Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Strains
4.2. Detection Limit Assays
4.3. DNA Extraction
4.4. PCR Testing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hunter, P.R.; Nichols, G. Epidemiology and Clinical Features of Cryptosporidium Infection in Immunocompromised Patients. Clin. Microbiol. Rev. 2002, 15, 145–154. [Google Scholar] [CrossRef] [Scilit]
- GBD Diarrhoeal Diseases Collaborators. Estimates of Global, Regional, and National Morbidity, Mortality, and Aetiologies of Diarrhoeal Diseases: A Systematic Analysis for the Global Burden of Disease Study 2015. Lancet Infect. Dis. 2017, 17, 909–948. [Google Scholar] [CrossRef] [Scilit]
- FAO/WHO. Multicriteria-Based Ranking for Risk Management of Food-Borne Parasites. Microbiological Risk Assessment Series 23; 2014; Available online: https://apps.who.int/iris/handle/10665/112672 (accessed on 1 May 2021).
- Ryan, U.; Hijjawi, N.; Xiao, L. Foodborne Cryptosporidiosis. Int. J. Parasitol. 2018, 48, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costa, D.; Razakandrainibe, R.; Valot, S.; Vannier, M.; Sautour, M.; Basmaciyan, L.; Gargala, G.; Viller, V.; Lemeteil, D.; Ballet, J.-J.; et al. Epidemiology of Cryptosporidiosis in France from 2017 to 2019. Microorganisms 2020, 8, 1358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costa, D.; Razakandrainibe, R.; Sautour, M.; Valot, S.; Basmaciyan, L.; Gargala, G.; Lemeteil, D.; Favennec, L.; Dalle, F.; French National Network on Surveillance of Human Cryptosporidiosis. Human Cryptosporidiosis in Immunodeficient Patients in France (2015–2017). Exp. Parasitol. 2018, 192, 108–112. [Google Scholar] [CrossRef] [Scilit]
- Robinson, G.; Chalmers, R.M. Cryptosporidium Diagnostic Assays: Microscopy. Methods Mol. Biol. 2020, 2052, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Adeyemo, F.E.; Singh, G.; Reddy, P.; Stenström, T.A. Methods for the Detection of Cryptosporidium and Giardia: From Microscopy to Nucleic Acid Based Tools in Clinical and Environmental Regimes. Acta Trop. 2018, 184, 15–28. [Google Scholar] [CrossRef] [Scilit]
- Khanna, V.; Tilak, K.; Ghosh, A.; Mukhopadhyay, C. Modified Negative Staining of Heine for Fast and Inexpensive Screening of Cryptosporidium, Cyclospora, and Cystoisospora Spp. Int. Sch. Res. Not. 2014, 2014, 165424. [Google Scholar] [CrossRef] [Scilit]
- Jerez Puebla, L.E.; Núñez-Fernández, F.A.; Fraga Nodarse, J.; Atencio Millán, I.; Cruz Rodríguez, I.; Martínez Silva, I.; Ayllón Valdés, L.; Robertson, L.J. Diagnosis of Intestinal Protozoan Infections in Patients in Cuba by Microscopy and Molecular Methods: Advantages and Disadvantages. J. Microbiol. Methods 2020, 179, 106102. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, S.A.; Karanis, P. Comparison of Current Methods Used to Detect Cryptosporidium Oocysts in Stools. Int. J. Hyg. Environ. Health 2018, 221, 743–763. [Google Scholar] [CrossRef] [Scilit]
- Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; Le Govic, Y.; Dalle, F.; Botterel, F.; et al. Is Real-Time PCR-Based Diagnosis Similar in Performance to Routine Parasitological Examination for the Identification of Giardia Intestinalis, Cryptosporidium Parvum/Cryptosporidium Hominis and Entamoeba Histolytica from Stool Samples? Evaluation of a New Commercial Multiplex PCR Assay and Literature Review. Clin. Microbiol. Infect. 2016, 22, 190.e1–190.e8. [Google Scholar] [CrossRef] [Scilit]
- Fontaine, M.; Guillot, E. Development of a TaqMan Quantitative PCR Assay Specific for Cryptosporidium Parvum. FEMS Microbiol. Lett. 2002, 214, 13–17. [Google Scholar] [CrossRef] [PubMed]
- Hadfield, S.J.; Robinson, G.; Elwin, K.; Chalmers, R.M. Detection and Differentiation of Cryptosporidium Spp. in Human Clinical Samples by Use of Real-Time PCR. J. Clin. Microbiol. 2011, 49, 918–924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mary, C.; Chapey, E.; Dutoit, E.; Guyot, K.; Hasseine, L.; Jeddi, F.; Menotti, J.; Paraud, C.; Pomares, C.; Rabodonirina, M.; et al. Multicentric Evaluation of a New Real-Time PCR Assay for Quantification of Cryptosporidium Spp. and Identification of Cryptosporidium Parvum and Cryptosporidium Hominis. J. Clin. Microbiol. 2013, 51, 2556–2563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fischer, P.; Taraschewski, H.; Ringelmann, R.; Eing, B. Detection of Cryptosporidium Parvum in Human Feces by PCR. Tokai J. Exp. Clin. Med. 1998, 23, 309–311. [Google Scholar]
- Gallas-Lindemann, C.; Sotiriadou, I.; Plutzer, J.; Noack, M.J.; Mahmoudi, M.R.; Karanis, P. Giardia and Cryptosporidium Spp. Dissemination during Wastewater Treatment and Comparative Detection via Immunofluorescence Assay (IFA), Nested Polymerase Chain Reaction (Nested PCR) and Loop Mediated Isothermal Amplification (LAMP). Acta Trop. 2016, 158, 43–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Z.; Morrison, M. Improved Extraction of PCR-Quality Community DNA from Digesta and Fecal Samples. Biotechniques 2004, 36, 808–812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Müller, A.; Stellermann, K.; Hartmann, P.; Schrappe, M.; Fätkenheuer, G.; Salzberger, B.; Diehl, V.; Franzen, C. A Powerful DNA Extraction Method and PCR for Detection of Microsporidia in Clinical Stool Specimens. Clin. Diagn. Lab. Immunol. 1999, 6, 243–246. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.F.; Lindo, J.F.; Auer, H.; Walochnik, J. Successful Extraction and PCR Amplification of Giardia DNA from Formalin-Fixed Stool Samples. Exp. Parasitol. 2019, 198, 26–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panina, Y.; Germond, A.; David, B.G.; Watanabe, T.M. Pairwise Efficiency: A New Mathematical Approach to QPCR Data Analysis Increases the Precision of the Calibration Curve Assay. BMC Bioinform. 2019, 20. [Google Scholar] [CrossRef] [Scilit]
- Valeix, N.; Costa, D.; Basmaciyan, L.; Valot, S.; Vincent, A.; Razakandrainibe, R.; Robert-Gangneux, F.; Nourrisson, C.; Pereira, B.; Fréalle, E.; et al. Multicenter Comparative Study of Six Cryptosporidium Parvum DNA Extraction Protocols Including Mechanical Pretreatment from Stool Samples. Microorganisms 2020, 8, 1450. [Google Scholar] [CrossRef] [Scilit]
- Claudel, L.; Valeix, N.; Basmaciyan, L.; Pereira, B.; Costa, D.; Vincent, A.; Valot, S.; Favennec, L.; Dalle, F. Comparative Study of Eleven Mechanical Pretreatment Protocols for Cryptosporidium Parvum DNA Extraction from Stool Samples. Microorganisms 2021, 9, 297. [Google Scholar] [CrossRef] [Scilit]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of Commercial and In-House Real-Time PCR Platforms for 15 Parasites and Microsporidia in Human Stool Samples without a Gold Standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [Scilit]
- Autier, B.; Belaz, S.; Razakandrainibe, R.; Gangneux, J.-P.; Robert-Gangneux, F. Comparison of Three Commercial Multiplex PCR Assays for the Diagnosis of Intestinal Protozoa. Parasite 2018, 25, 48. [Google Scholar] [CrossRef] [Scilit]
- Hartmeyer, G.N.; Hoegh, S.V.; Skov, M.N.; Dessau, R.B.; Kemp, M. Selecting PCR for the Diagnosis of Intestinal Parasitosis: Choice of Targets, Evaluation of In-House Assays, and Comparison with Commercial Kits. J. Parasitol. Res. 2017, 2017, 6205257. [Google Scholar] [CrossRef] [Scilit]
- Paulos, S.; Saugar, J.M.; de Lucio, A.; Fuentes, I.; Mateo, M.; Carmena, D. Comparative Performance Evaluation of Four Commercial Multiplex Real-Time PCR Assays for the Detection of the Diarrhoea-Causing Protozoa Cryptosporidium Hominis/Parvum, Giardia Duodenalis and Entamoeba Histolytica. PLoS ONE 2019, 14, e0215068. [Google Scholar] [CrossRef] [Scilit]
- Mero, S.; Kirveskari, J.; Antikainen, J.; Ursing, J.; Rombo, L.; Kofoed, P.-E.; Kantele, A. Multiplex PCR Detection of Cryptosporidium Sp, Giardia Lamblia and Entamoeba Histolytica Directly from Dried Stool Samples from Guinea-Bissauan Children with Diarrhoea. Infect. Dis. 2017, 49, 655–663. [Google Scholar] [CrossRef] [Scilit]
- Madison-Antenucci, S.; Relich, R.F.; Doyle, L.; Espina, N.; Fuller, D.; Karchmer, T.; Lainesse, A.; Mortensen, J.E.; Pancholi, P.; Veros, W.; et al. Multicenter Evaluation of BD Max Enteric Parasite Real-Time PCR Assay for Detection of Giardia Duodenalis, Cryptosporidium Hominis, Cryptosporidium Parvum, and Entamoeba Histolytica. J. Clin. Microbiol. 2016, 54, 2681–2688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, J.-H.; Lee, S.-E.; Kim, T.S.; Ma, D.-W.; Cho, S.-H.; Chai, J.-Y.; Shin, E.-H. Development of Molecular Diagnosis Using Multiplex Real-Time PCR and T4 Phage Internal Control to Simultaneously Detect Cryptosporidium Parvum, Giardia Lamblia, and Cyclospora Cayetanensis from Human Stool Samples. Korean J. Parasitol. 2018, 56, 419–427. [Google Scholar] [CrossRef] [Scilit]
- Morio, F.; Poirier, P.; Le Govic, Y.; Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; et al. Assessment of the First Commercial Multiplex PCR Kit (ParaGENIE Crypto-Micro Real-Time PCR) for the Detection of Cryptosporidium Spp., Enterocytozoon Bieneusi, and Encephalitozoon Intestinalis from Fecal Samples. Diagn. Microbiol. Infect. Dis. 2019, 95, 34–37. [Google Scholar] [CrossRef] [Scilit]
- Morgan, U.M.; Pallant, L.; Dwyer, B.W.; Forbes, D.A.; Rich, G.; Thompson, R.C. Comparison of PCR and Microscopy for Detection of Cryptosporidium Parvum in Human Fecal Specimens: Clinical Trial. J. Clin. Microbiol. 1998, 36, 995–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aghamolaie, S.; Rostami, A.; Fallahi, S.; Tahvildar Biderouni, F.; Haghighi, A.; Salehi, N. Evaluation of Modified Ziehl-Neelsen, Direct Fluorescent-Antibody and PCR Assay for Detection of Cryptosporidium Spp. in Children Faecal Specimens. J. Parasit. Dis. 2016, 40, 958–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brunet, J.; Lemoine, J.P.; Pesson, B.; Valot, S.; Sautour, M.; Dalle, F.; Muller, C.; Borni-Duval, C.; Caillard, S.; Moulin, B.; et al. Ruling out Nosocomial Transmission of Cryptosporidium in a Renal Transplantation Unit: Case Report. BMC Infect. Dis. 2016, 16, 363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Mean Cq Value (+/− Standard Deviation) | ||||||
|---|---|---|---|---|---|---|
| Oocysts/Gram | Fontaine et al. 2002 | Valeix et al. 2020 | Hadfield et al. 2011 | Mary et al. 2013 | p-Value | |
| C. parvum | 105 | 28.47 (+/− 0.54) | 27.60 (+/− 0.27) | 28.14 (+/− 0.42) | 24.80 (+/− 1.41) | 0.15 |
| 104 | 31.78 (+/− 0.17) | 29.86 (+/− 0.49) | 31.02 (+/− 0.32) | 26.97 (+/− 1.32) | 0.002 | |
| 103 | 34.71 (+/− 1.37) | 35.96 (+/− 0.31) | 35.72 (+/− 0.27) | 30.19 (+/− 0.27) | <0.001 | |
| 102 | / | 36.24 (+/− 0.25) | 39.15 | 32.38 (+/− 1.8) | / | |
| 10 | / | 36.64 (+/− 0.28) | / | / | / | |
| 1 | / | / | / | / | / | |
| Corresponding C. parvum PCR efficiency (%) | 109 | 111 | 84.9 | 143 | / | |
| R² value | 0.998 | 0.878 | 0.994 | 0.994 | / | |
| C. hominis | 105 | 28.14 (0.20) | 28.04 (+/− 0.25) | 28.76 (+/− 0.01) | 27.15 (+/− 0.04) | <0.001 |
| 104 | 30.9 (+/−0.25) | 29.66 (+/− 0.47) | 31.33 (+/− 0.09) | 29.69 (+/− 0.06) | 0.001 | |
| 103 | 38.27 | 36.14 (+/− 0.48) | / | 36.66 (+/− 0.61) | / | |
| 102 | / | / | / | / | / | |
| 10 | / | / | / | / | / | |
| 1 | / | / | / | / | / | |
| Corresponding C. hominis PCR efficiency (%) | 57.5 | 76.5 | / | 62.3 | / | |
| R² value | 0.939 | 0.893 | / | 0.932 | / | |
| Mean Cq Value (+/− Standard Deviation) | ||||||
|---|---|---|---|---|---|---|
| Oocysts/Gram | RIDA® GENE Parasitic Stool Panel II | FTD® Stool Parasites | Amplidiag® Stool Parasites | Allplex® GI Parasite Assay | p-Value | |
| C. parvum | 105 | 27.61 (+/− 0.15) | 19.84 (+/− 0.25) | 28.02 (+/− 0.11) | 28.32 (+/− 0.12) | <0.001 |
| 104 | 30.62 (+/− 0.25) | 22.88 (+/− 0.22) | 32.24 (+/− 0.15) | 31.97 (+/− 0.21) | <0.001 | |
| 103 | 37.7 | 26.59 (+/− 0.24) | 35.17 (+/− 0.95) | 34.72 (+/− 0.42) | / | |
| 102 | / | 30.50 (+/− 0.57) | 44.2 | 37.71 (+/− 0.66) | / | |
| 10 | / | 34.47 (+/− 1.77) | / | 37.68 | / | |
| 1 | / | 34.61 (+/− 1.82) | / | / | / | |
| Corresponding C. parvum PCR efficiency (%) | 57.8 | 104 | 56.4 | 156 | / | |
| R² value | 0.949 | 0.970 | 0.939 | 0.932 | / | |
| C. hominis | 105 | 27.73 (+/− 0.05) | 21.41 (+/− 0.09) | 29.01 (+/− 0.16) | 27.39 (+/− 0.45) | <0.001 |
| 104 | 29.63 (+/− 0.10) | 22.95 (+/− 0.09) | 32.06 (+/− 0.38) | 29.60 (+/− 0.09) | <0.001 | |
| 103 | 38.53 (+/− 2.74) | 26.84 +(/− 0.31) | 36.49 (+/− 1.10) | 33.35 +(/− 0.06) | 0.003 | |
| 102 | / | 29.22 (+/− 0.04) | 44.28 | 36.78 (+/− 0.62) | / | |
| 10 | / | 31.12 (+/− 0.28) | / | / | / | |
| 1 | / | / | / | / | / | |
| Corresponding C. hominis PCR efficiency (%) | 53.1 | 145 | 58.1 | 105 | / | |
| R² value | 0.877 | 0.982 | 0.956 | 0.985 | / | |
| C. cuniculus | C. meleagridis | C. felis | C. chipmunk | C. ubiquitum | |
|---|---|---|---|---|---|
| Fontaine et al. 2002 | Yes | Yes | No | No | No |
| Valeix et al. 2020 | Yes | Yes | Yes | Yes | Yes |
| Hadfield et al. 2011 | Yes | Yes | Yes | Yes | Yes |
| Mary et al. 2013 | No | No | No | No | No |
| RIDA® GENE Parasitic Stool Panel II | Yes | Yes | Yes | Yes | Yes |
| FTD® Stool parasites | Yes | Yes | Yes | Yes | Yes |
| Amplidiag® Stool Parasites | Yes | Yes | Yes | Yes | Yes |
| Allplex® GI Parasite Assay | Yes | Yes | Yes | Yes | Yes |
| Designation | Primers (5′-3′) | Probe (5′-3′) | Target | Amplicon Size (bp) | Thermocycling Conditions | Total Duration |
|---|---|---|---|---|---|---|
| Fontaine et al. 2002 [13] method | F:CGCTTCTCTAGCCTTTCATGA R: CTTCACGTGTGTTTGCCAAT | CCAATCACAGAATCATCAGAATCGACTGGTATC | Specific C. parvum sequence | 138 | 50 °C—2 min 95 °C—10 min 40 cycles: 95 °C—15 s/60 °C—1 min | 62 min |
| Valeix et al. 2020 [22] method | F: GTTAAACTGCRAATGGCT R: CGTCATTGCCACGGTA | CCGTCTAAAGCTGATAGGTCAGAAACTTGAATG and GTCACATTAATTGTGATCCGTAAAG | 18S rRNA | 258 | 95 °C—10 min 50 cycles: 95 °C—15 s/50 °C—15 s (touchdown from 60 °C)/72 °C—15 s | 48 min |
| Hadfield et al. 2011 [14] method | F:GAGGTAGTGACAAGAAATAACAATACAGG R:CTGCTTTAAGCACTCTAATTTTCTCAAAG | TACGAGCTTTTTAACTGCAACAA | 18S SSU rRNA | 300 | 95 °C—10 min 55 cycles: 95 °C—15 s/60 °C—60 s | 78 min |
| Mary et al. 2013 [15] method | F: CATGGATAACCGTGGTAAT R: TACCCTACCGTCTAAAGCTG | CTAGAGCTAATACATGCGAAAAAA | 18S rRNA | 178 | 94 °C—10 min 45 cycles: 94 °C—10 s/54 °C—30 s/72 °C—10 s | 48 min |
| RIDA® GENE Parasitic Stool Panel II | Not disclosed | Not disclosed | Not disclosed | Not disclosed | 95 °C—1 min 45 cycles: 95 °C—15 s/60 °C—30 s | 35 min |
| FTD® Stool parasites | Not disclosed | Not disclosed | DNA J-like protein gene | Not disclosed | 50 °C—15 min 94 °C—1 min 40 cycles: 94 °C—8 s/60 °C—1 min | 62 min |
| Amplidiag® Stool Parasites | Not disclosed | Not disclosed | COWP gene | Not disclosed | 95 °C—10 min 45 cycles: 95 °C—15 s/65 °C—1 min | 66 min |
| Allplex® GI Parasite Assay | Not disclosed | Not disclosed | Not disclosed | Not disclosed | 50 °C—20 min 95 °C—15 min 45 cycles: 95 °C—10 s/60 °C—1 min/72 °C—30 s | 110 min |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Costa, D.; Soulieux, L.; Razakandrainibe, R.; Basmaciyan, L.; Gargala, G.; Valot, S.; Dalle, F.; Favennec, L. Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species. Pathogens 2021, 10, 647. https://doi.org/10.3390/pathogens10060647
Costa D, Soulieux L, Razakandrainibe R, Basmaciyan L, Gargala G, Valot S, Dalle F, Favennec L. Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species. Pathogens. 2021; 10(6):647. https://doi.org/10.3390/pathogens10060647
Chicago/Turabian StyleCosta, Damien, Louise Soulieux, Romy Razakandrainibe, Louise Basmaciyan, Gilles Gargala, Stéphane Valot, Frédéric Dalle, and Loic Favennec. 2021. "Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species" Pathogens 10, no. 6: 647. https://doi.org/10.3390/pathogens10060647
APA StyleCosta, D., Soulieux, L., Razakandrainibe, R., Basmaciyan, L., Gargala, G., Valot, S., Dalle, F., & Favennec, L. (2021). Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species. Pathogens, 10(6), 647. https://doi.org/10.3390/pathogens10060647

