STAT1-Dependent Recruitment of Ly6ChiCCR2+ Inflammatory Monocytes and M2 Macrophages in a Helminth Infection
Abstract
:1. Introduction
2. Results
2.1. Lack of STAT1 Leads to a Reduction in Susceptibility to Experimental Cysticercosis Caused by T. crassiceps
2.2. Dysregulation of Monocyte Recruitment during Early T. crassiceps Infection in STAT1−/− Mice
2.3. Monocytic Cells Recruited in STAT1+/+ Mice Express PDL-1
2.4. STAT1 Is Necessary for the Anti-Proliferative Activity of CD11b+LyC6hiLy6G− Monocytic Cells Recruited during Early Infection with T. crassiceps
2.5. Peritoneal Macrophages from STAT1−/− T. crassiceps-Infected Mice Fail to Express Characteristic M2-Genes but Are Able to Respond to IL-4 In Vitro
2.6. Impaired M2 Macrophage Polarization in T. crassiceps-Infected STAT1−/− Mice
2.7. A Similar Th2 Cytokine Profile Is Observed in Sera from Both STAT1+/+ and STAT1−/− Mice Infected with T. crassiceps
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Genotype of STAT1 Knockout Mice
4.3. Parasites and Infection
4.4. ELISA for Specific Antibodies and Cytokines
4.5. Cell Preparations and Culture Conditions
4.6. Fluorescence Activated Cell Sorting (FACS)
4.7. [3H] Thymidine Incorporation Assay
4.8. Suppression-Assays
4.9. Western Blot Assay
4.10. Polymerase Chain Reaction
4.11. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Becerra-Diaz, M.; Valderrama-Carvajal, H.; Terrazas, L.I. Signal Transducers and Activators of Transcription (STAT) family members in helminth infections. Int. J. Biol. Sci. 2011, 7, 1371–1381. [Google Scholar] [CrossRef]
- Decker, T.; Stockinger, S.; Karaghiosoff, M.; Muller, M.; Kovarik, P. IFNs and STATs in innate immunity to microorganisms. J. Clin. Investig. 2002, 109, 1271–1277. [Google Scholar] [CrossRef]
- Murphy, K.M.; Ouyang, W.; Szabo, S.J.; Jacobson, N.G.; Guler, M.L.; Gorham, J.D.; Gubler, U.; Murphy, T.L. T helper differentiation proceeds through Stat1-dependent, Stat4-dependent and Stat4-independent phases. Curr. Top. Microbiol. Immunol. 1999, 238, 13–26. [Google Scholar] [CrossRef]
- Gavrilescu, L.C.; Butcher, B.A.; Del Rio, L.; Taylor, G.A.; Denkers, E.Y. STAT1 is essential for antimicrobial effector function but dispensable for gamma interferon production during Toxoplasma gondii infection. Infect. Immun. 2004, 72, 1257–1264. [Google Scholar] [CrossRef] [Green Version]
- Mantovani, A.; Sica, A.; Sozzani, S.; Allavena, P.; Vecchi, A.; Locati, M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 2004, 25, 677–686. [Google Scholar] [CrossRef]
- Rosas, L.E.; Keiser, T.; Pyles, R.; Durbin, J.; Satoskar, A.R. Development of protective immunity against cutaneous leishmaniasis is dependent on STAT1-mediated IFN signaling pathway. Eur. J. Immunol. 2003, 33, 1799–1805. [Google Scholar] [CrossRef] [PubMed]
- Bhardwaj, N.; Rosas, L.E.; Lafuse, W.P.; Satoskar, A.R. Leishmania inhibits STAT1-mediated IFN-gamma signaling in macrophages: Increased tyrosine phosphorylation of dominant negative STAT1beta by Leishmania mexicana. Int. J. Parasitol. 2005, 35, 75–82. [Google Scholar] [CrossRef] [PubMed]
- Kulkarni, M.M.; Varikuti, S.; Terrazas, C.; Kimble, J.L.; Satoskar, A.R.; McGwire, B.S. Signal transducer and activator of transcription 1 (STAT-1) plays a critical role in control of Trypanosoma cruzi infection. Immunology 2015, 145, 225–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Terrazas, L.I. The complex role of pro- and anti-inflammatory cytokines in cysticercosis: Immunological lessons from experimental and natural hosts. Curr. Top. Med. Chem. 2008, 8, 383–392. [Google Scholar] [CrossRef] [PubMed]
- Terrazas, L.I.; Cruz, M.; Rodriguez-Sosa, M.; Bojalil, R.; Garcia-Tamayo, F.; Larralde, C. Th1-type cytokines improve resistance to murine cysticercosis caused by Taenia crassiceps. Parasitol. Res. 1999, 85, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Sosa, M.; David, J.R.; Bojalil, R.; Satoskar, A.R.; Terrazas, L.I. Cutting edge: Susceptibility to the larval stage of the helminth parasite Taenia crassiceps is mediated by Th2 response induced via STAT6 signaling. J. Immunol. 2002, 168, 3135–3139. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Sosa, M.; Saavedra, R.; Tenorio, E.P.; Rosas, L.E.; Satoskar, A.R.; Terrazas, L.I. A STAT4-dependent Th1 response is required for resistance to the helminth parasite Taenia crassiceps. Infect. Immun. 2004, 72, 4552–4560. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Sosa, M.; Satoskar, A.R.; Calderon, R.; Gomez-Garcia, L.; Saavedra, R.; Bojalil, R.; Terrazas, L.I. Chronic helminth infection induces alternatively activated macrophages expressing high levels of CCR5 with low interleukin-12 production and Th2-biasing ability. Infect. Immun. 2002, 70, 3656–3664. [Google Scholar] [CrossRef] [Green Version]
- Morales-Montor, J.; Baig, S.; Hallal-Calleros, C.; Damian, R.T. Taenia crassiceps: Androgen reconstitution of the host leads to protection during cysticercosis. Exp. Parasitol. 2002, 100, 209–216. [Google Scholar] [CrossRef]
- Becerra-Diaz, M.; Terrazas, L.I. Taenia crassiceps infection and its excreted/secreted products inhibit STAT1 activation in response to IFN-gamma. Int. J. Parasitol. 2014, 44, 613–623. [Google Scholar] [CrossRef] [PubMed]
- Reyes, J.L.; Terrazas, C.A.; Alonso-Trujillo, J.; van Rooijen, N.; Satoskar, A.R.; Terrazas, L.I. Early removal of alternatively activated macrophages leads to Taenia crassiceps cysticercosis clearance In Vivo. Int. J. Parasitol. 2010, 40, 731–742. [Google Scholar] [CrossRef]
- Dunay, I.R.; Fuchs, A.; Sibley, L.D. Inflammatory monocytes but not neutrophils are necessary to control infection with Toxoplasma gondii in mice. Infect. Immun. 2010, 78, 1564–1570. [Google Scholar] [CrossRef] [Green Version]
- Terrazas, C.; Varikuti, S.; Oghumu, S.; Steinkamp, H.M.; Ardic, N.; Kimble, J.; Nakhasi, H.; Satoskar, A.R. Ly6C(hi) inflammatory monocytes promote susceptibility to Leishmania donovani infection. Sci. Rep. 2017, 7, 14693. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carter, L.L.; Leach, M.W.; Azoitei, M.L.; Cui, J.; Pelker, J.W.; Jussif, J.; Benoit, S.; Ireland, G.; Luxenberg, D.; Askew, G.R.; et al. PD-1/PD-L1, but not PD-1/PD-L2, interactions regulate the severity of experimental autoimmune encephalomyelitis. J. Neuroimmunol. 2007, 182, 124–134. [Google Scholar] [CrossRef]
- Goni, O.; Alcaide, P.; Fresno, M. Immunosuppression during acute Trypanosoma cruzi infection: Involvement of Ly6G (Gr1(+))CD11b(+) immature myeloid suppressor cells. Int. Immunol. 2002, 14, 1125–1134. [Google Scholar] [CrossRef]
- Terrazas, L.I.; Montero, D.; Terrazas, C.A.; Reyes, J.L.; Rodriguez-Sosa, M. Role of the programmed Death-1 pathway in the suppressive activity of alternatively activated macrophages in experimental cysticercosis. Int. J. Parasitol. 2005, 35, 1349–1358. [Google Scholar] [CrossRef] [PubMed]
- Voisin, M.B.; Buzoni-Gatel, D.; Bout, D.; Velge-Roussel, F. Both expansion of regulatory GR1+ CD11b+ myeloid cells and anergy of T lymphocytes participate in hyporesponsiveness of the lung-associated immune system during acute toxoplasmosis. Infect. Immun. 2004, 72, 5487–5492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anthony, R.M.; Urban, J.F., Jr.; Alem, F.; Hamed, H.A.; Rozo, C.T.; Boucher, J.L.; Van Rooijen, N.; Gause, W.C. Memory T(H)2 cells induce alternatively activated macrophages to mediate protection against nematode parasites. Nat. Med. 2006, 12, 955–960. [Google Scholar] [CrossRef]
- Nair, M.G.; Guild, K.J.; Artis, D. Novel effector molecules in type 2 inflammation: Lessons drawn from helminth infection and allergy. J. Immunol. 2006, 177, 1393–1399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, A.; Urban, J.F., Jr.; Anthony, R.M.; Sun, R.; Stiltz, J.; van Rooijen, N.; Wynn, T.A.; Gause, W.C.; Shea-Donohue, T. Th2 cytokine-induced alterations in intestinal smooth muscle function depend on alternatively activated macrophages. Gastroenterology 2008, 135, 217–225.e1. [Google Scholar] [CrossRef] [Green Version]
- Brys, L.; Beschin, A.; Raes, G.; Ghassabeh, G.H.; Noel, W.; Brandt, J.; Brombacher, F.; De Baetselier, P. Reactive oxygen species and 12/15-lipoxygenase contribute to the antiproliferative capacity of alternatively activated myeloid cells elicited during helminth infection. J. Immunol. 2005, 174, 6095–6104. [Google Scholar] [CrossRef]
- Akira, S. Functional roles of STAT family proteins: Lessons from knockout mice. Stem Cells 1999, 17, 138–146. [Google Scholar] [CrossRef]
- Shuai, K. The STAT family of proteins in cytokine signaling. Prog. Biophys. Mol. Biol. 1999, 71, 405–422. [Google Scholar] [CrossRef]
- Najjar, I.; Fagard, R. STAT1 and pathogens, not a friendly relationship. Biochimie 2010, 92, 425–444. [Google Scholar] [CrossRef]
- Shuai, K.; Schindler, C.; Prezioso, V.R.; Darnell, J.E., Jr. Activation of transcription by IFN-gamma: Tyrosine phosphorylation of a 91-kD DNA binding protein. Science 1992, 258, 1808–1812. [Google Scholar] [CrossRef]
- Hu, X.; Park-Min, K.H.; Ho, H.H.; Ivashkiv, L.B. IFN-gamma-primed macrophages exhibit increased CCR2-dependent migration and altered IFN-gamma responses mediated by Stat1. J. Immunol. 2005, 175, 3637–3647. [Google Scholar] [CrossRef] [PubMed]
- Kurihara, T.; Warr, G.; Loy, J.; Bravo, R. Defects in macrophage recruitment and host defense in mice lacking the CCR2 chemokine receptor. J. Exp. Med. 1997, 186, 1757–1762. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuziel, W.A.; Morgan, S.J.; Dawson, T.C.; Griffin, S.; Smithies, O.; Ley, K.; Maeda, N. Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2. Proc. Natl. Acad. Sci. USA 1997, 94, 12053–12058. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gundra, U.M.; Girgis, N.M.; Gonzalez, M.A.; San Tang, M.; Van Der Zande, H.J.P.; Lin, J.D.; Ouimet, M.; Ma, L.J.; Poles, J.; Vozhilla, N.; et al. Vitamin A mediates conversion of monocyte-derived macrophages into tissue-resident macrophages during alternative activation. Nat. Immunol. 2017, 18, 642–653. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Qiu, H.; Xie, H.; Qi, Y.; Cha, H.; Qu, J.; Wang, M.; Feng, Y.; Ye, X.; Mu, J.; et al. A Schistosoma japonicum Infection Promotes the Expansion of Myeloid-Derived Suppressor Cells by Activating the JAK/STAT3 Pathway. J. Immunol. 2017, 198, 4716–4727. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, K.Y.; Lee, Y.L.; Chiang, M.H.; Wang, H.Y.; Chen, C.Y.; Lin, C.H.; Chen, Y.C.; Fan, C.K.; Cheng, P.C. Schistosoma egg antigens suppress LPS-induced inflammation in human IMR-90 cells by modulation of JAK/STAT1 signaling. J. Microbiol. Immunol. Infect. 2021, 54, 501–513. [Google Scholar] [CrossRef] [PubMed]
- Reese, T.A.; Wakeman, B.S.; Choi, H.S.; Hufford, M.M.; Huang, S.C.; Zhang, X.; Buck, M.D.; Jezewski, A.; Kambal, A.; Liu, C.Y.; et al. Helminth infection reactivates latent gamma-herpesvirus via cytokine competition at a viral promoter. Science 2014, 345, 573–577. [Google Scholar] [CrossRef] [Green Version]
Gene | Sequence Primers | Temperature °C |
---|---|---|
β-Actin forward β-Actin reverse | TTTGATGTCACGCACGATTTCC TGTGATGGTGGGAATGGGTCAG | 60 °C |
Arginase-1 forward Arginase-1 reverse | CAGAAGAATGGAAGAGTCAG CAGATATGCAGGGAGTCACC | 54 °C |
Ym-1 forward Ym-1 reverse | TCACAGGTCTGGCAATTCTTCTG TTTGTCCTTAGGAGGGCTTCCTC | 56 °C |
Fizz-1 forward Fizz-1 reverse | GGTCCCAGTGCATATGGATGAGACCATAGA CACCTCTTCACTCGAGGGACAGTTGGCAGC | 62 °C |
STAT-1 KO WT Reverse STAT-1 KO Common STAT-1 Mutant reverse | CTGATCCAGGCAGGCGTT TAATGTTTCATAGTTGGATATCAT GAGATAATTCACAAAATCAGAGAG | 52 °C |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Becerra-Díaz, M.; Ledesma-Soto, Y.; Olguín, J.E.; Sánchez-Barrera, A.; Mendoza-Rodríguez, M.G.; Reyes, S.; Satoskar, A.R.; Terrazas, L.I. STAT1-Dependent Recruitment of Ly6ChiCCR2+ Inflammatory Monocytes and M2 Macrophages in a Helminth Infection. Pathogens 2021, 10, 1287. https://doi.org/10.3390/pathogens10101287
Becerra-Díaz M, Ledesma-Soto Y, Olguín JE, Sánchez-Barrera A, Mendoza-Rodríguez MG, Reyes S, Satoskar AR, Terrazas LI. STAT1-Dependent Recruitment of Ly6ChiCCR2+ Inflammatory Monocytes and M2 Macrophages in a Helminth Infection. Pathogens. 2021; 10(10):1287. https://doi.org/10.3390/pathogens10101287
Chicago/Turabian StyleBecerra-Díaz, Mireya, Yadira Ledesma-Soto, Jonadab E. Olguín, Angel Sánchez-Barrera, Mónica G. Mendoza-Rodríguez, Sandy Reyes, Abhay R. Satoskar, and Luis I. Terrazas. 2021. "STAT1-Dependent Recruitment of Ly6ChiCCR2+ Inflammatory Monocytes and M2 Macrophages in a Helminth Infection" Pathogens 10, no. 10: 1287. https://doi.org/10.3390/pathogens10101287
APA StyleBecerra-Díaz, M., Ledesma-Soto, Y., Olguín, J. E., Sánchez-Barrera, A., Mendoza-Rodríguez, M. G., Reyes, S., Satoskar, A. R., & Terrazas, L. I. (2021). STAT1-Dependent Recruitment of Ly6ChiCCR2+ Inflammatory Monocytes and M2 Macrophages in a Helminth Infection. Pathogens, 10(10), 1287. https://doi.org/10.3390/pathogens10101287