Comparison of Three In-House Real PCR Assays Targeting Kinetoplast DNA, the Small Subunit Ribosomal RNA Gene and the Glucose-6-Phosphate Isomerase Gene for the Detection of Leishmania spp. in Human Serum
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Samples
4.2. Nucleic Acid Extraction
4.3. PCR Screening Assays
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Positive control plasmid sequence insert for kinetoplast DNA-PCR protocol (GenBank Accession Code: EU437405.1) |
CCACCCGGCCCTATTTTACACCAACCCCCAGTTTCCCGCCTCGGACCCGATTTTTGAC-ATTTTTGGCCAATTTTTGAACGGGATTTCTGCACCCATTTTTCGATTTTCGCAGAACGCC-CCTACCCGGAGGACCAGAAAAG |
Positive control plasmid sequence insert for the small subunit ribosomal RNA gene-PCR protocol (GenBank Accession Code: M81430.1) |
AAGTGCTTTCCCATCGCAACCTCGGTTCGGTGTGTGGCGCCTTTGAGGGGTTTAGTGCGT-C |
References
- Schwarz, N.G.; Loderstaedt, U.; Hahn, A.; Hinz, R.; Zautner, A.E.; Eibach, D.; Fischer, M.; Hagen, R.M.; Frickmann, H. Microbiological laboratory diagnostics of neglected zoonotic diseases (NZDs). Acta Trop. 2017, 165, 40–65. [Google Scholar] [CrossRef]
- Oliveira, J.G.S.; Novais, F.O.; de Oliveira, C.I.; Junior, A.C.D.C.; Campos, L.F.; da Rocha, A.V.; Boaventura, V.; Noronha, A.; Costa, J.M.; Barral, A. Polymerase chain reaction (PCR) is highly sensitive for diagnosis of mucosal leishmaniasis. Acta Trop. 2005, 94, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Deborggraeve, S.; Boelaert, M.; Rijal, S.; De Doncker, S.; Dujardin, J.-C.; Herdewijn, P.; Buscher, P. Diagnostic accuracy of a newLeishmaniaPCR for clinical visceral leishmaniasis in Nepal and its role in diagnosis of disease. Trop. Med. Int. Health 2008, 13, 1378–1383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evans, T.G.; Teixeira, M.J.; McAuliffe, I.T.; Vasconcelos, I.; Vasconcelos, A.W.; Sousa Ade, A.; Lima, J.W.; Pearson, R.D. Epi-demiology of visceral leishmaniasis in northeast Brazil. J. Infect. Dis. 1992, 166, 1124–1132. [Google Scholar] [CrossRef]
- Badaro, R.; Jones, T.C.; Carvalho, E.M.; Sampaio, D.; Reed, S.G.; Barral, A.; Teixeira, R.; Johnson, W.D. New Perspectives on a Subclinical Form of Visceral Leishmaniasis. J. Infect. Dis. 1986, 154, 1003–1011. [Google Scholar] [CrossRef] [PubMed]
- Badaró, R.; Jones, T.C.; Lorenço, R.; Cerf, B.J.; Sampaio, D.; Carvalho, E.M.; Rocha, H.; Teixeira, R.; Johnson, W.D., Jr. A pro-spective study of visceral leishmaniasis in an endemic area of Brazil. J. Infect. Dis. 1986, 154, 639–649. [Google Scholar] [CrossRef]
- Dereure, J.; Thanh, H.D.; Lavabre-Bertrand, T.; Cartron, G.; Bastides, F.; Richard-Lenoble, D.; Dedet, J. Visceral leishmaniasis. Persistence of parasites in lymph nodes after clinical cure. J. Infect. 2003, 47, 77–81. [Google Scholar] [CrossRef]
- Russo, R.; Laguna, F.; Lopez-Velez, R.; Medrano, F.J.; Rosenthal, E.; Cacopardo, B.; Nigro, L. Visceral leishmaniasis in those infected with HIV: Clinical aspects and other opportunistic infections. Ann. Trop. Med. Parasitol. 2003, 97, 99–105. [Google Scholar] [CrossRef] [Green Version]
- Mody, R.M.; Lakhal-Naouar, I.; E Sherwood, J.; Koles, N.L.; Shaw, D.; Bigley, D.P.; A Co, E.-M.; Copeland, N.K.; Jagodzinski, L.L.; Mukbel, R.M.; et al. Asymptomatic Visceral Leishmania infantum Infection in US Soldiers Deployed to Iraq. Clin. Infect. Dis. 2019, 68, 2036–2044. [Google Scholar] [CrossRef] [Green Version]
- Reithinger, R.; Dujardin, J.-C. Molecular Diagnosis of Leishmaniasis: Current Status and Future Applications. J. Clin. Microbiol. 2007, 45, 21–25. [Google Scholar] [CrossRef] [Green Version]
- Mary, C.; Faraut, F.; Drogoul, M.P.; Xeridat, B.; Schleinitz, N.; Cuisenier, B.; Dumon, H. Reference values for Leishmania in-fantum parasitemia in different clinical presentations: Quantitative polymerase chain reaction for therapeutic monitoring and patient follow-up. Am. J. Trop. Med. Hyg. 2006, 75, 858–863. [Google Scholar] [CrossRef] [Green Version]
- Sudarshan, M.; Weirather, J.L.; Wilson, M.; Sundar, S. Study of parasite kinetics with antileishmanial drugs using real-time quantitative PCR in Indian visceral leishmaniasis. J. Antimicrob. Chemother. 2011, 66, 1751–1755. [Google Scholar] [CrossRef]
- Pandey, K.; Pandey, B.D.; Mallik, A.K.; Kaneko, O.; Uemura, H.; Kanbara, H.; Yanagi, T.; Hirayama, K. Diagnosis of visceral leishmaniasis by polymerase chain reaction of DNA extracted from Giemsa’s solution-stained slides. Parasitol. Res. 2010, 107, 727–730. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cruz, I.; Millet, A.; Carrillo, E.; Chenik, M.; Salotra, P.; Verma, S.; Veland, N.; Jara, M.; Adaui, V.; Castrillón, C.; et al. An approach for interlaboratory comparison of conventional and real-time PCR assays for diagnosis of human leishmaniasis. Exp. Parasitol. 2013, 134, 281–289. [Google Scholar] [CrossRef] [PubMed]
- Mary, C.; Faraut, F.; Lascombe, L.; Dumon, H. Quantification of Leishmania infantum DNA by a Real-Time PCR Assay with High Sensitivity. J. Clin. Microbiol. 2004, 42, 5249–5255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wortmann, G.; Sweeney, C.; Houng, H.S.; Aronson, N.; Stiteler, J.; Jackson, J.; Ockenhouse, C. Rapid diagnosis of leishmani-asis by fluorogenic polymerase chain reaction. Am. J. Trop. Med. Hyg. 2001, 65, 583–587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wortmann, G.; Hochberg, L.; Houng, H.H.; Sweeney, C.; Zapor, M.; Aronson, N.; Weina, P.; Ockenhouse, C.F. Rapid identi-fication of Leishmania complexes by a real-time PCR assay. Am. J. Trop. Med. Hyg. 2005, 73, 999–1004. [Google Scholar] [CrossRef]
- Coleman, R.E.; Hochberg, L.P.; Swanson, K.I.; Lee, J.S.; McAvin, J.C.; Moulton, J.K.; Eddington, D.O.; Groebner, J.L.; O’Guinn, M.L.; Putnam, J.L. Impact of Phlebotomine Sand Flies on U.S. Military Operations at Tallil Air Base, Iraq: 4. Detection and Identification ofLeishmaniaParasites in Sand Flies. J. Med Èntomol. 2009, 46, 649–663. [Google Scholar] [CrossRef] [Green Version]
- Ceccarelli, M.; Diotallevi, A.; Andreoni, F.; Vitale, F.; Galluzzi, L.; Magnani, M. Exploiting genetic polymorphisms in meta-bolic enzymes for rapid screening of Leishmania infantum genotypes. Parasit. Vectors 2018, 11, 572. [Google Scholar] [CrossRef]
- Merdekios, B.; Pareyn, M.; Tadesse, D.; Eligo, N.; Kassa, M.; Jacobs, B.K.M.; Leirs, H.; Van Geertruyden, J.-P.; Van Griensven, J.; Caljon, G.; et al. Evaluation of conventional and four real-time PCR methods for the detection of Leishmania on field-collected samples in Ethiopia. PLoS Negl. Trop. Dis. 2021, 15, e0008903. [Google Scholar] [CrossRef] [PubMed]
- Martín-Sánchez, J.; Pineda, J.A.; Morillas-Márquez, F.; García-García, J.A.; Acedo, C.; Macías, J. Detection of Leishmania in-fantum kinetoplast DNA in peripheral blood from asymptomatic individuals at risk for parenterally transmitted infections: Relationship between polymerase chain reaction results and other Leishmania infection markers. Am. J. Trop. Med. Hyg. 2004, 70, 545–548. [Google Scholar] [CrossRef] [Green Version]
- Inga, R.; De Doncker, S.; Gomez, J.; Lopez, M.; Garcia, R.; Le Ray, D.; Arevalo, J.; Dujardin, J.-C. Relation between variation in copy number of ribosomal RNA encoding genes and size of harbouring chromosomes in Leishmania of subgenus Viannia. Mol. Biochem. Parasitol. 1998, 92, 219–228. [Google Scholar] [CrossRef]
- Ceccarelli, M.; Galluzzi, L.; Migliazzo, A.; Magnani, M. Detection and characterization of Leishmania (Leishmania) and Leish-mania (Viannia) by SYBR green-based real-time PCR and high resolution melt analysis targeting kinetoplast minicircle DNA. PLoS ONE 2014, 9, e88845. [Google Scholar] [CrossRef] [Green Version]
- Fissore, C.; Delaunay, P.; Ferrua, B.; Rosenthal, E.; Del Giudice, P.; Aufeuvre, J.-P.; Le Fichoux, Y.; Marty, P. Convenience of Serum for Visceral Leishmaniasis Diagnosis by PCR. J. Clin. Microbiol. 2004, 42, 5332–5333. [Google Scholar] [CrossRef] [Green Version]
- de Assis, T.S.M.; Caligiorne, R.B.; Romero, G.A.S.; Rabello, A. Detection of Leishmania kDNA in human serum samples for the diagnosis of visceral leishmaniasis. Trans. R. Soc. Trop. Med. Hyg. 2009, 103, 1269–1272. [Google Scholar] [CrossRef] [PubMed]
- Diagnostik und Therapie der viszeralen Leishmaniasis (Kala Azar). Available online: https://www.dtg.org/images/Leitlinien_DTG/Leitlinie_viszerale_Leishmaniasis.pdf (accessed on 2 June 2021).
- Schawaller, M.; Wiemer, D.; Hagen, R.M.; Frickmann, H. Infectious diseases in German military personnel after predominantly tropical deployments: A retrospective assessment over 13 years. BMJ Mil. Health 2020. [Google Scholar] [CrossRef]
- Maaßen, W.; Wiemer, D.; Frey, C.; Kreuzberg, C.; Tannich, E.; Hinz, R.; Wille, A.; Fritsch, A.; Hagen, R.M.; Frickmann, H. Microbiological screenings for infection control in unaccompanied minor refugees: The German Armed Forces Medical Ser-vice’s experience. Mil. Med. Res. 2017, 4, 13. [Google Scholar] [CrossRef] [Green Version]
- Leslie, T.; Saleheen, S.; Sami, M.; Mayan, I.; Mahboob, N.; Fiekert, K.; Lenglet, A.; Ord, R.; Reithinger, R. Visceral leishmania-sis in Afghanistan. CMAJ. 2006, 175, 245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaufer, A.; Ellis, J.; Stark, D.; Barratt, J. The evolution of trypanosomatid taxonomy. Parasites Vectors 2017, 10, 1–17. [Google Scholar] [CrossRef]
- Obwaller, A.G.; Köhsler, M.; Poeppl, W.; Herkner, H.; Mooseder, G.; Aspöck, H.; Walochnik, J. Leishmania infections in Aus-trian soldiers returning from military missions abroad: A cross-sectional study. Clin. Microbiol. Infect. 2018, 24, 1100-e1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lima, M.S.D.C.; Hartkopf, A.C.L.; Tsujisaki, R.A.D.S.; Oshiro, E.T.; Shapiro, J.T.; Matos, M.D.F.C.; Dorval, M.E.C. Isolation and molecular characterization of Leishmania infantum in urine from patients with visceral leishmaniasis in Brazil. Acta Trop. 2018, 178, 248–251. [Google Scholar] [CrossRef] [Green Version]
- Pessoa-E-Silva, R.; Mendonça Trajano-Silva, L.A.; Lopes da Silva, M.A.; da Cunha Gonçalves-de-Albuquerque, S.; de Goes, T.C.; Silva de Morais, R.C.; Lopes de Melo, F.; de Paiva-Cavalcanti, M. Evaluation of urine for Leishmania infantum DNA detection by real-time quantitative PCR. J. Microbiol. Methods. 2016, 131, 34–41. [Google Scholar] [CrossRef]
- Veland, N.; Espinosa, D.; Valencia, B.M.; Ramos, A.P.; Calderon, F.; Arevalo, J.; Low, D.E.; Llanos-Cuentas, A.; Boggild, A.K. Polymerase chain reaction detection of Leishmania kDNA from the urine of Peruvian patients with cutaneous and mucocu-taneous leishmaniasis. Am. J. Trop. Med. Hyg. 2011, 84, 556–561. [Google Scholar] [CrossRef] [Green Version]
- Fisa, R.; Riera, C.; López-Chejade, P.; Molina, I.; Gállego, M.; Falcó, V.; Ribera, E.; Portús, M. Leishmania infantum DNA detec-tion in urine from patients with visceral leishmaniasis and after treatment control. Am. J. Trop. Med. Hyg. 2008, 78, 741–744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva, M.A.; Medeiros, Z.; Soares, C.R.; Silva, E.D.; Miranda-Filho, D.B.; Melo, F.L. A comparison of four DNA extraction protocols for the analysis of urine from patients with visceral leishmaniasis. Rev. Soc. Bras. Med. Trop. 2014, 47, 193–197. [Google Scholar] [CrossRef] [PubMed]
- Asfaram, S.; Teshnizi, S.H.; Fakhar, M.; Banimostafavi, E.S.; Soosaraei, M. Is urine a reliable clinical sample for the diagnosis of human visceral leishmaniasis? A systematic review and meta-analysis. Parasitol. Int. 2018, 67, 575–583. [Google Scholar] [CrossRef]
- Pappa, S.; Kontou, P.; Bagos, P.; Braliou, G. Urine-Based Molecular Diagnostic Tests for Leishmaniasis Infection in Human and Canine Populations: A Meta-Analysis. Pathogens 2021, 10, 269. [Google Scholar] [CrossRef]
- Bossuyt, P.M.; Reitsma, J.B.; E Bruns, D.; A Gatsonis, C.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; de Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef] [Green Version]
- Frickmann, H.; Hinz, R.; Hagen, R.M. Comparison of an automated nucleic acid extraction system with the column-based procedure. Eur. J. Microbiol. Immunol. 2015, 5, 94–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niesters, H.G. Quantitation of Viral Load Using Real-Time Amplification Techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef]
- Ivens, A.C.; Peacock, C.S.; Worthey, E.A.; Murphy, L.; Aggarwal, G.; Berriman, M.; Sisk, E.; Rajandream, M.-A.; Adlem, E.; Aert, R.; et al. The Genome of the Kinetoplastid Parasite, Leishmania major. Science 2005, 309, 436–442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Sample-ID | Initial Sample (I.S.)/Follow-Up Sample (F.U.S.) after Therapy | Time in Months Since Initial Sampling | Leishmania-Specific Immuno-Fluoresence Titer | Bone Marrow Positive by Microscopy or PCR | Ct Value # in the Kinetoplast DNA PCR | Ct Value # in the Small Subunit Ribosomal RNA Gene PCR | Ct Value # in the Glucose-6-Phosphate Isomerase Gene PCR |
---|---|---|---|---|---|---|---|
HAM-1 | I.S. | n.a. | 1:640 | Yes | 27 | 28 | - |
HAM-1_2 | F.U.S. | 3 | 1:640 | In previous assessment | - | - | - |
HAM-2 | I.S. | n.a. | >1:1280 | Yes | 33 | 32 | - |
HAM-3 | I.S. | n.a. | 1:320 | Yes | 30 | 29 | - |
HAM-4 | I.S. | n.a. | 1:320 | Yes | 39 | - | - |
HAM-5 | I.S. | n.a. | 1:640 | Yes | 29 | 29 | - |
HAM-5_2 | F.U.S. | 22 | 1:160 | In previous assessment | - | - | - |
HAM-6 | I.S. | n.a. | 1:160 | Yes | 18 | 23 | 36 |
HAM-6_2 | F.U.S. | 2 | 1:640 | In previous assessment | - | - | - |
HAM-7 | I.S. | n.a. | >1:1280 | Yes | 23 | 24 | 39 |
HAM-8 | I.S. | n.a. | 1:640 | Yes | 17 | 24 | 39 |
HAM-9 | I.S. | n.a. | >1:1280 | Yes * | - | - | - |
HAM-10 | I.S. | n.a. | >1:1280 | Yes | 29 | - | - |
HAM-10_2 | F.U.S. | 6.5 | >1:1280 | In previous assessment | - | - | - |
HAM-11 | I.S. | n.a. | >1:1280 | Yes | 29 | - | - |
HAM-11_2 | F.U.S. | 3 | 1:640 | In previous assessment | - | - | - |
HAM-12 | I.S. | n.a. | 1:320 | Yes | 16 | 24 | 37 |
HAM-12_2 | F.U.S. | 7 | 1:80 | In previous assessment | - | - | - |
HAM-13 | I.S. | n.a. | 1:320 | Yes | 20 | 26 | 38 |
HAM-13_2 | F.U.S. | 2.5 | 1:80 | In previous assessment | - | - | - |
HAM-14 | I.S. | n.a. | >1:1280 | Yes | 22 | 28 | - |
BAS-1_2° | F.U.S. | 5.5 | 1:1280 | In previous assessment | - | - | - |
BAS-2_2° | F.U.S. | 4 | 1:640 | In previous assessment | - | - | - |
BAS-3_2° | F.U.S. | 6 | 1:1280 | In previous assessment° | - | - | - |
BAS-4 | I.S. | n.a. | 1:1280 | In subsequent assessment | 22 | 28 | - |
BAS-4_2 | F.U.S. | <0.5 | 1:1280 | Yes | 10 | 17 | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanida, K.; Balczun, C.; Hahn, A.; Veit, A.; Nickel, B.; Poppert, S.; Scheid, P.L.; Hagen, R.M.; Frickmann, H.; Loderstädt, U.; et al. Comparison of Three In-House Real PCR Assays Targeting Kinetoplast DNA, the Small Subunit Ribosomal RNA Gene and the Glucose-6-Phosphate Isomerase Gene for the Detection of Leishmania spp. in Human Serum. Pathogens 2021, 10, 826. https://doi.org/10.3390/pathogens10070826
Tanida K, Balczun C, Hahn A, Veit A, Nickel B, Poppert S, Scheid PL, Hagen RM, Frickmann H, Loderstädt U, et al. Comparison of Three In-House Real PCR Assays Targeting Kinetoplast DNA, the Small Subunit Ribosomal RNA Gene and the Glucose-6-Phosphate Isomerase Gene for the Detection of Leishmania spp. in Human Serum. Pathogens. 2021; 10(7):826. https://doi.org/10.3390/pathogens10070826
Chicago/Turabian StyleTanida, Konstantin, Carsten Balczun, Andreas Hahn, Alexandra Veit, Beatrice Nickel, Sven Poppert, Patrick Leander Scheid, Ralf Matthias Hagen, Hagen Frickmann, Ulrike Loderstädt, and et al. 2021. "Comparison of Three In-House Real PCR Assays Targeting Kinetoplast DNA, the Small Subunit Ribosomal RNA Gene and the Glucose-6-Phosphate Isomerase Gene for the Detection of Leishmania spp. in Human Serum" Pathogens 10, no. 7: 826. https://doi.org/10.3390/pathogens10070826
APA StyleTanida, K., Balczun, C., Hahn, A., Veit, A., Nickel, B., Poppert, S., Scheid, P. L., Hagen, R. M., Frickmann, H., Loderstädt, U., & Tannich, E. (2021). Comparison of Three In-House Real PCR Assays Targeting Kinetoplast DNA, the Small Subunit Ribosomal RNA Gene and the Glucose-6-Phosphate Isomerase Gene for the Detection of Leishmania spp. in Human Serum. Pathogens, 10(7), 826. https://doi.org/10.3390/pathogens10070826