Characteristics and Pathogenicity of the Cell-Adapted Attenuated Porcine Epidemic Diarrhea Virus of the Non-S INDEL Cluster
Abstract
:1. Introduction
2. Results
2.1. Genetic Variations of PEDV in Field Isolates from Vietnam in 2018
2.2. Isolation and Characterization of the PEDV2 Passages
2.3. Selection of Permissive Cell Lines with PEDV2
2.4. Pathogenicity of PEDV2 Passages in Neonatal Piglets
3. Discussion
4. Materials and Methods
4.1. Virus and Cell Lines
4.2. RNA Extraction and Quantitative RT-PCR
4.3. Sequencing and Phylogenetic Analysis
4.4. Virus Infection and Titration
4.5. Isolation and Attenuation of the PEDV2 Virus in VERO-CCL81 Cells
4.6. Virus Purification
4.7. Culture of PEDV2 in Different Laboratory Cell Lines
4.8. Pathogenicity of PEDV2 Passages in Neonatal Piglets
4.9. Histopathology and Immunohistochemistry (IHC)
4.10. Bioinformatic Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pensaert, M.B.; de Bouck, P. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, C.M.; Saif, L.J.; Marthaler, D.; Wang, Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Viruses Res. 2016, 226, 20–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, R.-Q.; Cai, R.-J.; Chen, Y.-Q.; Liang, P.-S.; Chen, D.-K.; Song, C.-X. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg. Infect. Dis. 2012, 18, 161–163. [Google Scholar] [CrossRef]
- Song, D.; Moon, H.; Kang, B. Porcine epidemic diarrhea: A review of current epidemiology and available vaccines. Clin. Exp. Vaccine Res. 2015, 4, 166–176. [Google Scholar] [CrossRef] [Green Version]
- Bridgen, A.; Kocherhans, R.; Tobler, K.; Carvajal, A.; Ackermann, M. Further analysis of the genome of porcine epidemic diarrhoea virus. Adv. Exp. Med. Biol. 1998, 440, 781–786. [Google Scholar] [CrossRef]
- Duarte, M.; Laude, H. Sequence of the spike protein of the porcine epidemic diarrhoea virus. J. Gen. Virol. 1994, 75 Pt 5, 1195–1200. [Google Scholar] [CrossRef]
- Egberink, H.F.; Ederveen, J.; Callebaut, P.; Horzinek, M.C. Characterization of the structural proteins of porcine epizootic diarrhea virus, strain CV777. Am. J. Vet. Res. 1988, 49, 1320–1324. [Google Scholar]
- Kocherhans, R.; Bridgen, A.; Ackermann, M.; Tobler, K. Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Gen. 2001, 23, 137–144. [Google Scholar] [CrossRef] [Green Version]
- Pensaert, M.B.; de Bouck, P. Porcine Epidemic Diarrhea. In Disease of Swine, 9th ed.; Straw, B.E., Zimmerman, J.J., D’Allaire, S., Taylor, D.J., Eds.; Wiley-Blackwell: New York, NY, USA, 2006; pp. 267–372. [Google Scholar]
- Kaewborisuth, C.; He, Q.; Jongkaewwattana, A. The Accessory Protein ORF3 Contributes to Porcine Epidemic Diarrhea Virus Replication by Direct Binding to the Spike Protein. Viruses 2018, 10, 399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Si, F.; Hu, X.; Wang, C.; Chen, B.; Wang, R.; Dong, S.; Yu, R.; Li, Z. Porcine Epidemic Diarrhea Virus (PEDV) ORF3 Enhances Viral Proliferation by Inhibiting Apoptosis of Infected Cells. Viruses 2020, 12, 214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, K.; Lu, W.; Chen, J.; Xie, S.; Shi, H.; Hsu, H.; Yu, W.; Xu, K.; Bian, C.; Fischer, W.B.; et al. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Lett. 2012, 586, 384–391. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; van Kuppeveld, F.J.M.; He, Q.; Rottier, P.J.M.; Bosch, B.J. Cellular entry of the porcine epidemic diarrhea virus. Viruses Res. 2016, 226, 117–127. [Google Scholar] [CrossRef] [Green Version]
- Wicht, O.; Li, W.; Willems, L.; Meuleman, T.J.; Wubbolts, R.W.; van Kuppeveld, F.J.; Rottier, P.J.; Bosch, B.J. Proteolytic activation of the porcine epidemic diarrhea coronavirus spike fusion protein by trypsin in cell culture. J. Virol. 2014, 88, 7952–7961. [Google Scholar] [CrossRef] [Green Version]
- Park, S.J.; Kim, H.K.; Song, D.S.; Moon, H.J.; Park, B.K. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field isolates in Korea. Arch. Virol. 2011, 156, 577–585. [Google Scholar] [CrossRef]
- Stott, C.J.; Temeeyasen, G.; Tripipat, T.; Kaewprommal, P.; Tantituvanont, A.; Piriyapongsa, J.; Nilubol, D. Evolutionary and epidemiological analyses based on spike genes of porcine epidemic diarrhea virus circulating in Thailand in 2008–2015. Infect. Genet. Evol. 2017, 50, 70–76. [Google Scholar] [CrossRef] [PubMed]
- Do, D.; Nguyen, T.; Puranaveja, S.; Thanawongnuwech, R. Genetic Characterization of Porcine Epidemic Diarrhea Virus (PEDV) Isolates from Southern Vietnam during 2009–2010 Outbreaks. Isr. J. Vet. Med. 2011, 41, 9. [Google Scholar]
- Kusanagi, K.-I.; Kuwahara, H.; Katoh, T.; Nunoya, T.; Ishikawa, Y.; Samejima, T.; Tajima, M. Isolation and Serial Propagation of Porcine Epidemic Diarrhea Virus in Cell Cultures and Partial Characterization of the Isolate. J. Vet. Med. Sci. 1992, 54, 313–318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kweon, C.-H.; Kwon, B.-J.; Jung, T.-S.; Kee, Y.-J.; Hur, D.-H.; Hwang, E.-K.; Rhee, J.-C.; An, S.-H. Isolation of porcine epidemic diarrhea virus (PEDV) in Korea. Korean J. Vet. Res. 1993, 33, 249–254. [Google Scholar]
- Song, D.; Park, B. Porcine epidemic diarrhoea virus: A comprehensive review of molecular epidemiology, diagnosis, and vaccines. Viruses Gen. 2012, 44, 167–175. [Google Scholar] [CrossRef]
- Takahashi, K.; Okada, K.; Ohshima, K. An outbreak of swine diarrhea of a new-type associated with coronavirus-like particles in Japan. Nihon Juigaku Zasshi 1983, 45, 829–832. [Google Scholar] [CrossRef] [Green Version]
- Chang, S.H.; Bae, J.L.; Kang, T.J.; Kim, J.; Chung, G.H.; Lim, C.W.; Laude, H.; Yang, M.S.; Jang, Y.S. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol. Cells 2002, 14, 295–299. [Google Scholar]
- Cruz, D.J.; Kim, C.J.; Shin, H.J. The GPRLQPY motif located at the carboxy-terminal of the spike protein induces antibodies that neutralize Porcine epidemic diarrhea virus. Viruses Res. 2008, 132, 192–196. [Google Scholar] [CrossRef]
- Sun, D.; Feng, L.; Shi, H.; Chen, J.; Cui, X.; Chen, H.; Liu, S.; Tong, Y.; Wang, Y.; Tong, G. Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet. Microbiol. 2008, 131, 73–81. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Qiao, S.; Yang, Y.; Su, Y.; Zhao, P.; Zhou, E.; Zhang, G. Phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field strains in central China based on the ORF3 gene and the main neutralization epitopes. Arch. Viruses 2014, 159, 1057–1065. [Google Scholar] [CrossRef]
- de Wilde, A.H.; Raj, V.S.; Oudshoorn, D.; Bestebroer, T.M.; van Nieuwkoop, S.; Limpens, R.W.A.L.; Posthuma, C.C.; van der Meer, Y.; Bárcena, M.; Haagmans, B.L.; et al. MERS-coronavirus replication induces severe in vitro cytopathology and is strongly inhibited by cyclosporin A or interferon-α treatment. J. Gen. Viruses 2013, 94 Pt 8, 1749–1760. [Google Scholar] [CrossRef]
- Schildgen, O.; Jebbink, M.F.; de Vries, M.; Pyrc, K.; Dijkman, R.; Simon, A.; Müller, A.; Kupfer, B.; van der Hoek, L. Identification of cell lines permissive for human coronavirus NL63. J. Viruses Met. 2006, 138, 207–210. [Google Scholar] [CrossRef]
- Zhou, P.; Yang, X.L.; Wang, X.G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.R.; Zhu, Y.; Li, B.; Huang, C.L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [Green Version]
- Jang, G.; Won, H.; Lee, D.U.; Noh, Y.H.; Lee, S.C.; Choi, H.W.; Yoon, I.J.; Lee, Y.J.; Sang Yoo, H.; Lee, C. Assessment of the safety and efficacy of an attenuated live vaccine based on highly virulent genotype 2b porcine epidemic diarrhea virus in nursing piglets. Vet. Microbiol. 2019, 231, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Song, D.S.; Oh, J.S.; Kang, B.K.; Yang, J.S.; Moon, H.J.; Yoo, H.S.; Jang, Y.S.; Park, B.K. Oral efficacy of Vero cell attenuated porcine epidemic diarrhea virus DR13 strain. Res. Vet. Sci. 2007, 82, 134–140. [Google Scholar] [CrossRef]
- Won, H.; Lee, D.U.; Jang, G.; Noh, Y.H.; Lee, S.C.; Choi, H.W.; Yoon, I.J.; Yoo, H.S.; Lee, C. Generation and protective efficacy of a cold-adapted attenuated genotype 2b porcine epidemic diarrhea virus. J. Vet. Sci. 2019, 20, e32. [Google Scholar] [CrossRef]
- Wu, Y.; Li, W.; Zhou, Q.; Li, Q.; Xu, Z.; Shen, H.; Chen, F. Characterization and pathogenicity of Vero cell-attenuated porcine epidemic diarrhea virus CT strain. Viruses J. 2019, 16, 121. [Google Scholar] [CrossRef] [Green Version]
- Diep, N.V.; Sueyoshi, M.; Izzati, U.; Fuke, N.; Teh, A.P.P.; Lan, N.T.; Yamaguchi, R. Appearance of US-like porcine epidemic diarrhoea virus (PEDV) strains before US outbreaks and genetic heterogeneity of PEDVs collected in Northern Vietnam during 2012–2015. Transbound. Emerg. Dis. 2018, 65, e83–e93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Than, V.T.; Choe, S.-E.; Vu, T.T.H.; Do, T.D.; Nguyen, T.L.; Bui, T.T.N.; Mai, T.N.; Cha, R.M.; Song, D.; An, D.-J.; et al. Genetic characterization of the spike gene of porcine epidemic diarrhea viruses (PEDVs) circulating in Vietnam from 2015 to 2016. Vet. Med. Sci. 2020, 6, 535–542. [Google Scholar] [CrossRef] [Green Version]
- Van Diep, N.; Sueyoshi, M.; Norimine, J.; Hirai, T.; Myint, O.; Teh, A.P.P.; Izzati, U.Z.; Fuke, N.; Yamaguchi, R. Molecular characterization of US-like and Asian non-S INDEL strains of porcine epidemic diarrhea virus (PEDV) that circulated in Japan during 2013–2016 and PEDVs collected from recurrent outbreaks. BMC Vet. Res. 2018, 14, 96. [Google Scholar] [CrossRef]
- Wen, Z.; Li, J.; Zhang, Y.; Zhou, Q.; Gong, L.; Xue, C.; Cao, Y. Genetic epidemiology of porcine epidemic diarrhoea virus circulating in China in 2012–2017 based on spike gene. Transbound. Emerg. Dis. 2018, 65, 883–889. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ma, Z.; Li, Y.; Gao, S.; Xiao, S. Porcine epidemic diarrhea virus: Molecular mechanisms of attenuation and vaccines. Microb. Pathog. 2020, 149, 104553. [Google Scholar] [CrossRef] [PubMed]
- Sato, T.; Takeyama, N.; Katsumata, A.; Tuchiya, K.; Kodama, T.; Kusanagi, K.-i. Mutations in the spike gene of porcine epidemic diarrhea virus associated with growth adaptation in vitro and attenuation of virulence in vivo. Viruses Gen. 2011, 43, 72–78. [Google Scholar] [CrossRef]
- Kweon, C.-H.; Kwon, B.-J.; Lee, J.-G.; Kwon, G.-O.; Kang, Y.-B. Derivation of attenuated porcine epidemic diarrhea virus (PEDV) as vaccine candidate. Vaccine 1999, 17, 2546–2553. [Google Scholar] [CrossRef]
- Lv, C.; Xiao, Y.; Li, X.; Tian, K. Porcine epidemic diarrhea virus: Current insights. Viruses Adapt. Treat. 2016, 8, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Won, H.; Lim, J.; Noh, Y.H.; Yoon, I.; Yoo, H.S. Efficacy of Porcine Epidemic Diarrhea Vaccines: A Systematic Review and Meta-Analysis. Vaccine 2020, 8, 642. [Google Scholar] [CrossRef]
- Beall, A.; Yount, B.; Lin, C.-M.; Hou, Y.; Wang, Q.; Saif, L.; Baric, R.; Lipkin, W.I. Characterization of a Pathogenic Full-Length cDNA Clone and Transmission Model for Porcine Epidemic Diarrhea Virus Strain PC22A. mBio 2016, 7, e01451-15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, C.M.; Wang, B.; Zhou, J.; Huang, Y.W. Aminopeptidase-N-independent entry of porcine epidemic diarrhea virus into Vero or porcine small intestine epithelial cells. Virology 2018, 517, 16–23. [Google Scholar] [CrossRef]
- Li, W.; Luo, R.; He, Q.; van Kuppeveld, F.J.M.; Rottier, P.J.M.; Bosch, B.J. Aminopeptidase N is not required for porcine epidemic diarrhea virus cell entry. Viruses Res. 2017, 235, 6–13. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.H.; Kim, I.J.; Pyo, H.M.; Tark, D.S.; Song, J.Y.; Hyun, B.H. Multiplex real-time RT-PCR for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus. J. Virol. Met. 2007, 146, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Park, S.J.; Moon, H.J.; Luo, Y.; Kim, H.K.; Kim, E.M.; Yang, J.S.; Song, D.S.; Kang, B.K.; Lee, C.S.; Park, B.K. Cloning and further sequence analysis of the ORF3 gene of wild- and attenuated-type porcine epidemic diarrhea viruses. Viruses Gen. 2008, 36, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Park, S.J.; Song, D.S.; Ha, G.W.; Park, B.K. Cloning and further sequence analysis of the spike gene of attenuated porcine epidemic diarrhea virus DR13. Viruses Gen. 2007, 35, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, M.; Wyler, R. Propagation of the virus of porcine epidemic diarrhea in cell culture. J. Clin. Microbiol. 1988, 26, 2235–2239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kärber, G. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Naunyn-Schmiedebergs Archiv für experimentelle pathologie und pharmakologie 1931, 162, 480–483. [Google Scholar] [CrossRef]
- Spearman, C. The method of ‘right and wrong cases’ (‘constant stimuli’) without gauss’s formulae. Br. J. Psychol. 1908, 2, 227–242. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
Amino Acid Position | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
27 | 46 | 61 | 62 | 63 | 122 | 193 | 265 | 492 | 647 | 888 | 1242 | 1257 | |
PEDV2-p0 | S | V | V | T | C | R | A | H | L | D | G | P | S |
PEDV2-p10 | . | . | . | . | . | . | . | . | . | . | . | . | . |
PEDV2-p26 | L | A | . | . | . | . | S | D | V | . | R | S | S |
PEDV2-p46 | L | A | A | - | - | L | S | D | V | G | R | S | S |
PEDV2-p103 | L | . | A | - | - | L | S | D | . | G | R | S | F |
LLC-MK2/PEDV2-p50 * | . | . | . | . | . | . | . | . | . | . | . | . | . |
Cell Line | Origin of Cell | PEDV2-p10 | PEDV2-p103 | ||||
---|---|---|---|---|---|---|---|
CPE | ΔCt d0-d4 | Log10 (TCID50/mL) | CPE | ΔCt d0-d4 | Log10 (TCID50/mL) | ||
LLC-MK2 | Monkey (Macaca mulatta) kidney epithelial | 40 h | 14.62 | 6.50 | 40 h | 16.91 | 6.50 |
VERO-CCL81 | Monkey (Cercopithecus aethiops) kidney epithelial | 40 h | 14.67 | 6.3 | 40 h | 17.23 | 6.7 |
MARC-145 | Monkey (Cercopithecus aethiops) kidney epithelial | 48 h | 14.78 | 6.5 | 48 h | 11.03 | 5.5 |
ST | Swine (Sus scrofa) testis fibroblast | 48 h | 12.71 | 5.9 | 48 h | 14.81 | 6.1 |
IPEC-J2 | Intestinal porcine (Sus scrofa) epithelial cell -J2 | No | - | ND | No | - | ND |
PK15 | Porcine (Sus scrofa) kidney epithelial | No | - | ND | No | - | ND |
Primer | Sequence (5′-3′) | Strand | PCR Product Size | Reference |
---|---|---|---|---|
ORF3-1 | TCCTAGACTTCAACCTTACG | Sense | 830 | [46] |
ORF3-2 | GGTGACAAGTGAAGCACAGA | Antisense | ||
SF1 | TCATCCATTAGTGATGTTGT | Sense | 1754 | [47] |
SR1_VN | AAATTGTCTAGTGTCAAC | Antisense | This study | |
SF2_VN | CCATTCAGCGTATTCTTTATTG | Sense | 1693 | This study |
SR2_VN | ATAGCCTCTTTAACACTCTC | Antisense | ||
SF3_VN | GATGAAGACTATAAGCGCTG | Sense | 1518 | This study |
SR3_VN | GCTCCAACTCTTGGACAGC | Antisense |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vu, T.T.H.; Yeom, M.; Moon, H.; Tran, T.N.; Le, V.P.; Song, D. Characteristics and Pathogenicity of the Cell-Adapted Attenuated Porcine Epidemic Diarrhea Virus of the Non-S INDEL Cluster. Pathogens 2021, 10, 1479. https://doi.org/10.3390/pathogens10111479
Vu TTH, Yeom M, Moon H, Tran TN, Le VP, Song D. Characteristics and Pathogenicity of the Cell-Adapted Attenuated Porcine Epidemic Diarrhea Virus of the Non-S INDEL Cluster. Pathogens. 2021; 10(11):1479. https://doi.org/10.3390/pathogens10111479
Chicago/Turabian StyleVu, Thi Thu Hang, Minjoo Yeom, Hyoungjoon Moon, Thi Nhan Tran, Van Phan Le, and Daesub Song. 2021. "Characteristics and Pathogenicity of the Cell-Adapted Attenuated Porcine Epidemic Diarrhea Virus of the Non-S INDEL Cluster" Pathogens 10, no. 11: 1479. https://doi.org/10.3390/pathogens10111479
APA StyleVu, T. T. H., Yeom, M., Moon, H., Tran, T. N., Le, V. P., & Song, D. (2021). Characteristics and Pathogenicity of the Cell-Adapted Attenuated Porcine Epidemic Diarrhea Virus of the Non-S INDEL Cluster. Pathogens, 10(11), 1479. https://doi.org/10.3390/pathogens10111479