Next Article in Journal
Pharmacotherapy Profiles in People with Opioid Use Disorders: Considerations for Relevant Drug–Drug Interactions with Antiviral Treatments for Hepatitis C
Next Article in Special Issue
Symptomatic and Asymptomatic Protist Infections in Hospital Inpatients in Southwestern China
Previous Article in Journal
Aspergillus Genus and Its Various Human Superficial and Cutaneous Features
Previous Article in Special Issue
High Diversity of Cryptosporidium Species and Subtypes Identified in Cryptosporidiosis Acquired in Sweden and Abroad
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species

1
Department of Parasitology/Mycology, University Hospital of Rouen, 76000 Rouen, France
2
EA ESCAPE 7510, University of Medicine Pharmacy Rouen, 76000 Rouen, France
3
CNR LE Cryptosporidiosis, Santé Publique France, 76000 Rouen, France
4
CNR LE Cryptosporidiosis Collaborating Laboratory, Santé Publique France, 21000 Dijon, France
5
Department of Parasitology/Mycology, University Hospital of Dijon, 21000 Dijon, France
*
Author to whom correspondence should be addressed.
Pathogens 2021, 10(6), 647; https://doi.org/10.3390/pathogens10060647
Submission received: 29 April 2021 / Revised: 21 May 2021 / Accepted: 21 May 2021 / Published: 23 May 2021

Abstract

Diagnostic approaches based on PCR methods are increasingly used in the field of parasitology, particularly to detect Cryptosporidium. Consequently, many different PCR methods are available, both “in-house” and commercial methods. The aim of this study was to compare the performance of eight PCR methods, four “in-house” and four commercial methods, to detect Cryptosporidium species. On the same DNA extracts, performance was evaluated regarding the limit of detection for both C. parvum and C. hominis specificity and the ability to detect rare species implicated in human infection. Results showed variations in terms of performance. The best performance was observed with the FTD® Stool parasites method, which detected C. parvum and C. hominis with a limit of detection of 1 and 10 oocysts/gram of stool respectively; all rare species tested were detected (C. cuniculus, C. meleagridis, C. felis, C. chipmunk, and C. ubiquitum), and no cross-reaction was observed. In addition, no cross-reactivity was observed with other enteric pathogens. However, commercial methods were unable to differentiate Cryptosporidium species, and generally, we recommend testing each DNA extract in at least triplicate to optimize the limit of detection.

1. Introduction

Human cases of cryptosporidiosis were first reported in the 1970s in children and immunosuppressed adults [1]. In 2015, the Global Enteric Multicenter Study (GEMS) described Cryptosporidium spp. as the second leading cause (5–15%) of moderate to severe diarrhea among infants in countries of sub-Saharan Africa and South Asia, after rotavirus [2]. At the same time, Cryptosporidium spp. were found to be responsible for more than 8 million cases of foodborne illnesses in 2010, and they were ranked fifth out of 24 potentially foodborne parasites in terms of importance [3,4]. In 2017 in France, the National Reference Center-Expert Laboratory (CNR-LE) for cryptosporidiosis was set up, allowing the collection and interpretation of epidemiological data thanks to the participation of members of the network. Published data from the French CNR-LE for cryptosporidiosis show that: i) even with around 250 notified cases each year, cryptosporidiosis is still largely underestimated in France, ii) cryptosporidiosis is predominant in immunocompetent individuals and especially in young children and young adults, and iii) cryptosporidiosis is over-represented in the summer [5,6]. The routine diagnosis of cryptosporidiosis still relies on light microscopy examination for many laboratories [7,8,9,10]. However, light microscopy examination lacks sensitivity, is time-consuming, and requires skilled technicians, making it an inefficient method for laboratories which are able to switch to PCR analysis [8,10,11,12]. Currently, several PCR methods are available to screen Cryptosporidium spp. DNA, both “in-house” and commercial methods, sometimes incorporated into multiplex panels [13,14,15,16,17]. Consequently, more and more laboratories are opting for such methods based on the practicalities of economic management. However, disparities exist in the performance of these methods. DNA extraction is essential to obtain good performance in PCR analysis and especially regarding parasitological investigations on stool samples. Some studies reported different performances of DNA extraction methods, and regarding the extraction of Cryptosporidium oocysts, a mechanical treatment of stool samples seems essential [18,19,20,21,22,23]. In addition to the extraction method, the removal of inhibitory substances and the gene locus targeted by related primers plays a major role in the performance of the method. One of the tasks of the CNR-LE for cryptosporidiosis is to assess the performance of available diagnostic tools. A previous work already compared performances of various extraction methods on C. parvum oocysts from stool samples [22]. In continuity of this work and based on the most effective extraction method, we propose a comparison of the limit of detection of eight real-time PCR methods (commercial or not) on the DNA of Cryptosporidium species. The main aim was to provide data to select the best methods for DNA amplification in terms of sensitivity and ability to detect human pathogenic Cryptosporidium species (even rare ones) in routine diagnosis.

2. Results

The results obtained from the four “in-house” PCR methods are summarized in Table 1. Except for the most concentrated C. parvum extract (105 oocysts/gram), significant differences in threshold cycle (Cq) values were observed when applicable (on ANOVA test). All four “in-house” methods detected C. parvum DNA and C. hominis DNA with a limit of detection of 103 oocysts/gram and 104 oocysts/gram, respectively. The most sensitive “in-house” PCR method for both C. parvum and C. hominis was the method developed by the CNR-LE Cryptosporidiosis Collaborating Laboratory (University Hospital of Dijon) and described by Valeix et al. 2020 [22]. Cq values obtained with the method described by Mary et al. 2013 [15] were lower than other tested methods but analysis performed in triplicate was insufficient to detect 10 oocysts/gram for C. parvum, contrary to the method described by Valeix et al. PCR efficiencies were satisfactory only on C. parvum DNA amplification for the methods described by Fontaine et al. 2002 and Valeix et al. 2020 [13,22]. R² values were satisfactory (>0.99) only to detect C. parvum and for the methods described by Fontaine et al. 2002, Hadfield et al. 2011 and Mary et al. 2013 [13,14,15].
The results obtained from the four multiplex commercial methods are presented in Table 2. All four commercial methods detected C. hominis DNA and C. parvum DNA with a limit of detection of 103 oocysts/gram. The best performance was obtained with the FTD Stool parasites method, with a detection of DNA corresponding to 1 oocyst/gram for C. parvum and 10 oocysts/gram for C. hominis. The Allplex GI Parasite Assay kit was the second-best method, with a detection of DNA corresponding to 100 oocysts/gram for C. hominis and 10 oocysts/gram for C. parvum but requiring a triplicate to reach the limit of detection (only 1/3 triplicates was positive to detect C. parvum at 10 oocysts/gram). PCR efficiencies and R² values varied greatly depending on the studied method but overall were unsatisfactory (PCR efficiency < 90% or > 110% and R² value < 0.99)
The ability to detect rare species implicated in human pathologies for each tested method is summarized in Table 3. All tested methods were able to detect the species C. cuniculus, C. meleagridis, C. felis, C. chipmunk, and C. ubiquitum, except the methods described by Mary et al. 2013 and Fontaine et al. 2002 [13,15]. Specificity tests performed in triplicate per condition, as described in the Methods section, revealed cross-reactivity only for the method described by Hadfield et al. 2011 [14] with Encephalitozoon intestinalis DNA.

3. Discussion

This study was designed to address questions regularly raised within the framework of scientific exchanges of the CNR-LE for cryptosporidiosis. It compared the performance of eight PCR methods to detect Cryptosporidium species (even rare) implicated in human infection, and their limit of detection. At first, the subject appeared to be well-investigated within the scientific community. However, in most cases, PCR performances to detect Cryptosporidium DNA were evaluated in cohorts from microscopically positive stool samples (probably relatively highly concentrated in oocysts), or not specifically through multiplex panels and from various extraction methods, or sometimes from DNA extracts stored for a long time [24,25,26,27,28,29,30,31,32,33]. In this study, thanks to a standardized extraction procedure (selected among the best methods regarding specific Cryptosporidium DNA extraction from stool samples [22]), observed PCR performances were exclusively due to the DNA amplification step. The limit of each studied PCR method was determined by assessing titrations of Cryptosporidium oocysts in stool samples as well as testing rare species implicated in human infection. The main interest of the study was to provide data on efficient methods for the routine diagnosis of cryptosporidiosis as a complement to extraction methods already assessed [22,23].
The results obtained generally showed similar performances between commercial and “in-house” methods in terms of limit of detection, with variations between each tested kit. Regarding C. parvum and C. hominis respectively, limits of detection generally reached at least 100 and 1000 oocysts/gram regardless of the method. Nevertheless, the limit of detection appeared optimal with the FTD® method considering both C. parvum and C. hominis. Variations in limits of detection may first be explained by the genes targeted by PCR methods. Three of the four “in-house” methods target the 18S rRNA gene whose expression is estimated at 5 copies/genome (20 copies/oocyst) [15]. The “in-house” method described by Fontaine et al. 2002 targets a gene whose expression is estimated at 1 copy/genome, and indeed, its observed performance in terms of limit of detection was generally poorer than that of the three methods targeting the 18S rRNA gene. Regarding commercial methods, targeted genes were only available for FTD® (DNA J-like protein, number of copies per genome not known) and Amplidiag® methods (COWP gene; 1 copy/genome). Of note, the observed performance of the Amplidiag® method was close to that of Fontaine et al.’s “in-house” method targeting a gene also expressed in 1 copy/genome. Comparing Table 1 and Table 2, the limit of detection of the Amplidiag® method appeared slightly better than that of Fontaine et al.’s “in-house” method (for both C. parvum and C. hominis) but this was only due to DNA detection in one replicate at the very end of the PCR program. It could be explained by the heterogeneous distribution of DNA in elution volume when parasite concentrations are low. To limit this bias, and to obtain optimized performance, we recommend running each DNA extract in several replicates (at least in triplicate) or until exhaustion if possible.
Regarding the results obtained to detect rare species of Cryptosporidium implicated in human infections, most tested methods were able to detect rare species except the “in-house” methods of Fontaine et al. 2002 and Mary et al. 2013 [13,15]. However, a limitation of this study was the use of only triplicate of each tested Cryptosporidium subtype due to the amount of available positive stools. The use of more numerous rare strains could potentially improve the observed results. For the method described by Fontaine et al. 2002, they highlighted the use of a specific primer-probe set supposed to be specific for a C. parvum genomic DNA sequence. No cross-reactivity with other Cryptosporidium species was expected; however, they initially reported cross-reaction with the C. meleagridis genotype, which was confirmed in our study [13]. For the method of Mary et al. 2013, no rare species was detected in this study. In the original article, tests on C. felis, C. bovis, C. cuniculus, C. canis, and C. chipmunk were evoked in the discussion. However, in reality, corresponding results were not shown [15]. Consequently, primers and probes described in the article of Mary et al. 2013 are probably very specific to C. parvum and C. hominis. Regarding specificity in this study, performances obtained were highly satisfactory for each tested condition in concordance with the literature [13,14,15,27,34]. Cross-reactivity with Candida albicans DNA was tested since Mary et al. 2013 reported potential cross-reactivity with the C. albicans 18S rRNA gene (based on an in silico approach) and primers and probes of the PCR method described by Hadfield et al. 2011 [14,15]. For the method described by Hadfield et al. 2011, no cross-reactivity was observed with C. albicans but cross-reactivity was observed with E. intestinalis.
Finally, out of a total of 784 PCRs performed, varying results were obtained from the same DNA samples. Commercial methods (especially FTD® and Allplex®) appeared to be valuable options for large screening to detect Cryptosporidium species. We recommend testing each DNA extract at least in triplicate to optimize the detection of small amounts of DNA. However, if commercial methods are able to detect rare species, results are expressed exclusively as positive or negative for Cryptosporidium spp. DNA detection. Consequently, to discriminate species, we recommend the use of “in-house” methods, and especially the method described by Valeix et al. 2020 [22], due to the results obtained in terms of limit of detection and the ability to detect rare species. In addition, the method described by Valeix et al. 2020 appeared to be strongly replicable, since performances in terms of limit of detection were similar to those described here, even using different stool samples [22].

4. Materials and Methods

4.1. Strains

Cryptosporidium spp. tested strains were obtained from the French cryptosporidiosis CNR-LE stools collection. C. parvum IIaA15G2R1 (n = 3), C. hominis IbA10G2 (n = 3) gp60 subtypes, C. cuniculus (n = 3), C. meleagridis (n = 3), C. felis (n = 3), C. chipmunk (n = 3), and C. ubiquitum (n = 3) were tested, all previously isolated from human clinical samples. In total, per studied method, six ten-fold range points (105-1 oocysts/gram) were studied for both C. parvum and C. hominis. Ranges of dilutions were done from highly concentrated natural stool samples that we diluted subsequently. Ranges of dilutions were performed in liquid stool matrix exempt of Cryptosporidium species. Each sample was vortexed for 20 s before performing dilutions. Oocyst numeration was done microscopically using Kova cells and confirmed by immunofluorescence as described in Section 4.2.
Regarding the studied Cryptosporidium rare species, stools were selected from the CNR collection with oocyst concentrations that varied between 103 and 104 oocysts/gram to be easily detectable.
Other positive stool specimens were obtained from the CNR-LE collection to evaluate specificity: Giardia intestinalis (n = 3), Blastocystis hominis (n = 3), Enterobius vermicularis (n = 3), Chilomastix mesnilii (n = 3), Entamoeba histolytica (n = 3), Entamoeba dispar (n = 3), Encephalitozoon intestinalis (n = 3), and Enterocytozoon bieneusi (n = 3) positive stool samples were tested. Exact stool concentrations of these other pathogens were not calculated. Positivity was objectified by microscopy exclusively assuming relatively high concentrations. Additional tests were performed on Candida albicans (n = 3) and on negative stool samples (n = 20). A total of 784 PCRs were performed (98 per tested method).

4.2. Detection Limit Assays

Serial ten-fold oocyst dilutions (105-1 oocysts/gram of stool) were performed using a negative liquid stool human matrix. Each corresponding dilution was confirmed by counting oocysts microscopically both on Kova slides (Labellians, Nemours, France) and using Crypto-Cel FITC (Cellabs, Sydney, Australia) staining according to the manufacturer’s instructions. Limits of detection were estimated considering the positivity of at least one of the three tested replicates per condition. Cryptosporidium negativity of the matrix was based on both microscopy and PCR investigations from the method described by Valeix et al. 2020.

4.3. DNA Extraction

Based on a previous published work [22], we chose an extraction protocol offering highly satisfying performances in C. parvum DNA extraction from stool matrix. Accordingly, the observed PCR performances were exclusively due to amplification methods since extraction was standardized. Consequently, DNA extraction was performed using a QIAamp PowerFecal DNA kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions. Briefly, it is a manual extraction kit combining thermal, mechanical, and chemical lysis. The starting volume for DNA extraction was 250 µL of sample. Obtained DNA extracts (100 µL) were stored at −20 °C until use. In addition, to control DNA extraction, we used Diacontrol DNA® for each sample according to the manufacturer’s instructions. Ten microliters of viral DNA control was inoculated in each sample before extraction. Control DNA was subsequently detected using ready-to-use ProbePrimer mix (DICD-CY-L100) with the following PCR protocol: 50 °C for 2 min; 95 °C for 10 min; 95 °C for 15 s and 60 °C for 60 s, repeated 45 times.

4.4. PCR Testing

Eight real-time PCR methods were tested on the same DNA extracts: 4 “in-house” PCRs already assessed [13,14,15,22] and 4 multiplex commercial PCRs: RIDA® GENE Parasitic Stool Panel II (R-Biopharm, Darmstadt, Germany), FTD® Stool parasites (Fast Track Diagnostics, Esch-sur-Alzette, Luxembourg), Amplidiag® Stool Parasites (Mobidiag, Paris, France), and Allplex® GI Parasite Assay (Seegene, Düsseldorf, Germany). The studied methods were selected based on methods used in France according to data collected by the CNR-LE for cryptosporidiosis. PCR was performed in triplicate for each tested condition on a CFX96 PCR detection system (Bio-rad, Marnes-la-Coquette, France) according to published data for “in-house” PCR and according to the manufacturer’s instructions for commercial PCR (synthesized in Table 4). A total of 784 PCRs were performed (98 per tested method). In detail, each studied condition was extracted 3 times (N = 3) and run in simplicate per extract for PCR amplification. Consequently, regarding assays from range of dilution + rare species + specificity investigations respectively: 36 + 15 + 47 = 98 DNA extracts were tested for each studied method (N = 8). Assays were divided into two runs per studied method (two distinct PCR plates). A total of 16 PCR runs were done.
Results were considered positive when curves were exponential in logarithmic scale until the last cycle expected by each PCR program (Table 4).
PCR efficiencies (10_1/slope _1) were estimated according to Bustin et al. 2009: plotting the logarithm of the initial template concentration on the x-axis and Cq on the y-axis [35]. R² values were obtained using graphical representation on Excel software.

5. Conclusions

Recent epidemiology confirms that cryptosporidiosis is common worldwide in both immunocompetent and immunocompromised individuals. Diagnostic approaches are still mainly based on microscopy; however, PCR-based methods are increasingly used for routine diagnosis. The performance of PCR methods is variable and needs to be evaluated. In this study, based on PCR analysis of the same DNA extracts, we compared the performance of eight commonly used methods according to limit of detection (for both C. hominis and C. parvum), specificity, and rare species identification. All eight methods were able to detect C. parvum and C. hominis with a limit of detection of 1000 oocysts/gram of stool, but only one method (FTD®) was able to detect one and ten oocysts/gram for C. parvum and C. hominis, respectively. Specificity was satisfactory for each tested method. Six of the eight methods were able to detect rare species implicated in human infection.

Author Contributions

Conceptualization: D.C., R.R., L.F. and F.D.; methodology: D.C. and L.S.; investigation: D.C. and L.S.; supervision: D.C., L.F. and F.D.; writing—original draft preparation: D.C.; writing—review: G.G., S.V., L.B., L.F., R.R. and F.D. All authors have read and agreed to the published version of the manuscript.

Funding

The authors gratefully thank Santé Publique France for their funding of CNR-LE cryptosporidiosis activities.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors are grateful to Nikki Sabourin-Gibbs, Rouen University Hospital, for her help in editing the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hunter, P.R.; Nichols, G. Epidemiology and Clinical Features of Cryptosporidium Infection in Immunocompromised Patients. Clin. Microbiol. Rev. 2002, 15, 145–154. [Google Scholar] [CrossRef] [Scilit]
  2. GBD Diarrhoeal Diseases Collaborators. Estimates of Global, Regional, and National Morbidity, Mortality, and Aetiologies of Diarrhoeal Diseases: A Systematic Analysis for the Global Burden of Disease Study 2015. Lancet Infect. Dis. 2017, 17, 909–948. [Google Scholar] [CrossRef] [Scilit]
  3. FAO/WHO. Multicriteria-Based Ranking for Risk Management of Food-Borne Parasites. Microbiological Risk Assessment Series 23; 2014; Available online: https://apps.who.int/iris/handle/10665/112672 (accessed on 1 May 2021).
  4. Ryan, U.; Hijjawi, N.; Xiao, L. Foodborne Cryptosporidiosis. Int. J. Parasitol. 2018, 48, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Costa, D.; Razakandrainibe, R.; Valot, S.; Vannier, M.; Sautour, M.; Basmaciyan, L.; Gargala, G.; Viller, V.; Lemeteil, D.; Ballet, J.-J.; et al. Epidemiology of Cryptosporidiosis in France from 2017 to 2019. Microorganisms 2020, 8, 1358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Costa, D.; Razakandrainibe, R.; Sautour, M.; Valot, S.; Basmaciyan, L.; Gargala, G.; Lemeteil, D.; Favennec, L.; Dalle, F.; French National Network on Surveillance of Human Cryptosporidiosis. Human Cryptosporidiosis in Immunodeficient Patients in France (2015–2017). Exp. Parasitol. 2018, 192, 108–112. [Google Scholar] [CrossRef] [Scilit]
  7. Robinson, G.; Chalmers, R.M. Cryptosporidium Diagnostic Assays: Microscopy. Methods Mol. Biol. 2020, 2052, 1–10. [Google Scholar] [CrossRef] [Scilit]
  8. Adeyemo, F.E.; Singh, G.; Reddy, P.; Stenström, T.A. Methods for the Detection of Cryptosporidium and Giardia: From Microscopy to Nucleic Acid Based Tools in Clinical and Environmental Regimes. Acta Trop. 2018, 184, 15–28. [Google Scholar] [CrossRef] [Scilit]
  9. Khanna, V.; Tilak, K.; Ghosh, A.; Mukhopadhyay, C. Modified Negative Staining of Heine for Fast and Inexpensive Screening of Cryptosporidium, Cyclospora, and Cystoisospora Spp. Int. Sch. Res. Not. 2014, 2014, 165424. [Google Scholar] [CrossRef] [Scilit]
  10. Jerez Puebla, L.E.; Núñez-Fernández, F.A.; Fraga Nodarse, J.; Atencio Millán, I.; Cruz Rodríguez, I.; Martínez Silva, I.; Ayllón Valdés, L.; Robertson, L.J. Diagnosis of Intestinal Protozoan Infections in Patients in Cuba by Microscopy and Molecular Methods: Advantages and Disadvantages. J. Microbiol. Methods 2020, 179, 106102. [Google Scholar] [CrossRef] [Scilit]
  11. Ahmed, S.A.; Karanis, P. Comparison of Current Methods Used to Detect Cryptosporidium Oocysts in Stools. Int. J. Hyg. Environ. Health 2018, 221, 743–763. [Google Scholar] [CrossRef] [Scilit]
  12. Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; Le Govic, Y.; Dalle, F.; Botterel, F.; et al. Is Real-Time PCR-Based Diagnosis Similar in Performance to Routine Parasitological Examination for the Identification of Giardia Intestinalis, Cryptosporidium Parvum/Cryptosporidium Hominis and Entamoeba Histolytica from Stool Samples? Evaluation of a New Commercial Multiplex PCR Assay and Literature Review. Clin. Microbiol. Infect. 2016, 22, 190.e1–190.e8. [Google Scholar] [CrossRef] [Scilit]
  13. Fontaine, M.; Guillot, E. Development of a TaqMan Quantitative PCR Assay Specific for Cryptosporidium Parvum. FEMS Microbiol. Lett. 2002, 214, 13–17. [Google Scholar] [CrossRef] [PubMed]
  14. Hadfield, S.J.; Robinson, G.; Elwin, K.; Chalmers, R.M. Detection and Differentiation of Cryptosporidium Spp. in Human Clinical Samples by Use of Real-Time PCR. J. Clin. Microbiol. 2011, 49, 918–924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Mary, C.; Chapey, E.; Dutoit, E.; Guyot, K.; Hasseine, L.; Jeddi, F.; Menotti, J.; Paraud, C.; Pomares, C.; Rabodonirina, M.; et al. Multicentric Evaluation of a New Real-Time PCR Assay for Quantification of Cryptosporidium Spp. and Identification of Cryptosporidium Parvum and Cryptosporidium Hominis. J. Clin. Microbiol. 2013, 51, 2556–2563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Fischer, P.; Taraschewski, H.; Ringelmann, R.; Eing, B. Detection of Cryptosporidium Parvum in Human Feces by PCR. Tokai J. Exp. Clin. Med. 1998, 23, 309–311. [Google Scholar]
  17. Gallas-Lindemann, C.; Sotiriadou, I.; Plutzer, J.; Noack, M.J.; Mahmoudi, M.R.; Karanis, P. Giardia and Cryptosporidium Spp. Dissemination during Wastewater Treatment and Comparative Detection via Immunofluorescence Assay (IFA), Nested Polymerase Chain Reaction (Nested PCR) and Loop Mediated Isothermal Amplification (LAMP). Acta Trop. 2016, 158, 43–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Yu, Z.; Morrison, M. Improved Extraction of PCR-Quality Community DNA from Digesta and Fecal Samples. Biotechniques 2004, 36, 808–812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Müller, A.; Stellermann, K.; Hartmann, P.; Schrappe, M.; Fätkenheuer, G.; Salzberger, B.; Diehl, V.; Franzen, C. A Powerful DNA Extraction Method and PCR for Detection of Microsporidia in Clinical Stool Specimens. Clin. Diagn. Lab. Immunol. 1999, 6, 243–246. [Google Scholar] [CrossRef] [Scilit]
  20. Lee, M.F.; Lindo, J.F.; Auer, H.; Walochnik, J. Successful Extraction and PCR Amplification of Giardia DNA from Formalin-Fixed Stool Samples. Exp. Parasitol. 2019, 198, 26–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Panina, Y.; Germond, A.; David, B.G.; Watanabe, T.M. Pairwise Efficiency: A New Mathematical Approach to QPCR Data Analysis Increases the Precision of the Calibration Curve Assay. BMC Bioinform. 2019, 20. [Google Scholar] [CrossRef] [Scilit]
  22. Valeix, N.; Costa, D.; Basmaciyan, L.; Valot, S.; Vincent, A.; Razakandrainibe, R.; Robert-Gangneux, F.; Nourrisson, C.; Pereira, B.; Fréalle, E.; et al. Multicenter Comparative Study of Six Cryptosporidium Parvum DNA Extraction Protocols Including Mechanical Pretreatment from Stool Samples. Microorganisms 2020, 8, 1450. [Google Scholar] [CrossRef] [Scilit]
  23. Claudel, L.; Valeix, N.; Basmaciyan, L.; Pereira, B.; Costa, D.; Vincent, A.; Valot, S.; Favennec, L.; Dalle, F. Comparative Study of Eleven Mechanical Pretreatment Protocols for Cryptosporidium Parvum DNA Extraction from Stool Samples. Microorganisms 2021, 9, 297. [Google Scholar] [CrossRef] [Scilit]
  24. Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of Commercial and In-House Real-Time PCR Platforms for 15 Parasites and Microsporidia in Human Stool Samples without a Gold Standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [Scilit]
  25. Autier, B.; Belaz, S.; Razakandrainibe, R.; Gangneux, J.-P.; Robert-Gangneux, F. Comparison of Three Commercial Multiplex PCR Assays for the Diagnosis of Intestinal Protozoa. Parasite 2018, 25, 48. [Google Scholar] [CrossRef] [Scilit]
  26. Hartmeyer, G.N.; Hoegh, S.V.; Skov, M.N.; Dessau, R.B.; Kemp, M. Selecting PCR for the Diagnosis of Intestinal Parasitosis: Choice of Targets, Evaluation of In-House Assays, and Comparison with Commercial Kits. J. Parasitol. Res. 2017, 2017, 6205257. [Google Scholar] [CrossRef] [Scilit]
  27. Paulos, S.; Saugar, J.M.; de Lucio, A.; Fuentes, I.; Mateo, M.; Carmena, D. Comparative Performance Evaluation of Four Commercial Multiplex Real-Time PCR Assays for the Detection of the Diarrhoea-Causing Protozoa Cryptosporidium Hominis/Parvum, Giardia Duodenalis and Entamoeba Histolytica. PLoS ONE 2019, 14, e0215068. [Google Scholar] [CrossRef] [Scilit]
  28. Mero, S.; Kirveskari, J.; Antikainen, J.; Ursing, J.; Rombo, L.; Kofoed, P.-E.; Kantele, A. Multiplex PCR Detection of Cryptosporidium Sp, Giardia Lamblia and Entamoeba Histolytica Directly from Dried Stool Samples from Guinea-Bissauan Children with Diarrhoea. Infect. Dis. 2017, 49, 655–663. [Google Scholar] [CrossRef] [Scilit]
  29. Madison-Antenucci, S.; Relich, R.F.; Doyle, L.; Espina, N.; Fuller, D.; Karchmer, T.; Lainesse, A.; Mortensen, J.E.; Pancholi, P.; Veros, W.; et al. Multicenter Evaluation of BD Max Enteric Parasite Real-Time PCR Assay for Detection of Giardia Duodenalis, Cryptosporidium Hominis, Cryptosporidium Parvum, and Entamoeba Histolytica. J. Clin. Microbiol. 2016, 54, 2681–2688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Shin, J.-H.; Lee, S.-E.; Kim, T.S.; Ma, D.-W.; Cho, S.-H.; Chai, J.-Y.; Shin, E.-H. Development of Molecular Diagnosis Using Multiplex Real-Time PCR and T4 Phage Internal Control to Simultaneously Detect Cryptosporidium Parvum, Giardia Lamblia, and Cyclospora Cayetanensis from Human Stool Samples. Korean J. Parasitol. 2018, 56, 419–427. [Google Scholar] [CrossRef] [Scilit]
  31. Morio, F.; Poirier, P.; Le Govic, Y.; Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; et al. Assessment of the First Commercial Multiplex PCR Kit (ParaGENIE Crypto-Micro Real-Time PCR) for the Detection of Cryptosporidium Spp., Enterocytozoon Bieneusi, and Encephalitozoon Intestinalis from Fecal Samples. Diagn. Microbiol. Infect. Dis. 2019, 95, 34–37. [Google Scholar] [CrossRef] [Scilit]
  32. Morgan, U.M.; Pallant, L.; Dwyer, B.W.; Forbes, D.A.; Rich, G.; Thompson, R.C. Comparison of PCR and Microscopy for Detection of Cryptosporidium Parvum in Human Fecal Specimens: Clinical Trial. J. Clin. Microbiol. 1998, 36, 995–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Aghamolaie, S.; Rostami, A.; Fallahi, S.; Tahvildar Biderouni, F.; Haghighi, A.; Salehi, N. Evaluation of Modified Ziehl-Neelsen, Direct Fluorescent-Antibody and PCR Assay for Detection of Cryptosporidium Spp. in Children Faecal Specimens. J. Parasit. Dis. 2016, 40, 958–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Brunet, J.; Lemoine, J.P.; Pesson, B.; Valot, S.; Sautour, M.; Dalle, F.; Muller, C.; Borni-Duval, C.; Caillard, S.; Moulin, B.; et al. Ruling out Nosocomial Transmission of Cryptosporidium in a Renal Transplantation Unit: Case Report. BMC Infect. Dis. 2016, 16, 363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Table 1. Limit of detection of tested “in-house” methods on C. parvum and C. hominis. PCR efficiencies were calculated based on obtained results from corresponding ranges of dilutions.
Table 1. Limit of detection of tested “in-house” methods on C. parvum and C. hominis. PCR efficiencies were calculated based on obtained results from corresponding ranges of dilutions.
Mean Cq Value (+/− Standard Deviation)
Oocysts/GramFontaine et al. 2002Valeix et al. 2020 Hadfield et al. 2011Mary et al. 2013 p-Value
C. parvum10528.47 (+/− 0.54)27.60 (+/− 0.27)28.14 (+/− 0.42)24.80 (+/− 1.41)0.15
10431.78 (+/− 0.17)29.86 (+/− 0.49)31.02 (+/− 0.32)26.97 (+/− 1.32)0.002
10334.71 (+/− 1.37)35.96 (+/− 0.31)35.72 (+/− 0.27)30.19 (+/− 0.27)<0.001
102/36.24 (+/− 0.25)39.1532.38 (+/− 1.8)/
10/36.64 (+/− 0.28)///
1/////
Corresponding C. parvum PCR efficiency (%)10911184.9143/
R² value0.9980.8780.9940.994/
C. hominis10528.14 (0.20)28.04 (+/− 0.25)28.76 (+/− 0.01)27.15 (+/− 0.04)<0.001
10430.9 (+/−0.25)29.66 (+/− 0.47)31.33 (+/− 0.09)29.69 (+/− 0.06)0.001
10338.2736.14 (+/− 0.48)/36.66 (+/− 0.61)/
102/////
10/////
1/////
Corresponding C. hominis PCR efficiency (%)57.576.5/62.3/
R² value0.9390.893/0.932/
Table 2. Limit of detection of tested commercial methods on C. parvum and C. hominis. PCR efficiencies were calculated based on obtained results from corresponding ranges of dilutions.
Table 2. Limit of detection of tested commercial methods on C. parvum and C. hominis. PCR efficiencies were calculated based on obtained results from corresponding ranges of dilutions.
Mean Cq Value (+/− Standard Deviation)
Oocysts/GramRIDA® GENE Parasitic Stool Panel IIFTD® Stool ParasitesAmplidiag® Stool ParasitesAllplex® GI Parasite Assayp-Value
C. parvum10527.61 (+/− 0.15)19.84 (+/− 0.25)28.02 (+/− 0.11)28.32 (+/− 0.12)<0.001
10430.62 (+/− 0.25)22.88 (+/− 0.22)32.24 (+/− 0.15)31.97 (+/− 0.21)<0.001
10337.726.59 (+/− 0.24)35.17 (+/− 0.95)34.72 (+/− 0.42)/
102/30.50 (+/− 0.57)44.237.71 (+/− 0.66)/
10/34.47 (+/− 1.77)/37.68/
1/34.61 (+/− 1.82)///
Corresponding C. parvum PCR efficiency (%)57.810456.4156/
R² value0.9490.9700.9390.932/
C. hominis10527.73 (+/− 0.05)21.41 (+/− 0.09)29.01 (+/− 0.16)27.39 (+/− 0.45)<0.001
10429.63 (+/− 0.10)22.95 (+/− 0.09)32.06 (+/− 0.38)29.60 (+/− 0.09)<0.001
10338.53 (+/− 2.74)26.84 +(/− 0.31)36.49 (+/− 1.10)33.35 +(/− 0.06)0.003
102/29.22 (+/− 0.04)44.2836.78 (+/− 0.62)/
10/31.12 (+/− 0.28)///
1/////
Corresponding C. hominis PCR efficiency (%)53.114558.1105/
R² value0.8770.9820.9560.985/
Table 3. Detection of rare species of Cryptosporidium implicated in human cases by tested methods.
Table 3. Detection of rare species of Cryptosporidium implicated in human cases by tested methods.
C. cuniculusC. meleagridisC. felisC. chipmunkC. ubiquitum
Fontaine et al. 2002YesYesNoNoNo
Valeix et al. 2020YesYesYesYesYes
Hadfield et al. 2011YesYesYesYesYes
Mary et al. 2013NoNoNoNoNo
RIDA® GENE Parasitic Stool Panel IIYesYesYesYesYes
FTD® Stool parasitesYesYesYesYesYes
Amplidiag® Stool ParasitesYesYesYesYesYes
Allplex® GI Parasite AssayYesYesYesYesYes
Table 4. Description of tested methods.
Table 4. Description of tested methods.
DesignationPrimers (5′-3′)Probe (5′-3′)TargetAmplicon Size (bp)Thermocycling Conditions Total
Duration
Fontaine et al. 2002 [13] methodF:CGCTTCTCTAGCCTTTCATGA
R: CTTCACGTGTGTTTGCCAAT
CCAATCACAGAATCATCAGAATCGACTGGTATCSpecific
C. parvum sequence
138 50 °C—2 min
95 °C—10 min
40 cycles: 95 °C—15 s/60 °C—1 min
62 min
Valeix et al. 2020 [22] methodF: GTTAAACTGCRAATGGCT
R: CGTCATTGCCACGGTA
CCGTCTAAAGCTGATAGGTCAGAAACTTGAATG and GTCACATTAATTGTGATCCGTAAAG18S rRNA258 95 °C—10 min
50 cycles: 95 °C—15 s/50 °C—15 s (touchdown from 60 °C)/72 °C—15 s
48 min
Hadfield et al. 2011 [14] methodF:GAGGTAGTGACAAGAAATAACAATACAGG
R:CTGCTTTAAGCACTCTAATTTTCTCAAAG
TACGAGCTTTTTAACTGCAACAA18S SSU rRNA30095 °C—10 min
55 cycles: 95 °C—15 s/60 °C—60 s
78 min
Mary et al. 2013 [15] methodF: CATGGATAACCGTGGTAAT
R: TACCCTACCGTCTAAAGCTG
CTAGAGCTAATACATGCGAAAAAA18S rRNA17894 °C—10 min
45 cycles: 94 °C—10 s/54 °C—30 s/72 °C—10 s
48 min
RIDA® GENE Parasitic Stool Panel IINot disclosed Not disclosed Not disclosed Not disclosed 95 °C—1 min
45 cycles: 95 °C—15 s/60 °C—30 s
35 min
FTD® Stool parasitesNot disclosed Not disclosed DNA J-like protein gene Not disclosed 50 °C—15 min
94 °C—1 min
40 cycles: 94 °C—8 s/60 °C—1 min
62 min
Amplidiag® Stool ParasitesNot disclosed Not disclosed COWP geneNot disclosed95 °C—10 min
45 cycles: 95 °C—15 s/65 °C—1 min
66 min
Allplex® GI Parasite AssayNot disclosed Not disclosed Not disclosed Not disclosed 50 °C—20 min
95 °C—15 min
45 cycles: 95 °C—10 s/60 °C—1 min/72 °C—30 s
110 min
F: Forward. R: Reverse. SSU: Small subunit. COWP: Cryptosporidium oocyst wall protein.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Costa, D.; Soulieux, L.; Razakandrainibe, R.; Basmaciyan, L.; Gargala, G.; Valot, S.; Dalle, F.; Favennec, L. Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species. Pathogens 2021, 10, 647. https://doi.org/10.3390/pathogens10060647

AMA Style

Costa D, Soulieux L, Razakandrainibe R, Basmaciyan L, Gargala G, Valot S, Dalle F, Favennec L. Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species. Pathogens. 2021; 10(6):647. https://doi.org/10.3390/pathogens10060647

Chicago/Turabian Style

Costa, Damien, Louise Soulieux, Romy Razakandrainibe, Louise Basmaciyan, Gilles Gargala, Stéphane Valot, Frédéric Dalle, and Loic Favennec. 2021. "Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species" Pathogens 10, no. 6: 647. https://doi.org/10.3390/pathogens10060647

APA Style

Costa, D., Soulieux, L., Razakandrainibe, R., Basmaciyan, L., Gargala, G., Valot, S., Dalle, F., & Favennec, L. (2021). Comparative Performance of Eight PCR Methods to Detect Cryptosporidium Species. Pathogens, 10(6), 647. https://doi.org/10.3390/pathogens10060647

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop