaeus) in Portugal. Exp. Appl. Acarol. 2021, 83, 449–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Sousa, R.; Edouard-Fournier, P.; Santos-Silva, M.; Amaro, F.; Bacellar, F.; Raoult, D. Molecular detection of Rickettsia felis, Rickettsia typhi and two genotypes closely related to Bartonella elizabethae. Am. J. Trop. Med. Hyg. 2006, 75, 727–731. [Google Scholar] [CrossRef] [Scilit]
- Gilles, J.; Just, F.T.; Silaghi, C.; Pradel, I.; Passos, L.M.F.; Lengauer, H.; Hellmann, K.; Pfister, K. Rickettsia felis in Fleas, Germany. Emerg. Infect. Dis. 2008, 14, 1294–1296. [Google Scholar] [CrossRef] [Scilit]
- Maina, A.N.; Jiang, J.; Luce-Fedrow, A.; St. John, H.K.; Farris, C.M.; Richards, A.L. Worldwide presence and features of flea-borne Rickettsia asembonensis. Front. Vet. Sci. 2019, 5, 334. [Google Scholar] [CrossRef] [Scilit]
- Maina, A.N.; Luce-Fedrow, A.; Omulo, S.; Hang, J.; Chan, T.-C.; Ade, F.; Jima, D.D.; Ogola, E.; Ge, H.; Breiman, R.F.; et al. Isolation and characterization of a novel Rickettsia species (Rickettsia asembonensis sp. Nov.) obtained from cat fleas (Ctenocephalides felis). Int. J. Syst. Evol. Microbiol. 2016, 66, 4512–4517. [Google Scholar] [CrossRef] [Scilit]
- Eremeeva, M.E.; Capps, D.; McBride, C.L.; Williams-Newkirk, A.J.; Dasch, G.A.; Salzer, J.S.; Beati, L.; Durden, L.A. Detection of Rickettsia asembonensis in fleas (Siphonaptera: Pulicidae, Ceratophyllidae) collected in five counties in Georgia, United States. J. Med. Entomol. 2020, 57, 1246–1253. [Google Scholar] [CrossRef] [Scilit]
- Silva, A.B.; Vizzoni, V.F.; Costa, A.P.; Costa, F.B.; Moraes-Filho, J.; Labruna, M.B.; Gazêta, G.S.; de Maria Seabra Nogueira, R. First report of a Rickettsia asembonensis related infecting fleas in Brazil. Acta Trop. 2017, 172, 44–49. [Google Scholar] [CrossRef] [Scilit]
- Colonia, C.B.; Ramírez-Hernández, A.; Gil-Mora, J.; Agudelo, J.C.; Villa, G.J.C.; Pino, C.; Betancourt-Ruiz, P.; Cárdenas, J.E.P.; Blanton, L.S.; Hidalgo, M. Flea-borne Rickettsia species in fleas, Caldas Department, Colombia. J. Infect. Dev. Ctries. 2020, 14, 1155–1163. [Google Scholar] [CrossRef] [Scilit]
- Nziza, J.; Tumushime, J.C.; Cranfield, M.; Ntwari, A.E.; Modrý, D.; Mudakikwa, A.; Gilardi, K.; Šlapeta, J. Fleas from domestic dogs and rodents in Rwanda Carry Rickettsia asembonensis and Bartonella tribocorum. Med. Vet. Entomol. 2019, 33, 177–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nataraj, N.; Muthuraman, K.; Sundaram, D.; Ayyanar, E.; Ashokkumar, M.; Kasinathan, G.; Devaraju, P. Molecular detection of Candidatus Rickettsia asembonensis in fleas collected from pets and domestic animals in Puducherry, India. Med. Vet. Entomol. 2020, 34, 498–502. [Google Scholar] [CrossRef] [Scilit]
- Moonga, L.C.; Hayashida, K.; Nakao, R.; Lisulo, M.; Kaneko, C.; Nakamura, I.; Eshita, Y.; Mweene, A.S.; Namangala, B.; Sugimoto, C.; et al. Molecular detection of Rickettsia felis in dogs, rodents and cat fleas in Zambia. Parasit. Vectors 2019, 12, 168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Montes, S.; Salceda-Sánchez, B.; Ballados-González, G.G.; Valtierra-Alzaga, L.; Soto-Gutiérrez, J.J.; Becker, I. Rickettsia asembonensis: New records associated with the cat flea (Ctenocephalides felis felis) in Mexico. Vet. Parasitol. Reg. Stud. Rep. 2020, 21, 100433. [Google Scholar] [CrossRef] [Scilit]
- Otiang, E.; Chen, D.; Jiang, J.; Maina, A.N.; Farris, C.M.; Luce-Fedrow, A.; Richards, A.L. Pathogen carriage by peri-domestic fleas in Western Kenya. Vector Borne Zoonotic Dis. 2021, 21, 256–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, F.C.; Fonseca, D.M.; Hamilton, G.; Price, D. Metagenomic analysis of human-biting cat fleas in urban northeastern United States of America reveals an emerging zoonotic pathogen. Sci. Rep. 2020, 10, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Dall’Agnol, B.; Souza, U.; Webster, A.; Weck, B.; Stenzel, B.; Labruna, M.; Klafke, G.; Martins, J.R.; Ferreira, C.A.S.; Reck, J. “Candidatus Rickettsia asemboensis” in Rhipicephalus sanguineus ticks, Brazil. Acta Trop. 2017, 167, 18–20. [Google Scholar] [CrossRef] [Scilit]
- Low, V.L.; Prakash, B.K.; Tan, T.K.; Sofian-Azirun, M.; Anwar, F.H.K.; Vinnie-Siow, W.Y.; AbuBakar, S. Pathogens in ectoparasites from free-ranging animals: Infection with Rickettsia asembonensis in ticks, and a potentially new species of Dipylidium in fleas and lice. Vet. Parasitol. 2017, 245, 102–105. [Google Scholar] [CrossRef] [Scilit]
- Tay, S.T.; Koh, F.X.; Kho, K.L.; Sitam, F.T. Rickettsial infections in Monkeys, Malaysia. Emerg. Infect. Dis. 2015, 21, 545–547. [Google Scholar] [CrossRef] [Scilit]
- Phoosangwalthong, P.; Hii, S.F.; Kamyingkird, K.; Kengradomkij, C.; Pinyopanuwat, N.; Chimnoi, W.; Traub, R.J.; Inpankaew, T. Cats as potential mammalian reservoirs for Rickettsia sp. genotype RF2125 in Bangkok, Thailand. Vet. Parasitol. Reg. Stud. Rep. 2018, 13, 188–192. [Google Scholar] [CrossRef] [Scilit]
- Pomykal, J. A Case of infestation of humans with fleas Archaeopsylla erinacei (Siphonaptera, Pulicidae). Folia Parasitol. 1985, 32, 348. [Google Scholar]
- Greigert, V.; Brunet, J.; Ouarti, B.; Laroche, M.; Pfaff, A.W.; Henon, N.; Lemoine, J.-P.; Mathieu, B.; Parola, P.; Candolfi, E.; et al. The trick of the hedgehog: Case report and short review about Archaeopsylla erinacei (Siphonaptera: Pulicidae) in human health. J. Med. Entomol. 2020, 57, 318–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palacios-Salvatierra, R.; Cáceres-Rey, O.; Vásquez-Domínguez, A.; Mosquera-Visaloth, P.; Anaya-Ramírez, E. Rickettsial species in human cases with non-specific acute febrile syndrome in Peru. Rev. Peru. Med. Exp. Salud Publica 2018, 35, 630–635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kho, K.L.; Koh, F.X.; Singh, H.K.L.; Zan, H.A.M.; Kukreja, A.; Ponnampalavanar, S.; Tay, S.T. Spotted fever group rickettsioses and murine typhus in a Malaysian teaching hospital. Am. J. Trop. Med. Hyg. 2016, 95, 765–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, L.-Z.; Lei, S.-C.; Yan, Z.-J.; Xiao, X.; Liu, J.-W.; Gong, X.-Q.; Yu, H.; Yu, X.-J. Detection of multiple intracellular bacterial pathogens in Haemaphysalis Flava ticks collected from hedgehogs in Central China. Pathogens 2021, 10, 115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarih, M.; M’Ghirbi, Y.; Bouattour, A.; Gern, L.; Baranton, G.; Postic, D. Detection and identification of Ehrlichia spp. in ticks collected in Tunisia and Morocco. J. Clin. Microbiol. 2005, 43, 1127–1132. [Google Scholar] [CrossRef] [Scilit]
- Kawahara, M.; Rikihisa, Y.; Lin, Q.; Isogai, E.; Tahara, K.; Itagaki, A.; Hiramitsu, Y.; Tajima, T. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl. Environ. Microbiol. 2006, 72, 1102–1109. [Google Scholar] [CrossRef] [Scilit]
- Koh, F.X.; Kho, K.L.; Kisomi, M.G.; Wong, L.P.; Bulgiba, A.; Tan, P.E.; Lim, Y.A.L.; Nizam, Q.N.H.; Panchadcharam, C.; Tay, S.T. Ehrlichia and Anaplasma infections: Serological evidence and tick surveillance in Peninsular Malaysia. J. Med. Entomol. 2018, 55, 269–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsumoto, K.; Takeuchi, T.; Yokoyama, N.; Katagiri, Y.; Ooshiro, M.; Zakimi, S.; Gaowa, N.; Kawamori, F.; Ohashi, N.; Inokuma, H. Detection of the new Ehrlichia species closely related to Ehrlichia ewingii from Haemaphysalis longicornis in Yonaguni Island, Okinawa, Japan. J. Vet. Med. Sci. 2011, 73, 1485–1488. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, O.B.; Amor, N.M.S.; Omer, S.A.; Alagaili, A.N. Molecular detection and characterization of Theileria sp. from hedgehogs (Paraechinus aethiopicus) in Saudi Arabia. Lett. Appl. Microbiol. 2021, 74, 476–483. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Liu, Q.; Jiao, F.-C.; Xu, B.-L.; Zhou, X.-N. Detection of piroplasms infection in sheep, dogs and hedgehogs in Central China. Infect. Dis. Poverty 2014, 3, 18. [Google Scholar] [CrossRef] [Scilit]
- Al-Fahdi, A.; Alqamashoui, B.; Al-Hamidhi, S.; Kose, O.; Tageldin, M.H.; Bobade, P.; Johnson, E.H.; Hussain, A.-R.; Karagenc, T.; Tait, A.; et al. Molecular surveillance of Theileria parasites of livestock in Oman. Ticks Tick Borne Dis. 2017, 8, 741–748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bishop, R.; Musoke, A.; Morzaria, S.; Gardner, M.; Nene, V. Theileria: Intracellular protozoan parasites of wild and domestic ruminants transmitted by ixodid ticks. Parasitology 2004, 129, S271–S283. [Google Scholar] [CrossRef] [Scilit]
- Hao, L.; Yuan, D.; Li, S.; Jia, T.; Guo, L.; Hou, W.; Lu, Z.; Mo, X.; Yin, J.; Yang, A.; et al. Detection of Theileria spp. in ticks, sheep keds (Melophagus ovinus), and livestock in the Eastern Tibetan Plateau, China. Parasitol. Res. 2020, 119, 2641–2648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- King’ori, E.; Obanda, V.; Chiyo, P.I.; Soriguer, R.C.; Morrondo, P.; Angelone, S. Molecular identification of Ehrlichia, Anaplasma, Babesia and Theileria in African elephants and their ticks. PLoS ONE 2019, 14, e0226083. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Li, X.; Liu, J.; Wang, J.; Jia, D.; Liu, A.; He, Z.; Guan, G.; Liu, Z.; Liu, G.; et al. First report of Theileria infection of bactrian camels (Camelus bactrianus) in Xinjiang, China. Acta Parasitol. 2019, 64, 923–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rjeibi, M.R.; Amairia, S.; Rouatbi, M.; Ben Salem, F.; Mabrouk, M.; Gharbi, M. Molecular prevalence and genetic characterization of piroplasms in dogs from Tunisia. Parasitology 2016, 143, 1622–1628. [Google Scholar] [CrossRef] [Scilit]
- M’ghirbi, Y.; Ros-García, A.; Iribar, P.; Rhaim, A.; Hurtado, A.; Bouattour, A.A. Molecular study of tick-borne haemoprotozoan parasites (Theileria and Babesia) in small ruminants in northern Tunisia. Vet. Parasitol. 2013, 198, 72–77. [Google Scholar] [CrossRef] [Scilit]
- Ros-García, A.; M’ghirbi, Y.; Hurtado, A.; Bouattour, A. Prevalence and genetic diversity of piroplasm species in horses and ticks from Tunisia. Infect. Genet. Evol. 2013, 17, 33–37. [Google Scholar] [CrossRef] [Scilit]
- de Sousa, K.C.M.; Fernandes, M.P.; Herrera, H.M.; Benevenute, J.L.; Santos, F.M.; Rocha, F.L.; Barreto, W.T.G.; Macedo, G.C.; Campos, J.B.; Martins, T.F.; et al. Molecular detection of Hepatozoon spp. in domestic dogs and wild mammals in Southern Pantanal, Brazil with implications in the transmission route. Vet. Parasitol. 2017, 237, 37–46. [Google Scholar] [CrossRef] [Scilit]
- Dezdek, D.; Vojta, L.; Curković, S.; Lipej, Z.; Mihaljević, Z.; Cvetnić, Z.; Beck, R. Molecular detection of Theileria annae and Hepatozoon canis in foxes (Vulpes vulpes) in Croatia. Vet. Parasitol. 2010, 172, 333–336. [Google Scholar] [CrossRef] [Scilit]
- Modrý, D.; Beck, R.; Hrazdilová, K.; Baneth, G. A Review of methods for detection of Hepatozoon infection in carnivores and arthropod vectors. Vector Borne Zoonotic Dis. 2017, 17, 66–72. [Google Scholar] [CrossRef] [Scilit]
- Morelli, S.; Diakou, A.; Traversa, D.; Di Gennaro, E.; Simonato, G.; Colombo, M.; Dimzas, D.; Grillini, M.; Frangipane di Regalbono, A.; Beugnet, F.; et al. First record of Hepatozoon Spp. in domestic cats in Greece. Ticks Tick Borne Dis. 2021, 12, 101580. [Google Scholar] [CrossRef] [Scilit]
- Bouattour, A.; Chabchoub, A.; Hajjaji, I.; M’ghirbi, Y. Hepatozoon canis and Babesia vogeli infections of dogs in Tunisia. Vet. Parasitol. Reg. Stud. Rep. 2021, 23, 100512. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Liu, Z.; Niu, Q.; Liu, J.; Xie, J.; Chen, Q.; Chen, Z.; Guan, G.; Liu, G.; Luo, J.; et al. Evaluation of different nested PCRs for detection of Anaplasma phagocytophilum in ruminants and ticks. BMC Vet. Res. 2016, 12, 35. [Google Scholar] [CrossRef] [Scilit]
- Santos, A.S.; Santos-Silva, M.M.; de Sousa, R.; Bacellar, F.; Dumler, J.S. PCR-based survey of Anaplasma phagocytophilum in portuguese ticks (Acari: Ixodidae). Vector Borne Zoonotic Dis. 2009, 9, 33–40. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.-J.; Diao, X.-N.; Zhao, G.-Y.; Chen, M.-H.; Xiong, Y.; Shi, M.; Fu, W.-M.; Guo, Y.-J.; Pan, B.; Chen, X.-P.; et al. Extensive diversity of rickettsiales bacteria in two species of ticks from China and the evolution of the rickettsiales. BMC Evol. Biol. 2014, 14, 167. [Google Scholar] [CrossRef] [Scilit]
- Guo, W.-P.; Tian, J.-H.; Lin, X.-D.; Ni, X.-B.; Chen, X.-P.; Liao, Y.; Yang, S.-Y.; Dumler, J.S.; Holmes, E.C.; Zhang, Y.-Z. Extensive genetic diversity of rickettsiales bacteria in multiple mosquito species. Sci. Rep. 2016, 6, 38770. [Google Scholar] [CrossRef] [Scilit]
- M’ghirbi, Y.; Bèji, M.; Oporto, B.; Khrouf, F.; Hurtado, A.; Bouattour, A. Anaplasma marginale and A. phagocytophilum in Cattle in Tunisia. Parasit. Vectors 2016, 9, 556. [Google Scholar] [CrossRef] [Scilit]
- Jahfari, S.; Ruyts, S.C.; Frazer-Mendelewska, E.; Jaarsma, R.; Verheyen, K.; Sprong, H. Melting pot of tick-borne zoonoses: The European hedgehog contributes to the maintenance of various tick-borne diseases in natural cycles urban and suburban areas. Parasit. Vectors 2017, 10, 134. [Google Scholar] [CrossRef] [Scilit]
- Khodadadi, N.; Nabavi, R.; Sarani, A.; Saadati, D.; Ganjali, M.; Mihalca, A.D.; Otranto, D.; Sazmand, A. Identification of Anaplasma marginale in long-eared hedgehogs (Hemiechinus auritus) and their Rhipicephalus turanicus ticks in Iran. Ticks Tick Borne Dis. 2021, 12, 101641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naddaf, S.R.; Mahmoudi, A.; Ghasemi, A.; Rohani, M.; Mohammadi, A.; Ziapour, S.P.; Nemati, A.H.; Mostafavi, E. Infection of hard ticks in the Caspian Sea littoral of Iran with Lyme borreliosis and relapsing fever borreliae. Ticks Tick Borne Dis. 2020, 11, 101500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCoy, B.N.; Maïga, O.; Schwan, T.G. Detection of Borrelia theileri in Rhipicephalus geigyi from Mali. Ticks Tick Borne Dis. 2014, 5, 401–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitchell, E.A.; Williamson, P.C.; Billingsley, P.M.; Seals, J.P.; Ferguson, E.E.; Allen, M.S. Frequency and distribution of rickettsiae, borreliae, and ehrlichiae detected in human-parasitizing ticks, Texas, USA. Emerg. Infect. Dis. 2016, 22, 312–315. [Google Scholar] [CrossRef] [Scilit]
- Majerová, K.; Hönig, V.; Houda, M.; Papežík, P.; Fonville, M.; Sprong, H.; Rudenko, N.; Golovchenko, M.; Černá Bolfíková, B.; Hulva, P.; et al. Hedgehogs, squirrels, and blackbirds as sentinel hosts for active surveillance of Borrelia miyamotoi and Borrelia burgdorferi complex in urban and rural environments. Microorganisms 2020, 8, 1908. [Google Scholar] [CrossRef] [Scilit]
- Skuballa, J.; Petney, T.; Pfäffle, M.; Oehme, R.; Hartelt, K.; Fingerle, V.; Kimmig, P.; Taraschewski, H. Occurrence of different Borrelia burgdorferi Sensu Lato genospecies including, B. Afzelii, B. Bavariensis, and B. Spielmanii in Hedgehogs (Erinaceus spp.) in Europe. Ticks Tick Borne Dis. 2012, 3, 8–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben Said, M.; Belkahia, H.; Alberti, A.; Abdi, K.; Zhioua, M.; Daaloul-Jedidi, M.; Messadi, L. First molecular evidence of Borrelia burgdorferi Sensu Lato in goats, sheep, cattle and camels in Tunisia. Ann. Agric. Environ. Med. 2016, 23, 442–447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Younsi, H.; Sarih, M.; Jouda, F.; Godfroid, E.; Gern, L.; Bouattour, A.; Baranton, G.; Postic, D. Characterization of Borrelia lusitaniae isolates collected in Tunisia and Morocco. J. Clin. Microbiol. 2005, 43, 1587–1593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zouari, S.; Khrouf, F.; M’ghirbi, Y.; Bouattour, A. First molecular detection and characterization of zoonotic Bartonella species in fleas infesting domestic animals in Tunisia. Parasit. Vectors 2017, 10. [Google Scholar] [CrossRef] [Scilit]
- Belkhiria, J.; Chomel, B.B.; Ben Hamida, T.; Kasten, R.W.; Stuckey, M.J.; Fleischman, D.A.; Christopher, M.M.; Boulouis, H.-J.; Farver, T.B. Prevalence and potential risk factors for Bartonella infection in Tunisian stray dogs. Vector Borne Zoonotic Dis. 2017, 17, 388–397. [Google Scholar] [CrossRef] [Scilit]
- Znazen, A.; Rolain, J.-M.; Hammami, N.; Kammoun, S.; Hammami, A.; Raoult, D. High prevalence of Bartonella quintana endocarditis in Sfax, Tunisia. Am. J. Trop. Med. Hyg. 2005, 72, 503–507. [Google Scholar] [CrossRef] [Scilit]
- Selmi, R.; Ben Said, M.; Ben Yahia, H.; Abdelaali, H.; Boulouis, H.-J.; Messadi, L. First report on Bartonella henselae in dromedary camels (Camelus Dromedarius). Infect. Genet. Evol. 2020, 85, 104496. [Google Scholar] [CrossRef] [Scilit]
- Bitam, I.; Rolain, J.M.; Nicolas, V.; Tsai, Y.-L.; Parola, P.; Gundi, V.A.K.B.; Chomel, B.B.; Raoult, D. A Multi-gene analysis of diversity of Bartonella detected in fleas from Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 71–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hornok, S.; Földvári, G.; Rigó, K.; Meli, M.L.; Tóth, M.; Molnár, V.; Gönczi, E.; Farkas, R.; Hofmann-Lehmann, R. Vector-borne agents detected in fleas of the northern white-breasted hedgehog. Vector Borne Zoonotic Dis. 2014, 14, 74–76. [Google Scholar] [CrossRef] [Scilit]
- Sacristán, C.; das Neves, C.G.; Suhel, F.; Sacristán, I.; Tengs, T.; Hamnes, I.S.; Madslien, K. Bartonella Spp. Detection in ticks, culicoides biting midges and wild cervids from Norway. Transbound Emerg. Dis. 2020. [Google Scholar] [CrossRef] [Scilit]
- de Sousa, K.C.M.; do Amaral, R.B.; Herrera, H.M.; Santos, F.M.; Macedo, G.C.; de Andrade Pinto, P.C.E.; Barros-Battesti, D.M.; Machado, R.Z.; André, M.R. Genetic diversity of Bartonella Spp. in wild mammals and ectoparasites in Brazilian Pantanal. Microb. Ecol. 2018, 76, 544–554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- López-Pérez, A.M.; Osikowicz, L.; Bai, Y.; Montenieri, J.; Rubio, A.; Moreno, K.; Gage, K.; Suzán, G.; Kosoy, M. Prevalence and phylogenetic analysis of Bartonella species of wild carnivores and their fleas in northwestern Mexico. Ecohealth 2017, 14, 116–129. [Google Scholar] [CrossRef] [Scilit]
- Yin, X.; Zhao, S.; Yan, B.; Tian, Y.; Ba, T.; Zhang, J.; Wang, Y. Bartonella rochalimae, B. grahamii, B. elizabethae, and Wolbachia spp. in fleas from wild rodents near the China-Kazakhstan border. Korean J. Parasitol. 2019, 57, 553–559. [Google Scholar] [CrossRef] [Scilit]
- Ehlers, J.; Krüger, A.; Rakotondranary, S.J.; Ratovonamana, R.Y.; Poppert, S.; Ganzhorn, J.U.; Tappe, D. Molecular detection of Rickettsia spp., Borrelia spp., Bartonella spp. and Yersinia pestis in ectoparasites of endemic and domestic animals in southwest Madagascar. Acta Trop. 2020, 205, 105339. [Google Scholar] [CrossRef] [Scilit]
- Panthawong, A.; Grieco, J.P.; Ngoen-Klan, R.; Chao, C.-C.; Chareonviriyaphap, T. Detection of Anaplasma spp. and Bartonella spp. from wild-caught rodents and their ectoparasites in Nakhon Ratchasima Province, Thailand. J. Vector Ecol. 2020, 45, 241–253. [Google Scholar] [CrossRef] [Scilit]
- Bouattour, A. Dichotomous identification keys of ticks (Acari: Ixodidae), livestock parasites in North Africa. Arch. Inst. Pasteur Tunis 2002, 79, 43–50. [Google Scholar]
- Beaucournu, J.C. Ajouts et corrections à la faune des Puces de France et du Bassin méditerranéen occidental (Siphonaptera). Bull. Soc. Entomol. Fr. 2013, 118, 173–196. [Google Scholar]
- Michelet, L.; Delannoy, S.; Devillers, E.; Umhang, G.; Aspan, A.; Juremalm, M.; Chirico, J.; van der Wal, F.J.; Sprong, H.; Boye Pihl, T.P.; et al. High-throughput screening of tick-borne pathogens in Europe. Front. Cell. Infect. Microbiol. 2014, 4, 103. [Google Scholar] [CrossRef] [Scilit]
- Nielsen, E.M.; Andersen, M.T. Detection and characterization of verocytotoxin-producing Escherichia coli by automated 5′ nuclease PCR assay. J. Clin. Microbiol. 2003, 41, 2884–2893. [Google Scholar] [CrossRef] [Scilit]
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.-J.; Lee, S.-H.; Park, K.-H.; Koh, Y.-S.; Lee, K.-H.; Baik, H.-S.; Choi, M.-S.; Kim, I.-S.; Jang, W.-J. Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin. Diagn. Lab. Immunol. 2005, 12, 759–763. [Google Scholar] [CrossRef] [Scilit]
- Rar, V.A.; Fomenko, N.V.; Dobrotvorsky, A.K.; Livanova, N.N.; Rudakova, S.A.; Fedorov, E.G.; Astanin, V.B.; Morozova, O.V. Tickborne pathogen detection, western Siberia, Russia. Emerg. Infect. Dis. 2005, 11, 1708–1715. [Google Scholar] [CrossRef] [Scilit]
- Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef] [Scilit]
- Bonnet, S.; Jouglin, M.; L’Hostis, M.; Chauvin, A. Babesia sp. EU1 from roe deer and transmission within Ixodes ricinus. Emerg. Infect. Dis. 2007, 13, 1208–1210. [Google Scholar] [CrossRef] [Scilit]
- Masatani, T.; Hayashi, K.; Andoh, M.; Tateno, M.; Endo, Y.; Asada, M.; Kusakisako, K.; Tanaka, T.; Gokuden, M.; Hozumi, N.; et al. Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan. Ticks Tick Borne Dis. 2017, 8, 581–587. [Google Scholar] [CrossRef] [Scilit]
- Loh, S.-M.; Gofton, A.W.; Lo, N.; Gillett, A.; Ryan, U.M.; Irwin, P.J.; Oskam, C.L. Novel Borrelia species detected in echidna ticks, Bothriocroton concolor, in Australia. Parasit. Vectors 2016, 9, 339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Norman, A.F.; Regnery, R.; Jameson, P.; Greene, C.; Krause, D.C. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. J. Clin. Microbiol. 1995, 33, 1797–1803. [Google Scholar] [CrossRef] [Scilit]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Hedgehog | Region | Locality | Geographical Coordinates | Sex a | No of Collected Ticks b | No of Collected Fleas b |
|---|---|---|---|---|---|---|
| ED1 | Kef | Dahmani | N: 35°56′35.606″ E: 8°49′50.747″ | M | 8 | 20 |
| EZ4 | Kef | Oued Souani | N: 36°11′49.6″ E: 8°58′33.964″ | M | 8 | 3 |
| EB1 | Bizerte | Metline | N: 37°14′56.022″ E: 10°02′29.616″ | F | 55 | 51 |
| EB2 | Bizerte | El Garia | N: 37°13′57.45″ E: 10°3′0.029″ | F | 1 | 0 |
| EB3 | Bizerte | Bazina | N: 36°57′49.392″ E: 9°18′0.158″ | F | 3 | 2 |
| EB4 | Bizerte | Bni Atta | N: 37°13′55.42″ E: 10°5′0.701″ | M | 8 | 4 |
| EB5 | Bizerte | Joumine | N: 36°55′34.248″ E: 9°23′14.744″ | F | 3 | 3 |
| EB6 | Bizerte | El Garia | N: 37°13′ 57.45″ E: 10°3′0.029″ | M | 7 | 5 |
| EG1 | Kasserine | Bouzguem | N:35°10′03″ E: 8°50′11″ | M | 17 | 4 |
| EA1 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | F | Nd | Nd |
| EA2 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | F | Nd | Nd |
| EA3 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | F | Nd | Nd |
| EA4 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | F | Nd | Nd |
| EA5 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | M | Nd | Nd |
| EA6 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | M | Nd | Nd |
| EA7 | Kef | Abida | N: 35°59.392″ E: 8°44′13.574″ | M | Nd | Nd |
| EZ1 | Kef | Zaafran | N: 33°26′39.271″ E: 8°55′18.39″ | F | Nd | Nd |
| EZ2 | Kef | Zaafran | N: 33°26′39.271″ E: 8°55′18.39″ | M | Nd | Nd |
| EZ3 | Kef | Zaafran | N: 33°26′39.271″ E: 8°55′18.39″ | F | Nd | Nd |
| ES1 | Kef | Kalaat Senan | N: 35°45′20.254″ E: 8°21′9.562″ | M | 0 | 0 |
| Pathogen | Hedgehog IR (Positive Samples/Total Tested Samples) a | Tick IR (Positive Samples/Total Tested Samples) b | Flea IR (Positive Samples/Total Tested Samples) | ||||
|---|---|---|---|---|---|---|---|
| Hae. erinacei | Rh. sanguineus | Ixodes spp. | Hy. aegyptium | Archaeopsylla erinacei | Ctenocephalides felis | ||
| Ehrlichia spp. | 45% (9/20) | 26% (24/92) | 0 | 0 | 0 | 0 | 0 |
| Ehrlichia ewingii | 5% (1/20) | 3.3% (3/92) | 0 | 0 | 0 | 0 | 0 |
| Candidatus E. shimanensis | 10% (2/20) | 0 | 0 | 0 | 0 | 0 | 0 |
| Coxiella burnetii | 10% (2/20) | 80.4% (74/92) | 86.6% (13/15) | 50% (1/2) | 100% (1/1) | 34% (31/91) | 100% (1/1) |
| Rickettsia spp. | 10% (2/20) | 40.2% (37/92) | 86.6% (13/15) | 50% (1/2) | 0 | 82.4% (75/91) | 100% (1/1) |
| Rickettsia massiliae | 0 | 0 | 53.3% (8/15) | 0 | 0 | 1.1% (1/91) | 0 |
| Rickettsia lusitaniae | 0 | 0 | 6.7% (1/15) | 0 | 0 | 0 | 0 |
| Rickettsia asembonensis | 0 | 0 | 0 | 0 | 0 | 78% (71/91) | 0 |
| Bartonella spp. | 0 | 3.3% (3/92) | 6.7% (1/15) | 0 | 0 | 2.2% (2/91) | 0 |
| Theileria youngi | 40% (8/20) | 0 | 0 | 0 | 0 | 0 | 0 |
| Hepatozoon sp. | 5% (1/20) | 0 | 0 | 0 | 0 | 0 | 0 |
| Borrelia sp. | 0 | 0 | 6.7% (1/15) | 0 | 0 | 0 | 0 |
| Anaplasma sp. | 0 | 0 | 6.7% (1/15) | 0 | 0 | 0 | 0 |
| Pathogen Identification by Microfluidic Real-Time PCR | Host a | Similarity % | Accession Number of the Reference Sequences | Pathogen Identification by Sequencing b (Targeted Gene) | Accession Number |
|---|---|---|---|---|---|
| Anaplasma spp. | Rh. sanguineus | 99.7 | KJ410249 | Anaplasma sp. (16S rRNA) | MW508491 |
| Anaplasma spp. | Hae. Erinacei | 99.8 | MN148616 | E. ewingii (16S rRNA) | MW508469 |
| Ehrlichia spp. | Hae. erinacei Atelerix algirus | 99.8–100 | MN148616 | E. ewingii (16S rRNA) | MW508471 MW508473 |
| Ehrlichia spp. | Atelerix algirus | 99.3 | AB074459 | Ca. E. shimenensis (16S rRNA) | MW508474MW508475MW508468 |
| Rickettsia spp. | A. erinacei | 100 | MN186290 MK923741 | R. asembonensis (gltA) | MW508476-MW508479 |
| Rickettsia spp. | Rh. sanguineus | 100 | MK761227 | R. lusitaniae (gltA) | MW508481 |
| Rickettsia spp. | A. erinacei | 99.3 | AF123714 | R. massiliae (ompB) | MW508483 |
| Rickettsia massiliae | Rh. sanguineus | 100 | DQ503428 | R. massiliae (ompB) | MW508482- MW508489 |
| Theileria spp. | Atelerix algirus | 99 | AF245279 | T. youngi (18S rRNA) | MW508493- MW508496 |
| Hepatozoon spp. | Atelerix algirus | 100 | KU680466 | Hepatozoon sp. (18S rRNA) | MW508490 |
| Coxiella burnetii | Atelerix algirus A. erinacei Hae. erinacei | 100 | MN540441 LC46497 | C. burnetii (16S rRNA) | MW508460- MW508464 |
| Borrelia sp. | Rh. sanguineus | 99.7 | MN958351 | Borrelia sp. (flaB) | MW508492 |
| Pathogen | Targeted Gene | Primers | Sequence (5′-3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|---|
| Rickettsia spp. | gltA | Rsfg877 Rsfg1258 | GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA | 381 | [157] |
| ompB | Rc.rglt.4362p Rc.rompB.4836n | GTCAGCGTTACTTCTTCGATGC CCGTACTCCATCTTAGCATCAG | 475 | [158] | |
| Rc.rompB.4496p Rc.rompB.4762n | CCAATGGCAGGACTTAGCTACT AGGCTGGCTGATACACGGAGTAA | 267 | |||
| Anaplasma/Ehrlichia spp. | 16S rRNA | EHR1 EHR2 EHR3 | GAACGAACGCTGGCGGCAAGC AGTA(T/C)CG(A/G)ACCAGATAGCCGC TGCATAGGAATCTACCTAGTAG | 629 | [159] |
| Hepatozoon spp. | 18S rRNA | HepF HepR | ATACATGAGCAAAATCTCAAC CTTATTATTCCATGCTGCAG | 660 | [160] |
| Theileria spp. | 18S rRNA | BABGF2 BABGR2 | GYYTTGTAATTGGAATGATGG CCAAAGACTTTGATTTCTCTC | 559 | [161] |
| BTH 18S 1st F BTH 18S 1st | GTGAAACTGCGAATGGCTCATTACR AAGTGATAAGGTTCACAAAACTTCCC | 1500 bp | [162] | ||
| BTH 18S 2nd F BTH 18S 2nd R | GGCTCATTACAACAGTTATAGTTTATTTG CGGTCCGAATAATTCACCGGAT | 1500 | |||
| Coxiella burnetii and Coxiella-like endosymbionts | 16S rRNA | Cox 16SF1 Cox 16SR1 | CGTAGGAATCTACCTTRTAGWGG ACTYYCCAACAGCTAGTTCTCA | 719–813 | [52] |
| Cox 16SF2 Cox 16SR2 | TGAGAACTAGCTGTTGGRRAGT GCCTACCCGCTTCTGGTACAATT | 625 | |||
| Borrelia spp. | flaB | FlaB280F FlaRL | GCAGTTCARTCAGGTAACGG GCAATCATAGCCATTGCAGATTGT | 645 | [163] |
| FlaB737F FlaLL | GCATCAACTGTRGTTGTAACATTAACAGG ACATATTCAGATGCAGACAGAGGT | 407 | |||
| Bartonella spp. | gltA | bart781 bart1137 | GGG GAC CAG CTC ATG GTG G AAT GCA AAA AGA ACA GTA AAC A | 380–400 | [164] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Balti, G.; Galon, C.; Derghal, M.; Souguir, H.; Guerbouj, S.; Rhim, A.; Chemkhi, J.; Guizani, I.; Bouattour, A.; Moutailler, S.; et al. Atelerix algirus, the North African Hedgehog: Suitable Wild Host for Infected Ticks and Fleas and Reservoir of Vector-Borne Pathogens in Tunisia. Pathogens 2021, 10, 953. https://doi.org/10.3390/pathogens10080953
Balti G, Galon C, Derghal M, Souguir H, Guerbouj S, Rhim A, Chemkhi J, Guizani I, Bouattour A, Moutailler S, et al. Atelerix algirus, the North African Hedgehog: Suitable Wild Host for Infected Ticks and Fleas and Reservoir of Vector-Borne Pathogens in Tunisia. Pathogens. 2021; 10(8):953. https://doi.org/10.3390/pathogens10080953
Chicago/Turabian StyleBalti, Ghofrane, Clemence Galon, Moufida Derghal, Hejer Souguir, Souheila Guerbouj, Adel Rhim, Jomâa Chemkhi, Ikram Guizani, Ali Bouattour, Sara Moutailler, and et al. 2021. "Atelerix algirus, the North African Hedgehog: Suitable Wild Host for Infected Ticks and Fleas and Reservoir of Vector-Borne Pathogens in Tunisia" Pathogens 10, no. 8: 953. https://doi.org/10.3390/pathogens10080953
APA StyleBalti, G., Galon, C., Derghal, M., Souguir, H., Guerbouj, S., Rhim, A., Chemkhi, J., Guizani, I., Bouattour, A., Moutailler, S., & M’ghirbi, Y. (2021). Atelerix algirus, the North African Hedgehog: Suitable Wild Host for Infected Ticks and Fleas and Reservoir of Vector-Borne Pathogens in Tunisia. Pathogens, 10(8), 953. https://doi.org/10.3390/pathogens10080953

