Next Article in Journal
Seroepidemiological Study of Spotted Fever Group Rickettsiae and Identification of a Putative New Species, Rickesttsia sp. Da-1, in Gongliao, Northeast Taiwan
Next Article in Special Issue
Overexpression of Plasmodium falciparum M1 Aminopeptidase Promotes an Increase in Intracellular Proteolysis and Modifies the Asexual Erythrocytic Cycle Development
Previous Article in Journal
A Comparison of Peripheral Blood Smears, Autologous Cell Cultures, and Reverse Line Blot Hybridisation in Screening for Anaplasma/Ehrlichia in Roaming Dogs and Symptomatic Dogs in Trinidad
Previous Article in Special Issue
Association between Cognitive Function and Depression with Human T-Cell Lymphotropic Virus 1 Seropositivity and Serointensity in UK Adults
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 10
Issue 11
10.3390/pathogens10111432
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evidence of a Recent Bottleneck in Plasmodium falciparum Populations on the Honduran–Nicaraguan Border

by
Alejandra Pinto
1,
Osman Archaga
1,
Ángel Mejía
1,
Lenin Escober
2,
Jessica Henríquez
2,
Alberto Montoya
3,
Hugo O. Valdivia
4 and
Gustavo Fontecha
1,*
1
Microbiology Research Institute, National Autonomous University of Honduras, Tegucigalpa 11101, Honduras
2
National Malaria Laboratory, National Department of Surveillance, Ministry of Health of Honduras, Tegucigalpa 11101, Honduras
3
National Center for Diagnosis and Reference, Health Ministry, Managua 11001, Nicaragua
4
Department of Parasitology, U.S. Naval Medical Research Unit No, 6 (NAMRU-6), Lima 07006, Peru
*
Author to whom correspondence should be addressed.
Pathogens 2021, 10(11), 1432; https://doi.org/10.3390/pathogens10111432
Submission received: 13 September 2021 / Revised: 25 October 2021 / Accepted: 1 November 2021 / Published: 4 November 2021
(This article belongs to the Special Issue Advances in Human Pathogens Infections)
Browse Figures
Review Reports Versions Notes

Abstract

:
The countries of Central America and the island of Hispaniola have set the goal of eliminating malaria in less than a decade. Although efforts to reduce the malaria burden in the region have been successful, there has been an alarming increase in cases in the Nicaraguan Moskitia since 2014. The continuous decrease in cases between 2000 and 2014, followed by a rapid expansion from 2015 to the present, has generated a potential bottleneck effect in the populations of Plasmodium spp. Consequently, this study aimed to evaluate the genetic diversity of P. falciparum and the decrease in allelic richness in this population. The polymorphic regions of the pfmsp-1 and pfmsp-2 genes of patients with falciparum malaria from Honduras and Nicaragua were analyzed using nested PCR and sequencing. Most of the samples were classified into the K1 allelic subfamily of the pfmsp-1 gene and into the 3D7 subfamily of the pfmsp-2 gene. Despite the low genetic diversity found, more than half of the samples presented a polyclonal K1/RO33 haplotype. No sequence polymorphisms were found within each allelic subfamily. This study describes a notable decrease in the genetic diversity of P. falciparum in the Moskitia region after a bottleneck phenomenon. These results will be useful for future epidemiological investigations and the monitoring of malaria transmission in Central America.

1. Introduction

The incidence of malaria in the Americas has decreased by 53% in the last decade, reaching 0.9 million cases in 2019 [1]. However, progress in malaria elimination is not homogeneous for all countries. In this regard, 86% of malaria cases on the continent are reported by three countries: Brazil, Colombia and Venezuela, and the latter country reported almost half a million cases in 2019, representing a 13-fold increase since 2000 [1]. Although the Central American isthmus is responsible for only 2.4% of cases in the Americas, there are also notable differences in the epidemiology of malaria among the seven Central American countries. For example, Costa Rica, Panama and Nicaragua reported increases in case incidence of more than 40% in 2020 compared to 2015, while Belize, Guatemala and Honduras have met the goals set for 2020 by the Global Technical Strategy 2016–2030 to reduce incidence by at least 40% [2]. On the other hand, Belize and El Salvador have reported zero cases of malaria during the last years [1].
Currently the Central American region most affected by malaria is the Moskitia, which comprises the easternmost region of Honduras and the northwestern region of Nicaragua. The Moskitia is a region shared by both countries with little human development, scarce communication routes and predominantly indigenous populations with their own cultural characteristics and little access to health services. The incidence of malaria in Honduras and Nicaragua reached its lowest point in 2014 with around 1163 cases, and the downward trend has remained relatively constant in Honduras [1]. However, the number of malaria cases in Nicaragua exceeded 25,000 in 2020, returning to the figures reported in 2000 (Figure 1) [1]. Another unprecedented phenomenon in the region is the change in the proportion of Plasmodium falciparum malaria cases, which in Moskitia had never exceeded 20%, while now exceeds 50% on the Nicaraguan side. These changes in malaria transmission patterns and a recent bottleneck phenomenon are very likely to influence parasite populations and their genetic diversity.
The genetic diversity of Plasmodium spp. has been related to the ability of parasites to adapt adequately to their hosts through the selection of advantageous traits, such as antigenic variability that allows them to evade the immune response, as well as the emergence of mutations responsible for resistance to antimalarials [3,4,5,6,7]. Genetically diverse populations of Plasmodium are common in regions with high transmission patterns, such as sub-Saharan Africa and some Southeast Asian countries [8,9,10,11,12], but as the incidence of malaria declines, the parasite’s genetic diversity is expected to decline as well [13,14]. Central America is considered a region of moderate to low malaria transmission, and studies on the genetic diversity of Plasmodium spp. in Central America are scarce. Most studies have analyzed polymorphic coding genes (P. falciparum glutamate rich protein pfglurp, merozoite surface proteins pfmsp-1 and pfmsp-2, P. vivax apical membrane antigen pvama-1, merozoite surface proteins pvmsp-1, pvmsp-142, circumsporozoite protein pvcsp, and the surface protein pvs48/45) to assess the diversity of P. falciparum and/or P. vivax in some countries of the isthmus [14,15,16,17,18,19], whereas other studies have used microsatellite markers [20,21] or next generation sequencing using a selectively amplified whole genome approach (sWGA) [22]. Despite differences in the methods, most of these studies conclude that the parasite populations in Central America present a low diversity in relation to parasites of Sub-Saharan Africa [23]. This is much less clear in the Americas, where some of the regions with high incidence of malaria are still within the low to medium transmission levels and accordingly show low diversity of the parasite populations [24].
Some of the most widely used markers are two genes that encode the merozoite surface proteins of P. falciparum (pfmsp-1 and pfmsp-2) [17,25,26,27,28,29]. These markers are very informative due to their high rate of size and sequence polymorphisms, due in part to their tendency to recombine during the sexual phase of the cycle [30,31]. Furthermore, both markers make it possible to detect polyclonal infections. The pfmsp-1 gene is located on chromosome 9 and is made up of 17 sequence blocks, of which block 2 is particularly polymorphic [32]. This gene segment allows the parasite to be classified into three allelic subfamilies: K1, MAD20 and RO33, and to detect alleles according to the size of the amplified fragments. The pfmsp-2 gene is located on chromosome 2. It is composed of five sequence blocks, of which the most polymorphic is the third block, allowing the parasites to be classified into two allelic subfamilies: FC27 and 3D7 [27,29,33,34]. This study aimed to analyze the changes in the genetic diversity of P. falciparum population circulating in the Moskitia after a recent bottleneck phenomenon.

2. Results

A total of 160 blood samples were collected between 2018 and 2021 with a microscopic diagnosis of P. falciparum malaria confirmed by PCR. Block 2 of the pfmsp-1 gene was amplified, and 147 (92%) samples were positive for at least one of the three allelic subfamilies. The cause of the lack of amplification of the remaining 13 samples is unknown. The overall frequency of K1, MAD20 and RO33 subfamilies was 84.4%, 23.8% and 61.2% respectively. Block 3 of the pfmsp-2 gene was also analyzed, and 55 (34%) samples amplified for at least one of the subfamilies 3D7 or FC27. The 3D7 allelic subfamily was present in 92.7% of the samples, while the FC27 subfamily was detected in the remaining 7.3% (Table 1) (Supplementary Table S1).
The alleles of each subfamily were classified according to their approximate size in base pairs on a 2% agarose gel. A single allele was found for the subfamilies K1 (235 bp), RO33 (335 bp), 3D7 (276 bp) and FC27 (327 bp). Three alleles were found for MAD20 (146 bp, 183 bp, and 202 bp) (Figure 2).
The minority of samples showed monoclonal infections with a single allele. Thirty-three (22.5%) samples amplified only K1, 16 (10.9%) samples amplified only MAD20 and three (2.04%) samples amplified only RO33. The number of samples with polyclonal infections, that is, that showed two or more alleles, was 96 (65.3%) for the pfmsp-1 gene. In contrast, no polyclonal infections were detected for pfmsp-2. The different combinations of alleles of pfmsp-1 are shown in Table 2. No intrafamily mixed infections were detected. Regarding the interfamily mixed infections, the most frequent combination of alleles was K1 and RO33 (52.4%). Five samples (3.4%) revealed the simultaneous presence of alleles for the three subfamilies of pfmsp-1 (Figure 3).
As shown in Figure 4 and Table 2, the relative distribution of alleles in the samples collected in Honduras and Nicaragua are not statistically significant. According to Pearson’s Chi square test, the p-values were 0.2296 for K1, 0.9542 for MAD20, and 0.4960 for RO33. Consequently, the parasites in the Moskitia region appear to behave as a homogeneous population.
To confirm the correct identity of the amplicons and detect sequence polymorphisms within each of the subfamilies, 21 amplicons from K1, 16 from MAD20, 10 from RO33, four from 3D7 and one from FC27 were successfully sequenced and assembled. According to the results retrieved by the NCBI BLAST, all the amplified sequences corresponded to the pfmsp-1 and pfmsp-2 genes. The sequences obtained in this study were deposited in Genbank with the accession numbers MZ723284–MZ723293 for K1, MZ723294–MZ723308 for MAD20, MZ723309–MZ723313 for RO33, MZ747207 for 3D7, and MZ747208 for FC27.
No polymorphisms were detected between the sequences within each marker, as can be seen in the chromatogram alignment of Figure 5. Consequently, a single allele of K1, RO33, 3D7 and FC27 was found. The only polymorphisms detected were among the three alleles of the MAD20 subfamily. The nucleotide sequences of the five markers (K1, MAD20, RO33, 3D7 and FC27) were translated in silico, and the amino acid sequences were determined. Figure 6 shows the tripeptide repeat sequences of K1, MAD20, RO33, and 3D7, as well as the amino acid sequence of FC27. These sequences were analyzed by the Protein Blast tool and the results indicated identity percentages of 93.2% for RO33 and 100% for K1, MAD20 and 3D7, with respect to sequences previously deposited in the database of isolates of various geographic regions.

3. Discussion

The genetic diversity of P. falciparum populations is directly proportional to the intensity of malaria transmission in a geographic region [8]. High genetic diversity of the parasite is characteristic of areas of highest malaria transmission while diversity is expected to be minimal in low transmission settings. For example, a recent study conducted in Northeast India using merozoite surface protein 1 and 2 (pfmsp-1, pfmsp-2) and glutamate rich protein (pfglurp) revealed extensive parasite diversity in a state that contributes almost half of malaria cases to the region [28]. An earlier study demonstrated dramatic variation in geographic diversity and differentiation in different regions using microsatellite analysis. The mean heterozygosities in South American countries were less than half of those observed in Africa, with intermediate heterozygosities in the Asia/Pacific region [35].
Central America is considered a low transmission scenario, and although there are active foci in Panama, Costa Rica and Guatemala, the Moskitia region, shared between Honduras and Nicaragua, is responsible for the largest number of malaria cases in the Central American isthmus [1]. The number of malaria cases in the Moskitia had been declining continuously from 2000 to 2009, the year in which Nicaragua reported only 640 cases, representing a reduction of more than 97% since 2000. Even though the reduction of cases in Honduras has remained relatively constant to date, malaria in the Nicaraguan Moskitia has exceeded 25,427 cases in 2020, delaying two decades of progress in the fight against malaria.
Another important change in the epidemiology of malaria in the Moskitia is the increase in the proportion of cases caused by P. falciparum. Historically, the largest contributor to malaria cases was P. vivax, and falciparum malaria did not exceed 20%; however, now it contributes more than 28% of malaria cases in Honduras and more than 50% in Nicaragua. This change in the transmission pattern added to the possible bottleneck effect experienced by the populations of the parasite in the last decade makes it necessary to study the effects on the genetic diversity of the parasite.
In this study, the allele frequencies of the pfmsp-1 and pfmsp-2 genes were assessed. Both genes encode antigens with highly polymorphic regions that have been used extensively to study the epidemiology of malaria [27,28,36]. The most frequent allelic subfamily of pfmsp-1 was K1 (84.4%) followed by RO33 (61.2%) and MAD20 (23.8%). An earlier study using 30 samples collected from six municipalities in Honduras (two in the Moskitia region) between 2010 and 2011 found that K1 was the most prevalent subfamily (57%), followed by MAD20 (25%) and RO33 (17%) [17]. The authors reported that most alleles were evenly represented, and no differences were found between the Miskito region and the rest of the country. The study by López et al. included a broader geographic region of the country compared to other studies from the same period and despite having analyzed only 30 isolates of P. falciparum, it is the only one that reports high genetic diversity in the parasite population in Honduras [17]. Another previous study analyzed 56 samples collected between 1995 and 1996 in one municipality in Honduras (Tocoa, Colón) and found that the most frequent allelic subfamily was MAD20 (73.2%) followed by K1 (46.4%). RO33 was not described on that occasion [15]. These discrepancies can be attributed to the population dynamics of the parasite over time, or to the difference in the geographic areas where the samples were collected.
Based on extensive global data collection by Lê et al. [29], subfamilies K1 and MAD20 are the dominant types worldwide. In two Latin American countries (Peru and Brazil), K1 shows a slight predominance over MAD20, while the frequency of RO33 is only marginal. Similarly, a study carried out with samples from Colombia reports an almost absolute predominance of MAD20 and did not report the presence of RO33 [37]. It should be noted then that the frequency of RO33 in Central America has increased compared to previous reports, resembling the results of similar studies carried out in Africa and Asia [29,38].
Regarding the pfmsp-2 gene, our results reveal a clear predominance of the 3D7 subfamily (92.7%) over FC27 (7.3%). This result coincides with what was reported 10 years earlier in Honduras by López et al. [17] with 91.7% predominance of 3D7 in 12 samples analyzed. Studies of the genetic diversity of the pfmsp-2 gene in the Americas are scarce. Two studies conducted in Colombia and Brazil reported that both FC27 and 3D7 allelic subfamilies were found in almost the same proportions [37,39]. On the other hand, the study by Haddad et al. [15] carried out with samples from one municipality in Honduras, reported a clear predominance of FC27 over 3D7.
The most surprising result of the present study is the low genetic diversity found in the parasite population. All 124 samples that amplified the K1 subfamily showed a single allele of approximately 235 bp that was confirmed by sequencing. The same happened with the RO33 subfamily, with a single allele of approximately 335 bp. Only the MAD20 subfamily revealed the presence of three alleles with size polymorphism. No sequence polymorphisms were found within each allele. The only similar study conducted with 35 samples from Honduras and collected a decade ago described a total of 23 alleles (13 K1 alleles, 5 MAD20 alleles, and 5 RO33 alleles) [17]. This inconsistency reflects a bottleneck effect in the parasite populations suffered by the notable decrease in the number of cases in the region. This bottleneck led to decreased allelic richness, the near fixation of a few alleles and missing pre-existing alleles.
Despite the homogeneity in the population demonstrated in this study, 96/147 (65.3%) samples showed a polyclonal infection with at least two alleles of pfmsp-1, especially K1/RO33. This proportion is higher than previously reported in Honduras, where 23% of mixed samples are described [17]. Mixed infections were not detected for the pfmsp-2 gene. If we consider the recent bottleneck, the homogeneity of the mixed genotypes and the low transmission that continues to prevail in the region, it is very likely that these mixed genotypes are propagated by a single multiple inoculation event rather than by superinfection [40]. This hypothesis is consistent with the results obtained by Valdivia et al. [22] when analyzing 20 samples collected between 2008 and 2010 from Honduras, demonstrating exclusively monoclonal infections and low intrapopulation diversity using a genome sequencing approach.
Finally, the allele frequencies of the parasite populations of Honduras were compared with those of Nicaragua. Statistical analysis showed that there were no significant differences between the two populations. Our results are consistent with the results of a previous study conducted with 110 samples collected in the Moskitia (Honduras and Nicaragua) between 2009 and 2012 that evaluated seven neutral microsatellite markers [21]. Those authors determined that there was low genetic diversity in the population, similar allelic richness in both countries, and no significant differences in the number of alleles per locus between the two countries. Therefore, it was proposed that there was a relatively free gene flow across the region. Both results confirm that despite the political border between both countries, the parasites that circulate in the Moskitia region are not geographically separated, and that adverse genetic events such as the emergence of resistance to antimalarials would affect malaria control on both sides of the border.

4. Materials and Methods

4.1. Sample Collection

This study included 160 blood samples from febrile patients diagnosed with falciparum malaria and who sought medical assistance in national health establishments in two municipalities of Honduras and five municipalities of Nicaragua belonging to the ecological and cultural region called the Moskitia (Figure 7). All samples from Honduras were collected in the department of Gracias a Dios, and those from Nicaragua were collected in the North Atlantic Region (RAAN). This study was limited to studying cases of falciparum malaria and not the cases of vivax malaria because the Health Ministries of Honduras and Nicaragua routinely collect on filter paper only blood samples diagnosed with P. falciparum. The samples were collected between 2018 and 2021.
Blood samples were collected by fingerstick on Whatman FTA filter paper at the time of patient recruitment. The ethics committee (CEI-MEIZ) of the National Autonomous University of Honduras (UNAH) reviewed and approved the study under protocol number 03-2020. Consent to participate was waived for the following reasons: (a) No personal information was included; (b) the study was beneficial to public health and, (c) did not harm the participants. Blood samples were collected for parasite species identification and analysis of genes associated with drug resistance, in accordance with national regulations and for routine malaria surveillance purposes.

4.2. DNA Extraction and Molecular Identification of the Parasite

DNA was extracted from blood on filter paper cards using a Chelex-100 based method (Bio-Rad Laboratories, Inc., Hercules, CA, USA) [41]. Microscopic diagnosis of the parasite species was confirmed by amplification of the 18S rRNA gene [42].

4.3. Amplification of pfmsp-1 and pfmsp-2

The pfmsp-1 gene was amplified by nested PCR as described previously [17,43]. In the first PCR, a region of more than 1 kb of the second variable region of the gene was amplified and three independent nested amplifications were carried out to detect the allelic subfamilies K1, RO33 and MAD20 (Figure 8). Primary reactions were carried out in a 50 μL volume containing 25 μL of GoTaq® 2X Master Mix (Promega corp., Madison, WI, USA), 2 μL of each primer (Table 3) at a concentration of 10 μM, 10 μL of DNA and 11 μL of nuclease-free water. Thermal cycler conditions were 1 cycle of 94 °C for 2 min; 30 cycles at 94 °C for 30 s, 54 °C for 1 min and 72 °C for 1 min; and a final extension step at 72 °C for 5 min. Two µL of the first PCR amplicons were used in three independent reactions in a 50 µL volume each containing 25 µL of Taq Master Mix, 2 µL of each primer (10 µM) and 19 µL of nuclease-free water. The cycling conditions in the thermal cycler for the three reactions were: 1 cycle of 94 °C for 5 min; 35 cycles at 94 °C for 30 s, annealing for 1 min and 72 °C for 1 min; and 1 final extension cycle at 72 °C for 10 min.
The pfmsp-2 gene was amplified by semi-nested PCR [17,44]. The first reaction was carried out in a 50 µL reaction volume containing 25 µL of Taq Master Mix, 2 µL of each primer (10 µM) (Table 3), 16 µL of nuclease-free water and 5 µL of DNA. The cycle conditions were: 1 denaturing step at 95 °C for 5 min; 30 cycles at 94 °C for 1 min, 60 °C for 2 min and 72 °C for 2 min; a final extension step at 72 °C and 10 min. The two allelic subfamilies 3D7 and FC27 were detected in independent secondary reactions in a final volume of 50 μL, with 25 μL of Taq Master Mix, 2 μL of each primer (10 μM), 20 μL of nuclease-free water and 1 μL DNA from the first reaction. The same cycling program was used for both reactions: 1 cycle at 94 °C for 2 min; 30 cycles at 94 °C for 30 s, 50 °C for 45 s, 70 °C for 2 min; and a final extension at 70 °C for 10 min. Amplification products were analysed by electrophoresis on a 2% agarose gel stained with ethidium bromide.
The overall allele frequency was calculated for each marker and the allele frequency in each of the two countries, Honduras, and Nicaragua. Pearson’s chi-square test was used to evaluate the percentages of positivity for each genotype per country to determine significant differences. A representative sample of each allele was selected according to the size of the product on the agarose gel for subsequent sequencing. Sequencing of amplicons was carried out directly from purified PCR products on both strands with their respective inner primers following standard Sanger sequencing protocols at Psomagen facilities (Psomagen, Inc., Rockville, MA, USA).
Sequences were trimmed at both 5′ and 3′ ends with the Geneious® 9.1.7 software (Biomatters, Auckland, New Zealand) and queried against international databases contained in NCBI to confirm the identity of the sequences. Subsequently, the sequences were analyzed for sequence and/or size polymorphisms. The sequences obtained were deposited in the NCBI database. The nucleotide sequences were translated in silico in the correct open reading frame to obtain the amino acid sequences of K1, MAD20, RO33, 3D7 and FC27. The peptide sequences were analyzed with the NCBI Protein Blast tool.

5. Conclusions

This study describes a bottleneck effect suffered by Plasmodium falciparum populations in the Moskitia region of Central America. The drastic decrease in the number of malaria cases reported in the region in recent years could have been responsible for a notable decrease in the genetic diversity of the parasite, generating highly homogeneous populations as revealed by the analysis of the pfmsp-1 and pfmsp-2 genes. These results will be useful for future epidemiological investigations and the monitoring of malaria transmission in Central America.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/pathogens10111432/s1, Table S1: Database showing total genotyping results for pfmsp-1 and pfmsp-2.

Author Contributions

Conceptualization, G.F.; methodology, G.F., A.P., O.A., Á.M., A.M., L.E. and J.H.; validation, G.F., and H.O.V.; formal analysis, G.F.; investigation, G.F., A.P., O.A., L.E., and J.H.; resources, G.F. and H.O.V.; data curation, G.F., A.P., L.E. Á.M. and O.A.; writing—original draft preparation, G.F.; writing—review and editing, G.F., A.P., O.A., L.E., J.H. and H.O.V.; supervision, G.F.; project administration, G.F., A.P.; funding acquisition, G.F., and H.O.V. All authors have read and agreed to the published version of the manuscript.

Funding

Funding for this study was provided by the Genetic Research Center, CIG-UNAH, and by the Armed Forces Health Surveillance Division (AFHSD) and its Global Emerging Infections Surveillance and Response (GEIS) Section (P0144_20_N6_01, 2020-2021).

Institutional Review Board Statement

The ethics committee (CEI-MEIZ) of the National Autonomous University of Honduras (UNAH) reviewed and approved the study under protocol number 03-2020.

Informed Consent Statement

Consent to participate was waived for the following reasons: No personal information was included. The study was beneficial to public health and does not harm the participants. Blood filter paper samples were collected for parasite species identification and analysis of genes associated with drug resistance, in accordance with national regulations and for routine malaria surveillance purposes.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors wish to thank all the health personnel who care for the population with malaria in the endemic areas of Honduras and Nicaragua. To all those who contributed in any way with the collection of samples, the microscopic diagnosis, and the treatment of the patients.

Conflicts of Interest

The authors declare no conflict of interest.

Disclaimer

The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, nor the U.S. Government.

Copyright Statement

Some authors of this manuscript are military service members and employees of the U.S. Government. This work was prepared as part of their official duties. Title 17 U.S.C. §105 provides that “Copyright protection under this Title is not available for any work of the United States Government”. Title 17 U.S.C. §101 defines a U.S. Government work as a work prepared by a military service member or employee of the U.S. Government as part of that person’s official duties.

References

  1. World Health Organization. World Malaria Report 2020: 20 Years of Global Progress and Challenges; Licence: CC BY-NC-SA 3.0 IGO; WHO: Geneva, Switzerland, 2020. [Google Scholar]
  2. World Health Organization. Global Technical Strategy for Malaria 2016–2030; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
  3. Amenga-Etego, L.N.; Asoala, V.; Agongo, G.; Jacob, C.; Goncalves, S.; Awandare, G.A.; Rockett, K.A.; Kwiatkowski, D. Temporal evolution of sulfadoxine-pyrimethamine resistance genotypes and genetic diversity in response to a decade of increased interventions against Plasmodium falciparum in northern Ghana. Malar. J. 2021, 20, 152. [Google Scholar] [CrossRef] [PubMed]
  4. Da Veiga Leal, S.; Ward, D.; Campino, S.; Benavente, E.D.; Ibrahim, A.; Claret, T.; Isaias, V.; Monteiro, D.; Clark, T.G.; Goncalves, L.; et al. Drug resistance profile and clonality of Plasmodium falciparum parasites in Cape Verde: The 2017 malaria outbreak. Malar. J. 2021, 20, 172. [Google Scholar] [CrossRef] [PubMed]
  5. Ghansah, A.; Amenga-Etego, L.; Amambua-Ngwa, A.; Andagalu, B.; Apinjoh, T.; Bouyou-Akotet, M.; Cornelius, V.; Golassa, L.; Andrianaranjaka, V.H.; Ishengoma, D.; et al. Monitoring parasite diversity for malaria elimination in sub-Saharan Africa. Science 2014, 345, 1297–1298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Montenegro, L.M.; de Las Salas, B.; Neal, A.T.; Tobon-Castano, A.; Fairhurst, R.M.; Lopera-Mesa, T.M. State of Artemisinin and Partner Drug Susceptibility in Plasmodium falciparum Clinical Isolates from Colombia. Am. J. Trop. Med. Hyg. 2021, 104, 263–270. [Google Scholar] [CrossRef]
  7. Lucchi, N.W.; Abdallah, R.; Louzada, J.; Udhayakumar, V.; Oliveira-Ferreira, J. Molecular Surveillance for Polymorphisms Associated with Artemisinin-Based Combination Therapy Resistance in Plasmodium falciparum Isolates Collected in the State of Roraima, Brazil. Am. J. Trop. Med. Hyg. 2020, 102, 310–312. [Google Scholar] [CrossRef]
  8. Babiker, H.A.; Lines, J.; Hill, W.G.; Walliker, D. Population structure of Plasmodium falciparum in villages with different malaria endemicity in east Africa. Am. J. Trop. Med. Hyg. 1997, 56, 141–147. [Google Scholar] [CrossRef]
  9. Atroosh, W.M.; Al-Mekhlafi, H.M.; Mahdy, M.A.; Saif-Ali, R.; Al-Mekhlafi, A.M.; Surin, J. Genetic diversity of Plasmodium falciparum isolates from Pahang, Malaysia based on MSP-1 and MSP-2 genes. Parasit. Vectors 2011, 4, 233. [Google Scholar] [CrossRef] [Green Version]
  10. Ralinoro, F.; Rakotomanga, T.A.; Rakotosaona, R.; Doll Rakoto, D.A.; Menard, D.; Jeannoda, V.; Ratsimbasoa, A. Genetic diversity of Plasmodium falciparum populations in three malaria transmission settings in Madagascar. Malar. J. 2021, 20, 239. [Google Scholar] [CrossRef]
  11. Gwarinda, H.B.; Tessema, S.K.; Raman, J.; Greenhouse, B.; Birkholtz, L.M. Parasite genetic diversity reflects continued residual malaria transmission in Vhembe District, a hotspot in the Limpopo Province of South Africa. Malar. J. 2021, 20, 96. [Google Scholar] [CrossRef]
  12. Bosco, A.B.; Anderson, K.; Gresty, K.; Prosser, C.; Smith, D.; Nankabirwa, J.I.; Nsobya, S.; Yeka, A.; Namubiru, R.; Arinaitwe, E.; et al. Genetic diversity and genetic relatedness in Plasmodium falciparum parasite population in individuals with uncomplicated malaria based on microsatellite typing in Eastern and Western regions of Uganda, 2019–2020. Malar. J. 2021, 20, 242. [Google Scholar] [CrossRef]
  13. Mohammed, H.; Assefa, A.; Chernet, M.; Wuletaw, Y.; Commons, R.J. Genetic polymorphisms of Plasmodium falciparum isolates from Melka-Werer, North East Ethiopia based on the merozoite surface protein-2 (msp-2) gene as a molecular marker. Malar. J. 2021, 20, 85. [Google Scholar] [CrossRef]
  14. Santamaria, A.M.; Vasquez, V.; Rigg, C.; Moreno, D.; Romero, L.; Justo, C.; Chaves, L.F.; Saldana, A.; Calzada, J.E. Plasmodium falciparum genetic diversity in Panama based on glurp, msp-1 and msp-2 genes: Implications for malaria elimination in Mesoamerica. Life 2020, 10, 319. [Google Scholar] [CrossRef]
  15. Haddad, D.; Snounou, G.; Mattei, D.; Enamorado, I.G.; Figueroa, J.; Stahl, S.; Berzins, K. Limited genetic diversity of Plasmodium falciparum in field isolates from Honduras. Am. J. Trop. Med. Hyg. 1999, 60, 30–34. [Google Scholar] [CrossRef] [PubMed]
  16. Samudio, F.; Santamaria, A.M.; Obaldia, N., III; Pascale, J.M.; Bayard, V.; Calzada, J.E. Prevalence of Plasmodium falciparum mutations associated with antimalarial drug resistance during an epidemic in Kuna Yala, Panama, Central America. Am. J. Trop. Med. Hyg. 2005, 73, 839–841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Lopez, A.C.; Ortiz, A.; Coello, J.; Sosa-Ochoa, W.; Torres, R.E.; Banegas, E.I.; Jovel, I.; Fontecha, G.A. Genetic diversity of Plasmodium vivax and Plasmodium falciparum in Honduras. Malar. J. 2012, 11, 391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Gutierrez, S.; Gonzalez-Ceron, L.; Montoya, A.; Sandoval, M.A.; Torres, M.E.; Cerritos, R. Genetic structure of Plasmodium vivax in Nicaragua, a country in the control phase, based on the carboxyl terminal region of the merozoite surface protein-1. Infect. Genet. Evol. 2016, 40, 324–330. [Google Scholar] [CrossRef] [PubMed]
  19. Vallejo, A.F.; Martinez, N.L.; Tobon, A.; Alger, J.; Lacerda, M.V.; Kajava, A.V.; Arevalo-Herrera, M.; Herrera, S. Global genetic diversity of the Plasmodium vivax transmission-blocking vaccine candidate Pvs48/45. Malar. J. 2016, 15, 202. [Google Scholar] [CrossRef] [Green Version]
  20. Prajapati, S.K.; Joshi, H.; Shalini, S.; Patarroyo, M.A.; Suwanarusk, R.; Kumar, A.; Sharma, S.K.; Eapen, A.; Dev, V.; Bhatt, R.M.; et al. Plasmodium vivax lineages: Geographical distribution, tandem repeat polymorphism, and phylogenetic relationship. Malar. J. 2011, 10, 374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Larranaga, N.; Mejia, R.E.; Hormaza, J.I.; Montoya, A.; Soto, A.; Fontecha, G.A. Genetic structure of Plasmodium falciparum populations across the Honduras-Nicaragua border. Malar. J. 2013, 12, 354. [Google Scholar] [CrossRef] [Green Version]
  22. Valdivia, H.O.; Villena, F.E.; Lizewski, S.E.; Garcia, J.; Alger, J.; Bishop, D.K. Genomic surveillance of Plasmodium falciparum and Plasmodium vivax cases at the University Hospital in Tegucigalpa, Honduras. Sci. Rep. 2020, 10, 20975. [Google Scholar] [CrossRef] [PubMed]
  23. Ajogbasile, F.V.; Kayode, A.T.; Oluniyi, P.E.; Akano, K.O.; Uwanibe, J.N.; Adegboyega, B.B.; Philip, C.; John, O.G.; Eromon, P.J.; Emechebe, G.; et al. Genetic diversity and population structure of Plasmodium falciparum in Nigeria: Insights from microsatellite loci analysis. Malar. J. 2021, 20, 236. [Google Scholar] [CrossRef]
  24. Knudson, A.; Gonzalez-Casabianca, F.; Feged-Rivadeneira, A.; Pedreros, M.F.; Aponte, S.; Olaya, A.; Castillo, C.F.; Mancilla, E.; Piamba-Dorado, A.; Sanchez-Pedraza, R.; et al. Spatio-temporal dynamics of Plasmodium falciparum transmission within a spatial unit on the Colombian Pacific Coast. Sci. Rep. 2020, 10, 3756. [Google Scholar] [CrossRef] [PubMed]
  25. Vo, T.C.; Le, H.G.; Kang, J.M.; Naw, H.; Fan, C.K.; Trinh, N.T.M.; Quang, H.H.; Na, B.K. Molecular surveillance of malaria in the Central Highlands, Vietnam. Parasitol. Int. 2021, 83, 102374. [Google Scholar] [CrossRef] [PubMed]
  26. Goh, X.T.; Lim, Y.A.L.; Lee, P.C.; Nissapatorn, V.; Chua, K.H. Diversity and natural selection of merozoite surface protein-1 in three species of human malaria parasites: Contribution from South-East Asian isolates. Mol. Biochem. Parasitol. 2021, 244, 111390. [Google Scholar] [CrossRef] [PubMed]
  27. Metoh, T.N.; Chen, J.H.; Fon-Gah, P.; Zhou, X.; Moyou-Somo, R.; Zhou, X.N. Genetic diversity of Plasmodium falciparum and genetic profile in children affected by uncomplicated malaria in Cameroon. Malar. J. 2020, 19, 115. [Google Scholar] [CrossRef] [Green Version]
  28. Patgiri, S.J.; Sarma, K.; Sarmah, N.; Bhattacharyya, N.; Sarma, D.K.; Nirmolia, T.; Bhattacharyya, D.R.; Mohapatra, P.K.; Bansal, D.; Bharti, P.K.; et al. Characterization of drug resistance and genetic diversity of Plasmodium falciparum parasites from Tripura, Northeast India. Sci. Rep. 2019, 9, 13704. [Google Scholar] [CrossRef]
  29. Le, H.G.; Kang, J.M.; Jun, H.; Lee, J.; Thai, T.L.; Myint, M.K.; Aye, K.S.; Sohn, W.M.; Shin, H.J.; Kim, T.S.; et al. Changing pattern of the genetic diversities of Plasmodium falciparum merozoite surface protein-1 and merozoite surface protein-2 in Myanmar isolates. Malar. J. 2019, 18, 241. [Google Scholar] [CrossRef]
  30. Ghoshal, S.; Gajendra, P.; Kanjilal, S.D.; Mitra, M.; Sengupta, S. Diversity analysis of MSP1 identifies conserved epitope organization in block 2 amidst high sequence variability in Indian Plasmodium falciparum isolates. Malar. J. 2018, 17, 447. [Google Scholar] [CrossRef]
  31. Miller, L.H.; Roberts, T.; Shahabuddin, M.; McCutchan, T.F. Analysis of sequence diversity in the Plasmodium falciparum merozoite surface protein-1 (MSP-1). Mol. Biochem. Parasitol. 1993, 59, 1–14. [Google Scholar] [CrossRef]
  32. Ferreira, M.U.; Liu, Q.; Zhou, M.; Kimura, M.; Kaneko, O.; Van Thien, H.; Isomura, S.; Tanabe, K.; Kawamoto, F. Stable patterns of allelic diversity at the Merozoite surface protein-1 locus of Plasmodium falciparum in clinical isolates from southern Vietnam. J. Eukaryot. Microbiol. 1998, 45, 131–136. [Google Scholar] [CrossRef]
  33. Ngomo, J.M.N.; M’Bondoukwe, N.P.; Yavo, W.; Mavoungou, L.C.B.; Bouyou-Akotet, M.K.; Mawili-Mboumba, D.P. Spatial and temporal distribution of Pfmsp1 and Pfmsp2 alleles and genetic profile change of Plasmodium falciparum populations in Gabon. Acta Trop. 2018, 178, 27–33. [Google Scholar] [CrossRef]
  34. Khatoon, L.; Jan, M.I.; Khan, I.U.; Ullah, F.; Malik, S.A. Genetic diversity in human malarial parasites of Khyber Agency Pakistan. Acta Parasitol. 2013, 58, 564–569. [Google Scholar] [CrossRef] [Green Version]
  35. Anderson, T.J.; Haubold, B.; Williams, J.T.; Estrada-Franco, J.G.; Richardson, L.; Mollinedo, R.; Bockarie, M.; Mokili, J.; Mharakurwa, S.; French, N.; et al. Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol. Biol. Evol. 2000, 17, 1467–1482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Ndiaye, T.; Sy, M.; Gaye, A.; Siddle, K.J.; Park, D.J.; Bei, A.K.; Deme, A.B.; Mbaye, A.; Dieye, B.; Ndiaye, Y.D.; et al. Molecular epidemiology of Plasmodium falciparum by multiplexed amplicon deep sequencing in Senegal. Malar. J. 2020, 19, 403. [Google Scholar] [CrossRef] [PubMed]
  37. Jimenez, J.N.; Snounou, G.; Letourneur, F.; Renia, L.; Velez, I.D.; Muskus, C.E. Near-fixation of a Pfmsp1 block 2 allelic variant in genetically diverse Plasmodium falciparum populations across Western Colombia. Acta Trop. 2010, 114, 67–70. [Google Scholar] [CrossRef] [PubMed]
  38. Al-abd, N.M.; Mahdy, M.A.; Al-Mekhlafi, A.M.; Snounou, G.; Abdul-Majid, N.B.; Al-Mekhlafi, H.M.; Fong, M.Y. The suitability of P. falciparum merozoite surface proteins 1 and 2 as genetic markers for in vivo drug trials in Yemen. PLoS ONE 2013, 8, e67853. [Google Scholar] [CrossRef]
  39. Sallenave-Sales, S.; Ferreira-da-Cruz, M.F.; Faria, C.P.; Cerruti, C., Jr.; Daniel-Ribeiro, C.T.; Zalis, M.G. Plasmodium falciparum: Limited genetic diversity of MSP-2 in isolates circulating in Brazilian endemic areas. Exp. Parasitol. 2003, 103, 127–135. [Google Scholar] [CrossRef]
  40. Sutton, P.L.; Neyra, V.; Hernandez, J.N.; Branch, O.H. Plasmodium falciparum and Plasmodium vivax infections in the Peruvian Amazon: Propagation of complex, multiple allele-type infections without super-infection. Am. J. Trop. Med. Hyg. 2009, 81, 950–960. [Google Scholar] [CrossRef] [Green Version]
  41. de Lamballerie, X.; Zandotti, C.; Vignoli, C.; Bollet, C.; de Micco, P. A one-step microbial DNA extraction method using “Chelex 100” suitable for gene amplification. Res. Microbiol. 1992, 143, 785–790. [Google Scholar] [CrossRef]
  42. Singh, B.; Bobogare, A.; Cox-Singh, J.; Snounou, G.; Abdullah, M.S.; Rahman, H.A. A genus- and species-specific nested polymerase chain reaction malaria detection assay for epidemiologic studies. Am. J. Trop. Med. Hyg. 1999, 60, 687–692. [Google Scholar] [CrossRef]
  43. Schoepflin, S.; Valsangiacomo, F.; Lin, E.; Kiniboro, B.; Mueller, I.; Felger, I. Comparison of Plasmodium falciparum allelic frequency distribution in different endemic settings by high-resolution genotyping. Malar. J. 2009, 8, 250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Mwingira, F.; Nkwengulila, G.; Schoepflin, S.; Sumari, D.; Beck, H.P.; Snounou, G.; Felger, I.; Olliaro, P.; Mugittu, K. Plasmodium falciparum msp1, msp2 and glurp allele frequency and diversity in sub-Saharan Africa. Malar. J. 2011, 10, 79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Pathogens 10 01432 g001 550
Figure 1. Number of malaria cases in Honduras and Nicaragua from 2000 to 2020. Source: Ministries of Health of Honduras and Nicaragua.
Figure 1. Number of malaria cases in Honduras and Nicaragua from 2000 to 2020. Source: Ministries of Health of Honduras and Nicaragua.
Pathogens 10 01432 g001
Pathogens 10 01432 g002 550
Figure 2. Agarose gels showing the amplification bands of the allelic subfamilies of pfmsp-1 and pfmsp-2. (a) K1; (b) RO33; (c) MAD20; (d) FC27; (e) 3D7. The molecular weight marker indicates a range of 100 bp to 1500 bp.
Figure 2. Agarose gels showing the amplification bands of the allelic subfamilies of pfmsp-1 and pfmsp-2. (a) K1; (b) RO33; (c) MAD20; (d) FC27; (e) 3D7. The molecular weight marker indicates a range of 100 bp to 1500 bp.
Pathogens 10 01432 g002
Pathogens 10 01432 g003 550
Figure 3. Venn diagram showing the number of samples that amplified for each allelic subfamily of pfmsp-1.
Figure 3. Venn diagram showing the number of samples that amplified for each allelic subfamily of pfmsp-1.
Pathogens 10 01432 g003
Pathogens 10 01432 g004 550
Figure 4. Proportion of Plasmodium falciparum isolates belonging to each of the allelic subfamilies of pfmsp-1 and pfmsp-2. The result of the chi-square test that compares the distribution of the three families of pfmsp-1 in Honduras and Nicaragua is shown.
Figure 4. Proportion of Plasmodium falciparum isolates belonging to each of the allelic subfamilies of pfmsp-1 and pfmsp-2. The result of the chi-square test that compares the distribution of the three families of pfmsp-1 in Honduras and Nicaragua is shown.
Pathogens 10 01432 g004
Pathogens 10 01432 g005 550
Figure 5. Chromatograms showing partial nucleotide sequence alignments of (a) K1; (b) RO33; (c) three different alleles of MAD20; (d) MAD20 type I; (e) MAD20 type II; (f) MAD20 type III; (g) 3D7; (h) FC27. The solid green bar above each alignment indicates that the aligned sequences do not show any difference between them.
Figure 5. Chromatograms showing partial nucleotide sequence alignments of (a) K1; (b) RO33; (c) three different alleles of MAD20; (d) MAD20 type I; (e) MAD20 type II; (f) MAD20 type III; (g) 3D7; (h) FC27. The solid green bar above each alignment indicates that the aligned sequences do not show any difference between them.
Pathogens 10 01432 g005
Pathogens 10 01432 g006 550
Figure 6. Amino acid sequences of the variable regions of each allelic subfamily of pfmsp-1 and pfmsp-2. Colors indicate different blocks of three amino acids.
Figure 6. Amino acid sequences of the variable regions of each allelic subfamily of pfmsp-1 and pfmsp-2. Colors indicate different blocks of three amino acids.
Pathogens 10 01432 g006
Pathogens 10 01432 g007 550
Figure 7. Map of Honduras and Nicaragua showing the municipalities in which blood samples were collected from patients with falciparum malaria. H1 = Puerto Lempira; H2 = Ramón Villeda Morales; N1 = Waspán; N2 = Puerto Cabezas; N3 = Bonanza; N4 = Rosita; N5 = Siuna, where H stands for Honduras and N for Nicaragua.
Figure 7. Map of Honduras and Nicaragua showing the municipalities in which blood samples were collected from patients with falciparum malaria. H1 = Puerto Lempira; H2 = Ramón Villeda Morales; N1 = Waspán; N2 = Puerto Cabezas; N3 = Bonanza; N4 = Rosita; N5 = Siuna, where H stands for Honduras and N for Nicaragua.
Pathogens 10 01432 g007
Pathogens 10 01432 g008 550
Figure 8. Scheme of pfmsp-1 and pfmsp-2 genes showing the size of the amplicons and hybridization sites of the primers.
Figure 8. Scheme of pfmsp-1 and pfmsp-2 genes showing the size of the amplicons and hybridization sites of the primers.
Pathogens 10 01432 g008
Table
Table 1. Genotypes and allelic frequencies of Plasmodium falciparum according to the subfamilies of pfmsp-1 and pfmsp-2.
Table 1. Genotypes and allelic frequencies of Plasmodium falciparum according to the subfamilies of pfmsp-1 and pfmsp-2.
pfmsp-1 Subfamiliespfmsp-2 Subfamilies
K1 (bp)n (%)MAD20 (bp)n (%)RO33 (bp)n (%)3D7 (bp)n (%)FC27 (bp)n (%)
235124 (84.4)1466 (4.01)33590 (61.2)27651 (92.7)3274 (7.3)
Negative23 (15.6)18316 (10.9)Negative57 (38.8)Negative4 (7.3)Negative51 (92.7)
20213 (8.8)
Negative112 (76.2)
Total147Total147Total147Total55Total55
Table
Table 2. Frequency (%) of allelic subfamilies of pfmsp-1 and pfmsp-2 per country.
Table 2. Frequency (%) of allelic subfamilies of pfmsp-1 and pfmsp-2 per country.
pfmsp-1 Subfamiliespfmsp-2 Subfamilies
K1MAD20RO33K1/MAD20MAD20/RO33K1/RO33K1/MAD20/RO333D7FC27
Honduras81225580484494
Nicaragua4313351529120
Total124 (84.4%)35 (23.8%)90 (61.2%)9 (6.1%)5 (3.4%)77 (52.4%)5 (3.4%)51 (92.7%)4 (7.3%)
Table
Table 3. Primers and amplification conditions for the pfmsp-1 and pfmsp-2 genes. A single band of the same size was found in all samples for each allelic family, except for MAD20.
Table 3. Primers and amplification conditions for the pfmsp-1 and pfmsp-2 genes. A single band of the same size was found in all samples for each allelic family, except for MAD20.
PCR/Allelic FamilyPrimer NamePrimer Sequence 5′-3′Annealing
Temperature		Approximate Amplicon Size
(bp)
pfmsp-11stMI-OFCTAGAAGCTTTAGAAGATGCAGTATTG54 °C>1000
MI-ORCTTAAATAGATTCTAATTCAAGTGGATCA
2nd K1K1FAAATGAAGAAGAAATTACTACAAAAGGTGC59 °C235
K1RGCTTGCATCAGCTGGAGGGCTTGCACCAGA
2nd RO33RO33FTAAAGGATGGAGCAAATACTCAAGTTGTTG58 °C335
RO33RCAAGTAATTTTGAACTCTATGTTTTAAATCAGCGTA
2nd MAD20MAD20FAAATGAAGGAACAAGTGGAACAGCTGTTAC59 °C146–202
MAD20RATCTGAAGGATTTGTACGTCTTGAATTACC
pfmsp-21stMSP2 S2GAAGGTAATTAAAACATTGTC60 °C905
MSP2 S3GAGGGATGTTGCTGCTCCACAG
2nd 3D7RvNS 3D7CTGAAGAGGTACTGGTAGA50 °C276
MSP-2 S1GCTTATAATATGAGTATAAGGAGAA
2nd FC27RvMS FC27GCATTGCCAGAACTTGAA50 °C327
MSP-2 S1GCTTATAATATGAGTATAAGGAGAA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Pinto, A.; Archaga, O.; Mejía, Á.; Escober, L.; Henríquez, J.; Montoya, A.; Valdivia, H.O.; Fontecha, G. Evidence of a Recent Bottleneck in Plasmodium falciparum Populations on the Honduran–Nicaraguan Border. Pathogens 2021, 10, 1432. https://doi.org/10.3390/pathogens10111432

AMA Style

Pinto A, Archaga O, Mejía Á, Escober L, Henríquez J, Montoya A, Valdivia HO, Fontecha G. Evidence of a Recent Bottleneck in Plasmodium falciparum Populations on the Honduran–Nicaraguan Border. Pathogens. 2021; 10(11):1432. https://doi.org/10.3390/pathogens10111432

Chicago/Turabian Style

Pinto, Alejandra, Osman Archaga, Ángel Mejía, Lenin Escober, Jessica Henríquez, Alberto Montoya, Hugo O. Valdivia, and Gustavo Fontecha. 2021. "Evidence of a Recent Bottleneck in Plasmodium falciparum Populations on the Honduran–Nicaraguan Border" Pathogens 10, no. 11: 1432. https://doi.org/10.3390/pathogens10111432

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop